Skip Navigation

Carcinogenesis 2007 28(1):223-231; doi:10.1093/carcin/bgl227
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kim, S.-H.
Right arrow Articles by Song, Y.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, S.-H.
Right arrow Articles by Song, Y.-S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

GADD153 mediates celecoxib-induced apoptosis in cervical cancer cells$

Su-Hyeong Kim1, Chang-Il Hwang2, Yong-Sung Juhnn2, Je-Ho Lee4, Woong-Yang Park2 and Yong-Sang Song1,3,*

1 Cancer Research Institute, Seoul National University College of Medicine 28 Yungun-Dong, Chongno-Ku, Seoul 110-744, Korea
2 Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine 28 Yungun-Dong, Chongno-Ku, Seoul 110-744, Korea
3 Department of Obstetrics and Gynecology, Seoul National University College of Medicine 28 Yungun-Dong, Chongno-Ku, Seoul 110-744, Korea
4 Molecular Therapy Research Center, Samsung Medical Center, Sungkyunkwan University School of Medicine 50 Ilwon-dong, Kangnam-ku, Seoul 135-710, South Korea

*To whom correspondence should be addressed. Tel: +82 2 2072 2822; Fax: +82 2 3668 7401; Email: yssong{at}snu.ac.kr

Abstract

Celecoxib, a selective cyclooxygenase 2 inhibitor, is known to have anti-inflammatory activity and to induce apoptosis in various types of cancer cells. Here, we examined the molecular mechanism of celecoxib-induced apoptosis in cervical cancer cell lines (HeLa, CaSki and C33A). Screening of a microarray cDNA-chip containing 225 different genes revealed that growth arrest and DNA damage inducible gene (GADD153), a transcription factor involved in apoptosis, showed the strongest differential expression following celecoxib treatment in all three cervical cancer cell lines. Notably, siRNA-induced silencing of GADD153 suppressed celecoxib-induced apoptosis in all the three cell lines, and exogenous expression of GADD153 triggered apoptosis in cervical cancer cells in the absence of other apoptotic stimuli. A luciferase reporter gene assay and mRNA stability tests revealed that expression of GADD153 was regulated at both the transcriptional and post-transcriptional levels following celecoxib treatment. The region between –649 and –249, containing an intact C/EBP-ATF binding site, was required for the basal activity and celecoxib-induced stimulation of GADD153 promoter activity. Also, mRNA stability test showed that celecoxib prolonged the half-life of GADD153 mRNA. In terms of signaling pathway, addition of the NF-{kappa}B inhibitor, N-tosyl-L phenylalanyl-chloromethyl ketone (TPCK), had no effect on GADD153 expression levels. Celecoxib treatment induced Bak expression, whereas cell treated with siGADD153 or TPCK showed lower levels of celecoxib-induced Bak up-regulation. These novel findings collectively suggest that GADD153 may play a key role in celecoxib-induced apoptosis in cervical cancer cells by regulating the expression of proapoptotic proteins such as Bak.

Abbreviations: GADD153, growth arrest and DNA damage inducible gene; TPCK, N-tosyl-L phenylalanyl-chloromethyl ketone


Introduction

Celecoxib, a selective cyclooxygenase-2 (COX-2) inhibitor commonly used to treat chronic arthritic conditions, has recently been shown to induce apoptosis in various types of cancer cells, including colon, prostate, head and neck and cervical cancers (15). Several ongoing clinical trials have been undertaken to evaluate the use of celecoxib alone or in combination with other agents for the prevention or treatment in lung cancer (6). Thus, it is important that we understand the anticancer mechanism of celecoxib with the goal of enhancing its efficacy as valuable adjunct or single agent in anticancer therapy.

Celecoxib can induce apoptosis even in COX-2 negative cells, suggesting the presence of a COX-2 independent mechanism (5,7,8). A number of studies have indicated that COX-2 independent celecoxib-induced apoptosis may occur via inactivation of Akt signaling or modulation of the mitochondria-mediated death pathway (2,9). Celecoxib is also known to cause changes in the expression of genes in the target cells. We previously reported that celecoxib treatment activated NF-{kappa}B in cervical cancer cells, resulting in Fas death receptor expression and subsequent apoptosis, whereas inhibition of NF-{kappa}B partially blocked celecoxib-induced apoptosis in these cells (5). The identification of additional celecoxib-regulated genes will provide new insight into celecoxib-related signaling mechanisms, and may facilitate the development of new celecoxib-based anticancer strategies.

Here, we sought to identify genes that might be associated with celecoxib-induced apoptosis in cervical cancer cells. Analysis of a microarray cDNA-chip allowed us to identify several genes that were up-regulated in celecoxib-treated cervical cancer cell lines (HeLa, CaSki and C33A). In repeated experiments, of the up-regulated genes, the growth arrest and DNA damage inducible gene (GADD153) was most strikingly elevated, >1.0-fold consistently, in all the three cell lines.

GADD153, also known as CHOP (CEBP homology protein), has been demonstrated to be involved in growth arrest and apoptosis following DNA damage and a variety of stresses, such as nutrient deprivation and treatment with anticancer agents (1012). Recently, Tsutsumi et al. (13) showed that induction of apoptosis by NSAID is dependent on the function of GADD153 using cells from GADD153 knockout mice.

We further evaluated the role of GADD153 expression and regulation in this system, providing important new insight into the anticancer effect of celecoxib.

Materials and methods

Cell lines and reagents
HeLa, CaSki and C33A cell lines were obtained from the American Type Culture Collection (Manassas, VA) and grown in RPMI1640 supplemented with 10% fetal bovine serum (FBS), penicillin and streptomycin (all from Invitrogen, Carlsbard, CA). Celecoxib was a generous gift from Pharmacia, Korea.

The NF-{kappa}B inhibitor N-tosyl-L phenylalanyl-chloromethyl ketone (TPCK) was purchased from Calbiochem (La Jolla, CA). Stock solutions were freshly prepared in dimethyl sulfoxide (DMSO) and added to the indicated final inhibitor concentrations. The final DMSO concentration was 0.001% and the same concentration was used as vehicle. DMSO alone (0.001%) was found to have no significant effect on cell function versus untreated cells. Propidium iodide and paclitaxel were obtained from Sigma Chemical (St Louis, MO).

Anti-GADD153 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Bak was obtained from Cell signaling (Beverly, MA). The anti-{alpha}-tubulin antibody (used as a loading control) was obtained from Sigma and the LipofectAMINE 2000 transfection reagents were purchased from Invitrogen.

cDNA microarray analysis
Total RNA was isolated with the TRIZOL reagent (Life Technologies, Gaithersberg, MD). Total RNA (40 µg) was labeled and hybridized to Human Apoptosis CHIP Version 1.1 (Takara Shuzo, Japan) as described previously (14). In brief, fluorescence-labeled target cDNA was prepared with a labeling kit (Macrogen, Korea) in the presence of fluorescent labeled dNTPs (Cy3 dUTP or Cy5 dUTP). Labeled target cDNAs were hybridized to microarray cDNA-chip for 16 h in 3x SSC at 65°C. Hybridized slides were washed at room temperature once in 0.5x SSC, 0.01% SDS for 5 min, and again in 0.06x SSC for 5 min. The Cy3 and Cy5 signals were obtained using a confocal laser scanner, and fluorescence intensity was analyzed with the IamGene v4.0 software (BioDiscovery, Swansea, UK). Data were normalized by non-linear regression (15).

Construction and transfection of the GADD153 expression vector
For transfection of the plasmid expression vector encoding human GADD153 the DNA sequence containing the GADD153 open reading frame (ORF) flanked by BamHI–XhoI restriction sites was PCR amplified from HeLa cells. Primers were designed to introduce the Kozak (underline) sequence (16) to increase translation (5'-GGG GAT CCA CCA TGG CAG CTG AGT CAT TGC CT and 5'-GGC TCG AGT CAT GCT TGG TGC AGA TTC AC). The resulting fragment was inserted into BamHI–XhoI precut pcDNA3 (Invitrogen) to generate pcDNA3-GADD153. The desired sequence was confirmed by direct DNA sequencing.

For transfection, cervical cancer cells were grown to 70% confluence and tranfected in serum-free medium for 6 h with LipofectAMINE 2000 (Invitrogen), and pcDNA3-GADD153 or empty vector (control). After 48 h, cells were harvested, washed twice with ice-cold phosphate-buffered saline (PBS), and processed for apoptosis analysis or western blot analysis.

Total RNA isolation and RT–PCR analysis
Total RNA was isolated and cDNAs were synthesized from 1 µg of total RNA using M-MLV Reverse Transcriptase (Invitrogen) with random hexamer primer. PCR was performed with specific primers (GADD153 sense 5'-GCT CTA GAG GGC TGC AGA GAT GGC-3', antisense 5'-GGA ATT CGG GAC TGA TGC TCC CA-3, ß-actin sense 5'-ACA CTG CCA TCT ACG AGC-3', antisense 5'-AGG GGC CGG ACT CGT CAT ACT-3' and GAPDH sense 5'-GAA GGT GAA GGT CGG AGT C-3', antisense 5'-GAA GAT GGT GAT GGG ATT TC-3') using the following amplication conditions: 95°C for 3 min, followed by 26 (GAPDH, ß-actin), 30 (GADD153) cycles of 95°C for 1 min, and 58°C for 1 min, and 72°C for 1 min.

Real time RT–PCR
Quantitative real time RT–PCR was performed in an iCycler IQ (Bio-Rad, Hercules, CA) using cDNA Master SYBR Green I dye (Roche, Basel, Switzerland). Threshold cycles were measured at the end of each extension step, using the second-derivative method offered by the iCycler IQ optical system software (version 3.0a, Bio-Rad Laboratories). Melting curve analysis was performed to confirm the peaks of interest in each samples. The results were normalized with regard to ß-actin mRNA levels.

Western blotting
Protein extraction was performed as described previously (5), and 50 µg of cell lysates were resolved by 12% SDS–PAGE, transferred onto nitrocellulose membrane, and immunoblotted with the indicated antibodies. Bound antibodies were detected using appropriate peroxidase-coupled secondary antibodies and visualized using an enhanced chemiluminescence detection system (Amersham, Piscataway, NJ).

Construction of silencing RNA (siRNA)
The 21 nt siRNA duplexes (GADD153, GUGGCUACUGACUACCCUC; Bak, CAACCGACGCUAUGACUCA; GFP, AAGACCCGCGCCGAGGUGAAG) were purchased from Dharmacon Research (Lafayette). The siRNA oligonucleotides were transfected with into cultured cells using LipofectAMINE2000 according to the manufacturer's recommendations. After 36 h post-transfection, the cells were treated with celecoxib (50 µM), incubated for an additional 6 h and then harvested for apoptosis analysis or western blotting.

Flow cytometry analysis of apoptotic cells
Treated cells were trypisinized and washed with cold PBS, fixed with 70% ethanol and stored at –20°C until use. The fixed cells were stained with 20 µg/ml of propodium iodide containing 10 µg/ml RNaseA and then incubated at room temperature for 30 min in the dark. The DNA content of the cells (1 x 104/experimental group) was analyzed by FACSCalibur flow cytometer using the CellQuest analysis program (BD Biosciences NorthRyde, Australia). The sub-G1 population was considered to represent apoptotic cells.

Analysis of GADD153 promoter activities
The GADD153 luciferase reporter gene construct was kindly provided by Dr P. Fafournoux (17). We introduced 5' mutations in the C/EBP-ATF, and SP-1 sites using a site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacture's instructions. The mutant C/EBP-ATF and SP-1 CHOP promoter construct was generated by substitution of TAGA for GCCC (SP-1 mutant) or CAGATC for ATTGCA (C/EBP-ATF mutant). The mutant constructs were confirmed by sequencing. For experiments, cells were seeded in 12-well culture plates with the density of 5 x 104 cells/well, incubated overnight, and then transfected with a GADD153 luciferase reporter gene construct (0.4 µg/well) and pSV-ß-galactosidase (0.1 µg/well) using LipofectAMINE 2000 reagent (Invitrogen). The cells were transferred to complete medium containing 10% FBS, 6 h post-transfection. Thirty-Six hours after transfection, cells were treated with celecoxib (50 µM), incubated for six hours, and then assayed for luciferase activities using the Bioluminescent Reporter Gene Assay System (Tropix, Bedford, MA) according to the manufacturer's instructions. The relative GADD153 promoter activities were normalized to ß-galactosidase activity.

mRNA stability assay
The half-life of GADD153 mRNA was assayed as a measure of GADD153 mRNA stability. Cervical cancer cells were incubated with celecoxib for 6 h, and then treated with 1 µg/ml of the transcription inhibitor, actinomycin D (Sigma). Samples were harvested for RNA for the indicated time points. GADD153 and GAPDH mRNA levels were quantified by real–time quantitative PCR and normalized against ß-actin. The half-lives of GADD153 and GADPH mRNA's were calculated using the Sigmaplot software (SPSS, Chicago, IL).

Results

Celecoxib induces GADD153 expression in cervical cancer cells
We previously reported that celecoxib effectively induced apoptosis in cervical cancer cells (5). Here we used a microarray cDNA-chip for detecting genes involved in apoptosis to examine differential gene expression in celecoxib-treated cervical cancer cells (HeLa, CaSki and C33A) treated with 50 µM celecoxib for 6 h.

Out of a total of 225 different genes in the microarray, selected genes were consistently up-regulated ~1.1–10-fold in repeated experiments in celecoxib-treated cells (Table 1). GADD153, a transcription factor involved in apoptosis, showed the most striking differential expression in all three cervical cancer cell lines and was thus chosen for further study. To confirm the microarry results and examine celecoxib-induced regulation of GADD153 expression, we used real-time RT–PCR and western blotting analysis to determine celecoxib-induced regulation at the level of mRNA and protein over time in these cells. Consistent with the noted increase in the mRNA (Figure 1A), GADD153 protein level (Figure 1B) increased in a time-dependent manner in celecoxib-treated cervical cancer cells.


Figure 1
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig 1 Induction of GADD153 expression by celecoxib in cervical cancer cells. (A) Cervical cancer cells were treated with celecoxib (50 µM) for the indicated times. Quantitative real-time RT–PCR was used to assess cellular GADD153 mRNA levels. The expression of mRNA of GADD153 was normalized to that of ß-actin and the ratio of GADD153 to control mRNA was calculated. (B) Whole cell lysates (50 µg) were resolved by 12% PAGE, transferred to nitrocellulose membrane and probed with antibody against GADD153. The blots were stripped and reprobed with antibody to {alpha}-tubulin to verify equal loading. The blots were representative of three independent experiments, showing similar trends. The graph represents the mean ± SD of triplicate samples from three independent experiments (*P < 0.01 versus 0 h).

 


View this table:
[in this window]
[in a new window]

 
Table 1 List of apoptotic genes up-regulated by celecoxib in three cervical cancer cell lines

 
Inhibition of celecoxib-induced apoptosis by silencing of GADD153 expression with small interfering RNA (siRNA)
To determine the importance of the GADD153 in celceoxib-induced apoptosis, we used to siRNA methodology to silence the GADD153 gene. siRNA oligonucleotide specific for GADD153 or control oligonucleotide against GFP were transiently transfected into cervical cancer cells, which were then subjected to celecoxib treatment. Western blotting revealed that transfection of cervical cancer cells with 100 nM siGADD153 effectively suppressed celecoxib-induced increases in GADD153 expression (Figure 2A). Interestingly, transfection of siRNA to suppress GADD153 decreased the apoptotic sub-G1 fraction even in the presence of celecoxib (Figure 2B). To know that siRNA for GADD153 dose not inhibit induced by other stressor without GADD153 inducing activity, we examined the effect of siGADD153 on paclitaxel-induced apoptosis for the indicated time. Paclitaxel-induced apoptosis in cervical cancer cells. Interestingly, paclitaxel-induced GADD153 expression in C33A cells, but not in HeLa cells. Western blotting revealed that transfection of C33A cells with 100 nM GADD153 siRNA effectively suppressed paclitaxel-induced GADD153 expression in C33A cells. Furthermore, the transfection of GADD153 siRNA reduced the apoptotic sub-G1 fraction in the paclitaxel-treated C33A cells, but not in HeLa cells (data not shown).


Figure 2
View larger version (40K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig 2 Inhibition of celecoxib-induced apoptosis by silencing of GADD153 expression with small interfering RNA (siRNA) Cervical cancer cells were cultured in 6-well plate and transfected with control (sictrl, 100 nM) or GADD153 small interfering RNA (siGADD153, 100 nM) for 36 h. After transfection, cells were treated with DMSO or 50 µM celecoxib for 6 h. (A) Whole cell lysates were prepared for western blotting analysis of GADD153 protein and {alpha}-tubulin. (B) Each of these groups was analyzed by flow cytometry after propidium iodide staining. The percentage of sub-G1 phase cells was determined based on the DNA content histograms and represented as the mean ± SD of triplicate samples from three independent experiments.

 
Effect of ectopic GADD153 overexpression on apoptosis in cervical cancer cell
To further determine the effect of GADD153 on apoptosis, an expression plasmid containing the full-length cDNA of GADD153 was transiently transfected into cervical cancer cells. As shown in Figure 3, GADD153 overexpression increased the apoptotic sub-G1 fraction of the cells up to 24–30%, whereas transfection with the empty vector was associated with the apoptotic sub-G1 fraction <5%. These results indicate that expression of GADD153 is capable of inducing apoptosis in cervical cancer cells in the absence of other apoptotic signals.


Figure 3
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig 3 Effect of ectopic GADD153 overexpression on apoptosis in cervical cancer cells western blot analysis of GADDD153 in cervical cancer cells transfected with the GADD153 expression plasmid (pcDNA3-GADD153) or vector control (pcDNA3) as described in Figure 1 (upper panel). The cells were also harvested for flow cytometric analysis of the percentages of cells with sub-G1 DNA content (lower panel). The blots were representative of three independent experiments showing similar trends. The percentage of sub-G1 phase cells was determined based on the DNA content histograms and represented as the mean ± SD of triplicate samples from three independent experiments (*P < 0.01 versus pcDNA3-transfected control).

 
Celecoxib treatment increase the transcriptional activity and mRNA stability of GADD153
To examine whether celceoxib increases GADD153 mRNA expression at the transcriptional or posttranscriptional level, we performed luciferase reporter gene assay and mRNA stability test.

GADD153-luciferase reporter plasmids (–954/+91, –649/+91, –249/+91, and –91/+91) were transiently transfected into cervical caner cells, which were then treated with or without 50 µM celecoxib for 6 h.

As shown in Figure 4B, the wild-type –649/+91 construct showed a ~1.5–3-fold increase in luciferase activity in celecoxib-treated cells versus untreated controls. Deletion to –649 had no significant effect of the celecoxib-induced activation of GADD153 promoter activity, whereas deletion to –249 dramatically decreased the basal and celecoxib-induced stimulation of GADD153 promoter activity in all three cell lines. Further deletions of the promoter from –249 to –91 led to additional reduction in celecoxib responsiveness and a progressive reduction of basal activities.


Figure 4
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig 4 Transcriptional and post-transcriptional regulation of GADD153 mRNA in celecoxib-treated cervical cancer cells (A) Schematic representations of the GADD153 promoter deletion and site-specific mutant constructs are presented schematically. The sequences of binding sites for transcription factor (closed bars) or mutated sites (cross symbol) are labeled accordingly. Cervical cancer cells were transfected with 400 ng of the GADD153 promoter-luciferase construct that has mutation in the indicated regions along with ß-galactosidase vector. (B and C) Thirty-six hours later, cells were incubated with celecoxib (50 µM) for six hours and luciferase activities were measured. Results are represented in relative luciferase units (RLU). (D) GADD153 mRNA stability in cervical cancer cells. The cells were treated with 50 µM celecoxib for 6 h and then transferred to medium containing celecoxib and actinomycin D (Act D, 1 µg/ml + celecoxib 50 µM), or DMSO + Act D. Total RNA was extracted at the indicated times. And GAPDH (D) and GADD153 (E) mRNA's transcripts were measured and normalized to the internal control, ß-actin. The graph represents the mean ± SD of triplicates sample from three independent experiments (*P < 0.01, ** P < 0.05).

 
These results suggest that the regulatory element(s) present between nucleotides –649 and –249 of the GADD153 promoter are responsible for mediating GADD153 gene activation in response to celecoxib. In the region from –649 to –249, two known responsive elements are present, SP-1 and C/EBP-ATF (12,17) sites. To precisely define which of these cis-acting elements is involved in celecoxib responsiveness, we transiently transfected cervical cancer cells with GADD153 promoter constructs containing site-specific mutants of each cis-acting element. As shown in Figure 4C, introduction of mutation at Sp-1 binding site had no effect on GADD153 promoter activity. C/EBP mutant construct significantly decreased the basal activity of GADD153 promoter compared with control cells. However, this C/EBP mutant construct has still inducible activity of GADD153 promoter after celecoxib treatment. These results implicate that C/EBP-ATF site is a necessary part for the basal activity of GADD153 promoter, but not important for GADD153 induction after celecoxib treatment.

Next, we tested whether mRNA stability is altered during celecoxib-induced GADD153 up-regulation, Cervical cancer cells were treated with celecoxib for 6 h (50 µM), and then replaced with fresh media containing celecoxib alone, actinomycin D (Act D 1 µg/ml) + celecoxib, or Act D + DMSO. This time is considered 0 h. RNA was extracted at subsequent time points from each group, and relative mRNA levels were calculated by comparison with ß-actin-normalized values with the level observed at time 0.

The t1/2 of GAPDH mRNA degradation was not affected by the addition of celecoxib (Figure 4D), while the t1/2 of GADD153 mRNA degradation was prolonged (HeLa, 30->52 min; CaSki, 39->90 min; C33A, 43->79 min) (Figure 4E).

Celecoxib-induced activation of GADD153 is independent of NF-{kappa}B signaling
Similar to GADD153, activation of NF-{kappa}B is a hallmark of ER stresses (18,19). In addition, NF-{kappa}B occasionally promotes apoptosis in various cancer cells (2022). We previously showed that celecoxib-induced apoptosis is mediated via NF-{kappa}B activation in cervical caner cells (5). To determine whether celecolxib-induced GADD153 expression is mediated via NF-{kappa}B activation, we examined the effect of TPCK, a serine protease inhibitor that prevents degradation of I{kappa}-B{alpha}. We used the same concentration of TPCK (0.1 µM) that was previously shown to be sufficient to attenuate celecoxib-induced apoptosis in cervical cancer cells. However, our results revealed that incubation of cells with 0.1 µM of TPCK for 1 h prior to treatment with 50 µM celecoxib had no effect on GADD153 mRNA expression (Figure 5), suggesting that celecoxib-induced activation of GADD153 is independent of NF-{kappa}B signaling.


Figure 5
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig 5 Celecoxib-induced GADD153 expression is NF-{kappa}B-independent in cervical cancer cells. Cervical cancer cells were preincubated for 1 h with TPCK (0.1 µM), treated with celceoxib (50 µM) for 6 h, and then analyzed for GADD153 mRNA levels as described in Figure 1. The results are representative of three independent experiments, showing similar trends. The bar indicates the quantitative measurement of GADD153 band intensity adjusted versus that of ß-actin (*P < 0.01 versus DMSO-treated control).

 
Celecoxib induces Bak expression in cervical cancer cells
Considerable evidence indicates that GADD153 mediates cellular response to oxidant injury, mainly by mediating ER stress (2325). Furthermore some NSAIDs can induce ER stress response including GADD153 (13), and Bak has been found to be associated with the ER-stress pathway (26,27). We therefore examined the relationship between GADD153 and Bak in celceoxib-induced apoptosis.

Western blotting analysis revealed that Bak was induced in celecoxib-treated cervical cancer cells (Figure 6A), with a time course that resembled the GADD153 response. To check the apoptotic effect of Bak induced by celecoxib, we transiently transfected siRNA oligonucleotide specific for Bak (siBak) or control oligonucleotide against GFP into cervical cancer cells, which were then treated with celecoxib. Western blotting revealed that transfection of cervical cancer cells with 100 nM siBak partially suppressed celecoxib-induced expression of Bak (Figure 6B) and also decreased the apoptotic sub-G1 fraction in the presence of celecoxib (Figure 6C).


Figure 6
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig 6 Association of BAK with GADD153 in celecoxib-induced apoptosis (A) Bak expression levels were examined in cervical cancer cells treated with celecoxib (50 µM) for the indicated times. Whole cell lysates were prepared for western blotting analysis using the indicated antibodies and the blots were stripped and reprobed with antibody to {alpha}-tubulin to verity equal loading control. (B) Cells were transfected with siRNA for Bak as described in Figure 2, treated with or without celecoxib (50 µM) for 6 h and western blotting was performed as described above. (C) Each of these groups was analyzed by flow cytometry after propidium idodide staining. The percentage of sub-G1 phase cells was determined based on DNA content histograms and represented as the mean ± SD of triplicate samples from three independent experiments. (**P < 0.05 versus sictrl-treated control). (D) Cells were transfected with siRNA for GADD153 as described in Figure 2, treated with or without celecoxib (50 µM) for 6 h and western blotting was performed as described above. (E) Cells were preincubated for 1 h with TPCK (0.1 µM), treated with celecoxib (50 µM) for 6 h, and then analyzed for Bak expression as described above. (F) Cells were transfected with siRNA for GADD153 as described in Figure 2, treated with or without TPCK 1 h prior to treatment with celecoxib for 6 h and then analyzed for Bak expression as described above.

 
To test whether GADD153 is responsible for the induction of Bak, we examined the effect of siGADD153 on celecoxib-induced Bak expression. Bak expression was reduced by 50% in cells transfected with siGADD153 (Figure 6D). This suggests that GADD153 may directly regulate at least a portion of celecoxib-induced Bak expression. However, the observation that ~50% of celecoxib-induced Bak expression remained in siGADD153-treated cells suggests that celecoxib-induced Bak expression may be mediated by other GADD153-indepednent mechanisms.

In our previous report (5), we found that TPCK, NF-{kappa}B blocker, inhibited the apoptosis by celecoxib. Also, in this study, siGADD153 inhibited the apoptosis by celecoxib to the similar degree as shown in TPCK-treated cells. However, the induction of GADD153 was not affected by TPCK (Figure 5). These three data sets seem to be contradictory. To solve this problem, we tested the effect of TPCK on Bak expression. As shown in Figure 6E, the addition of TPCK reduced the expression of Bak in celecoxib-treated cells. Additionally, the simultaneous use of TPCK and siGADD153 reduced the expression of Bak, additively (Figure 6F).

Discussion

We herein showed that GADD153 is critical for celecoxib-induced apoptosis of cervical cancer cells. Two lines of evidence support this conclusion: first, silencing of the GADD153 gene by siRNA blocked celecoxib-induced apoptosis in cervical cancer cells, and second, ectopic expression of GADD153 was sufficient to induce apoptosis in cervical cancer cells in the absence of additional apoptotic stimuli.

The GADD153, a member of the CCAAT/enhance-binding protein family of transcription factors, is a stress-induced, low molecular weight nuclear protein, also known as C/EBP homologous protein 10 (CHOP) (28,29). GADD153 can negatively regulate C/EBP transcription factors that inhibits cell progression or can act as a positive regulator of target genes (30). GADD153 expression has been associated with apoptosis in response to a number of stress stimuli, including anticancer agents, retinoic acid and nutrient deprivation (1012). In addition to its function as a transcription factor, GADD153 has been shown to mediate apoptosis through non-transcriptional pathway (10). However, few studies have sought to establish a direct link between apoptosis and GADD153 expression.

Here, we showed that GADD153 has been shown to be up-regulated during the apoptotic pathway. Interestingly, silencing of GADD153 expression blocked apoptosis in celecoxib-treated cervical cancer cells (Figure 2), indicating that GADD153 up-regulation was not merely a consequence of apoptosis. We found that siRNA for GADD153 does not inhibit apoptosis induced by other stressor, such as paclitaxel that does not have GADD153-inducing activity (data not shown). This result suggests that GADD153 may have an important role in causing apoptosis of cancer cells by other various anticancer agents.

GADD153 expression may be regulated at both the transcriptional and post-transcription levels (10,3133). GADD153 mRNA stability is reportedly increased by nutrient deprivation and anticancer agents, such as paclitaxel and etoposide (34,35). Consistent with these previous findings, we found that celecoxib treatment increased both the promoter activity of the GADD153 genes and the stability of the GADD153 mRNA. Additional luciferase assay using various deletion and substitution mutant gene constructs revealed that the region between –649 and –249, containing an intact C/EBP-ATF binding site, was required for both the basal and celecoxib-induced stimulation of GADD153 promoter activity. These results suggest that changes in GADD153 mRNA stability and promoter activity may be critically involved in celecoxib-induced apoptosis of cervical caner cells, indicating that GADD153 may be a novel therapeutic target in cervical cancer cells.

We also examined the importance of NF-{kappa}B in GADD153-mediated apoptosis, because NF-{kappa}B was previously shown to down-regulate GADD153, leading to decreased ER-stress induced apoptosis (36). In addition, we previously showed that celecoxib treatment increased the nuclear translocation of NF-{kappa}B, and enhanced apoptosis in cervical cancer cells, and that this effect could be blocked by addition of the NF-{kappa}B blocker, TPCK. Interestingly, the present study showed that GADD153 was up-regulated irrespective of the DNA binding activity of NF-{kappa}B in celecoxib-treated cells (data not shown), and addition of NF-{kappa}B blockers to celecoxib-treated cervical cancer cells had no effect on GADD153 expression. These findings suggests there is no relationship between NF-{kappa}B and GADD153, and provide evidence that the regulatory mechanism of GADD153 differ according to cell types and conditions.

Previous studies have reported association between Bcl-2 family members and GADD153-induced apoptosis (37,38). In other cells, GADD153 has important stimulatory interactions with members of the Bcl-2 family, while in other cells the induction of GADD153 results in Bcl-2 down-regulation (37). Although celecoxib treatment does not alter Bcl-2 expression (data not shown), it is possible that other Bcl-2-realted proteins are regulated in response to celecoxib. To examine this hypothesis, we investigated the expression levels of Bak, which is associated with the endoplasmic reticulum (a key molecule of action for GADD153), and can induce apoptosis in combination with BH3-domain-only members of the Bcl-2 family such as Bid (39). Our results revealed that Bak expression was induced in celecoxib-treated cells and suppression of Bak expression by siBak decreased the apoptotic sub-G1 fraction. This result supports the causality between Bak and celecoxib-induced apoptosis. In this study, NF-{kappa}B blocker, TPCK, did not affect the induction of GADD153. However, both TPCK and siRNA for GADD153 inhibit the apoptosis by celecoxib to the similar degree. We found that the addition of TPCK reduced celecoxib-induced Bak expression. Furthermore, the simultaneous use of TPCK and siGADD153 reduced Bak expression by celecoxib, additively (Figure 5). This result suggests that GADD153 and NF-{kappa}B pathways may use similar apoptotic and antiapoptotic signals through different signaling pathways. This may explain these contradictory results.

In summary, we herein show that GADD153 is critical for celecoxib-induced apoptosis in cervical cancer cells. Celecoxib-induced GADD153 expression is mediated through a region between –649 and –249 of the GADD153 promoter, and requires an intact CEBP-ATF binding site.

As GADD153 is induced by chemotherapeutics drugs in other tumor types (34,35,40) and plays a key role in drug-induced apoptosis, these findings provide important new insight into signaling involved in GADD153-induced apoptosis by celecoxib. This finding may facilitate the development of chemotherapeutic or chemopreventive strategies using celecoxib.

Footnotes

$This paper was previously published in Carcinogenesis 27(10) doi:10.1093/carcin/bgl027. This was not the final accepted paper and contained many errors. The publisher would like to apologize for this error. Back

Acknowledgments

This study was supported by the SRC program of MOST/KOSEF (R11-2000-080-09001-2) and the BK21 project for Medicine, Dentistry and Pharmacy.

Conflict of Interest Statement: None declared.

References

  1. Grosch S., Tegeder I., Niederberger E., Brautigam L., Geisslinger G. (2001) COX-2 independent induction of cell cycle arrest and apoptosis in colon cancer cells by the selective COX-2 inhibitor celecoxib. FASEB J. 15:2742–2744.[Free Full Text]
  2. Hsu A.L., Ching T.T., Wang D.S., Song X., Rangnekar V.M., Chen C.S. (2000) The cyclooxygenase-2 inhibitor celecoxib induces apoptosis by blocking Akt activation in human prostate cancer cells independently of Bcl-2. J. Biol. Chem. 275:11397–11403.[Abstract/Free Full Text]
  3. Arico S., Pattingre S., Bauvy C., Gane P., Barbat A., Codogno P., Ogier-Denis E. (2002) Celecoxib induces apoptosis by inhibiting 3-phosphoinositide-dependent protein kinase-1 activity in the human colon cancer HT-29 cell line. J. Biol. Chem. 277:27613–27621.[Abstract/Free Full Text]
  4. Hashitani S., Urade M., Nishimura N., Maeda T., Takaoka K., Noguchi K., Sakurai K. (2003) Apoptosis induction and enhancement of cytotoxicity of anticancer drugs by celecoxib, a selective cyclooxygenase-2 inhibitor, in human head and neck carcinoma cell lines. Int. J. Oncol. 23:665–672.[Web of Science][Medline]
  5. Kim S.H., Song S.H., Kim S.G., Chun K.S., Lim S.Y., Na H.K., Kim J.W., Surh Y.J., Bang Y.J., Song Y.S. (2004) Celecoxib induces apoptosis in cervical cancer cells independent of cyclooxygenase using NF-kappaB as a possible target. J. Cancer Res. Clin. Oncol. 130:551–560.[Web of Science][Medline]
  6. Bunn P.A. Jr and Keith R.L. (2002) The future of cyclooxygenase-2 inhibitors and other inhibitors of the eicosanoid signal pathway in the prevention and therapy of lung cancer. Clin. Lung Cancer 3:271–277 discussion 278.[Medline]
  7. Tegeder I., Pfeilschifter J., Geisslinger G. (2001) Cyclooxygenase-independent actions of cyclooxygenase inhibitors. FASEB J. 15:2057–2072.[Abstract/Free Full Text]
  8. Waskewich C., Blumenthal R.D., Li H., Stein R., Goldenberg D.M., Burton J. (2002) Celecoxib exhibits the greatest potency amongst cyclooxygenase (COX) inhibitors for growth inhibition of COX-2-negative hematopoietic and epithelial cell lines. Cancer Res. 62:2029–2033.[Abstract/Free Full Text]
  9. Jendrossek V., Handrick R., Belka C. (2003) Celecoxib activates a novel mitochondrial apoptosis signaling pathway. FASEB J. 17:1547–1549.[Abstract/Free Full Text]
  10. Kim D.G., You K.R., Liu M.J., Choi Y.K., Won Y.S. (2002) GADD153-mediated anticancer effects of N-(4-hydroxyphenyl)retinamide on human hepatoma cells. J. Biol. Chem. 277:38930–38938.[Abstract/Free Full Text]
  11. Carlson S.G., Fawcett T.W., Bartlett J.D., Bernier M., Holbrook N.J. (1993) Regulation of the C/EBP-related gene GADD153 by glucose deprivation. Mol. Cell. Biol. 13:4736–4744.[Abstract/Free Full Text]
  12. Bruhat A., Jousse C., Wang X.Z., Ron D., Ferrara M., Fafournoux P. (1997) Amino acid limitation induces expression of CHOP, a CCAAT/enhancer binding protein-related gene, at both transcriptional and post-transcriptional levels. J. Biol. Chem. 272:17588–17593.[Abstract/Free Full Text]
  13. Tsutsumi S., Gotoh T., Tomisato W., Mima S., Hoshino T., Hwang H.J., Takenaka H., Tsuchiya T., Mori M., Mizushima T. (2004) Endoplasmic reticulum stress response is involved in nonsteroidal anti-inflammatory drug-induced apoptosis. Cell Death Differ. 11:1009–1016.[CrossRef][Web of Science][Medline]
  14. Park W.Y., Hwang C.I., Kang M.J., et al. (2001) Gene profile of replicative senescence is different from progeria or elderly donor. Biochem. Biophys. Res. Commun. 282:934–939.[CrossRef][Web of Science][Medline]
  15. Quackenbush J. (2001) Computational analysis of microarray data. Nat. Rev. Genet. 2:418–427.[CrossRef][Web of Science][Medline]
  16. Kozak M. (1989) The scanning model for translation: an update. J. Cell. Biol. 108:229–241.[Abstract/Free Full Text]
  17. Bruhat A., Jousse C., Carraro V., Reimold A.M., Ferrara M., Fafournoux P. (2000) Amino acids control mammalian gene transcription: activating transcription factor 2 is essential for the amino acid responsiveness of the CHOP promoter. Mol. Cell. Biol. 20:7192–7204.[Abstract/Free Full Text]
  18. Chen L. and Gao X. (2002) Neuronal Apoptosis induced by endoplasmic reticulum stress. Neurochem. Res. 27:891–898.[CrossRef][Web of Science][Medline]
  19. Pahl H.L. and Baeuerle P.A. (1995) A novel signal transduction pathway from the endoplasmic reticulum to the nucleus is mediated by transcription factor NF-kappa B. EMBO J. 14:2580–2588.[Web of Science][Medline]
  20. Kucharczak J., Simmons M.J., Fan Y., Gelinas C. (2003) To be, or not to be: NF-kappaB is the answer—role of Rel/NF-kappaB in the regulation of apoptosis. Oncogene 22:8961–8982.[CrossRef][Web of Science][Medline]
  21. Kimura K. and Gelmann E.P. (2002) Propapoptotic effects of NF-kappaB in LNCaP prostate cancer cells lead to serine protease activation. Cell Death Differ. 9:972–980.[CrossRef][Web of Science][Medline]
  22. Farhana L., Dawson M.I., Fontana J.A. (2005) Apoptosis induction by a novel retinoid-related molecule requires nuclear factor-kappaB activation. Cancer Res. 65:4909–4917.[Abstract/Free Full Text]
  23. Guyton K.Z., Xu Q., Holbrook N.J. (1996) Induction of the mammalian stress response gene GADD153 by oxidative stress: role of AP-1 element. Biochem. J. 314:547–554.
  24. Oyadomari S., Koizumi A., Takeda K., Gotoh T., Akira S., Araki E., Mori M. (2002) Targeted disruption of the Chop gene delays endoplasmic reticulum stress-mediated diabetes. J. Clin. Invest. 109:525–532.[CrossRef][Web of Science][Medline]
  25. Ron D. and Habener J.F. (1992) CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription. Genes Dev. 6:439–453.[Abstract/Free Full Text]
  26. Daniel P.T. (2000) Dissecting the pathways to death. Leukemia 14:2035–2044.[CrossRef][Web of Science][Medline]
  27. Nutt L.K., Pataer A., Pahler J., Fang B., Roth J., McConkey D.J., Swisher S.G. (2002) Bax and Bak promote apoptosis by modulating endoplasmic reticular and mitochondrial Ca2+ stores. J. Biol. Chem. 277:9219–9225.[Abstract/Free Full Text]
  28. Wang X.Z., Kuroda M., Sok J., Batchvarova N., Kimmel R., Chung P., Zinszner H., Ron D. (1998) Identification of novel stress-induced genes downstream of chop. EMBO J. 17:3619–3630.[CrossRef][Web of Science][Medline]
  29. Matsumoto M., Minami M., Takeda K., Sakao Y., Akira S. (1996) Ectopic expression of CHOP (GADD153) induces apoptosis in M1 myeloblastic leukemia cells. FEBS Lett. 395:143–147.[CrossRef][Web of Science][Medline]
  30. Beda M., Vallejo M., Habener J.F. (1999) CHOP enhancement of gene transcription by interactions with Jun/Fos AP-1 complex proteins. Mol. Cell. Biol. 19:7589–7599.[Abstract/Free Full Text]
  31. Choi A.M., Tucker R.W., Carlson S.G., Weigand G., Holbrook N.J. (1994) Calcium mediates expression of stress-response genes in prostaglandin A2-induced growth arrest. FASEB J. 8:1048–1054.[Abstract]
  32. Jackman J., Alamo I. Jr, Fornace A.J. Jr. (1994) Genotoxic stress confers preferential and coordinate messenger RNA stability on the five gadd genes. Cancer Res. 54:5656–5662.[Abstract/Free Full Text]
  33. Ubeda M., Schmitt-Ney M., Ferrer J., Habener J.F. (1999) CHOP/GADD153 and methionyl-tRNA synthetase (MetRS) genes overlap in a conserved region that controls mRNA stability. Biochem. Biophys. Res. Commun. 262:31–38.[CrossRef][Web of Science][Medline]
  34. Eymin B., Dubrez L., Allouche M., Solary E. (1997) Increased GADD153 messenger RNA level is associated with apoptosis in human leukemic cells treated with etoposide. Cancer Res. 57:686–695.[Abstract/Free Full Text]
  35. Gately D.P. and Howell S.B. (1996) Paclitaxel activation of the GADD153 promoter through a cellular injury response element containing an essential Sp1 binding site. J. Biol. Chem. 271:20588–20593.[Abstract/Free Full Text]
  36. Nozaki S., Sledge G.W. Jr, Nakshatri H. (2001) Repression of GADD153/CHOP by NF-kappaB: a possible cellular defense against endoplasmic reticulum stress-induced cell death. Oncogene 20:2178–2185.[CrossRef][Web of Science][Medline]
  37. McCullough K.D., Martindale J.L., Klotz L.O., Aw T.Y., Holbrook N.J. (2001) Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state. Mol. Cell. Biol. 21:1249–1259.[Abstract/Free Full Text]
  38. Tombal B., Weeraratna A.T., Denmeade S.R., Isaacs J.T. (2000) Thapsigargin induces a calmodulin/calcineurin-dependent apoptotic cascade responsible for the death of prostatic cancer cells. Prostate 43:303–317.[CrossRef][Web of Science][Medline]
  39. Korsmeyer S.J., Wei M.C., Saito M., Weiler S., Oh K.J., Schlesinger P.H. (2000) Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Differ. 7:1166–1173.[CrossRef][Web of Science][Medline]
  40. Gately D.P., Jones J.A., Christen R., Barton R.M., Los G., Howell S.B. (1994) Induction of the growth arrest and DNA damage-inducible gene GADD153 by cisplatin in vitro and in vivo. Br. J. Cancer 70:1102–1106.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
C. Zang, H. Liu, J. Bertz, K. Possinger, H. P. Koeffler, E. Elstner, and J. Eucker
Induction of endoplasmic reticulum stress response by TZD18, a novel dual ligand for peroxisome proliferator-activated receptor {alpha}/{gamma}, in human breast cancer cells
Mol. Cancer Ther., August 1, 2009; 8(8): 2296 - 2307.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
D. Zhang, L. Qiu, X. Jin, Z. Guo, and C. Guo
Nuclear Factor-{kappa}B Inhibition by Parthenolide Potentiates the Efficacy of Taxol in Non-Small Cell Lung Cancer In vitro and In vivo
Mol. Cancer Res., July 1, 2009; 7(7): 1139 - 1149.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. N. Mungrue, J. Pagnon, O. Kohannim, P. S. Gargalovic, and A. J. Lusis
CHAC1/MGC4504 Is a Novel Proapoptotic Component of the Unfolded Protein Response, Downstream of the ATF4-ATF3-CHOP Cascade
J. Immunol., January 1, 2009; 182(1): 466 - 476.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
L. Ou, Y. Wu, C. Ip, X. Meng, Y.-C. Hsu, and M. M. Ip
Apoptosis induced by t10,c12-conjugated linoleic acid is mediated by an atypical endoplasmic reticulum stress response
J. Lipid Res., May 1, 2008; 49(5): 985 - 994.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kim, S.-H.
Right arrow Articles by Song, Y.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, S.-H.
Right arrow Articles by Song, Y.-S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?