Carcinogenesis Advance Access originally published online on June 4, 2007
Carcinogenesis 2007 28(10):2114-2121; doi:10.1093/carcin/bgm133
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Induction of death receptor 5 and suppression of survivin contribute to sensitization of TRAIL-induced cytotoxicity by quercetin in non-small cell lung cancer cells
Molecular Biology and Lung Cancer Program, Lovelace Respiratory Research Institute, 2425 Ridgecrest Drive Southeast, Albuquerque, NM 87108, USA
1 Laboratory of Molecular and Translational Medicine, West China Second University Hospital, Sichuan University, Chengdu 610041, China
* To whom correspondence should be addressed. Tel: +1 505 348 9645; Fax: +1 505 348 4990; Email: ylin{at}lrri.org
| Abstract |
|---|
|
|
|---|
The natural flavonoid quercetin has been suggested by epidemiological studies to have preventive activity against lung cancer; however, the mechanism of which has not been well elucidated. In this report, we demonstrate that quercetin significantly enhances tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced cytotoxicity in non-small cell lung cancer (NSCLC) cells. Quercetin increased expression of death receptor (DR) 5, whereas it had no effect on that of other components of the death-inducing signaling complex. Conversely, the expression of survivin was potently inhibited by quercetin. We further determined that Protein Kinase C (PKC) is essential for DR5 induction but is dispensable for suppression of survivin expression. In contrast, the blockage of the serine/threonine kinase Akt activity by quercetin is important for inhibition of survivin expression but not induction of DR5. These results suggest the pathways for regulation of DR5 and survivin expression by quercetin are distinct. Importantly, suppression of survivin-sensitized TRAIL-induced cell death and blockage of DR5 expression suppressed the synergistic cytotoxicity induced by quercetin and TRAIL co-treatment. On the whole, our data show that quercetin sensitizes TRAIL-induced cytotoxicity in lung cancer cells through two independent pathways: induction of DR5 and suppression of survivin expression, which may underlie the mechanism of the lung cancer preventive activity of quercetin. The potentiation of TRAIL-induced NSCLC cell death could be implicated in lung cancer therapy and prevention.
Abbreviations: Akt-DN, Akt dominant-negative mutant; DcR, decoy receptor; DR, death receptor; IAP, inhibitor of apoptosis protein; JNK, c-Jun N-terminal kinase; LDH, lactate dehydrogenase; NF-
B, nuclear factor-
B; NSCLC, non-small cell lung cancer; PARP, poly (ADP-ribose) polymerase; TNF, tumor necrosis factor; TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; siRNA, small interfering RNA
| Introduction |
|---|
|
|
|---|
Lung cancer is the leading cause of cancer-related mortality in USA (1,2). Most lung cancer patients are diagnosed at late stages of the disease when surgery is not a viable option. Chemotherapy and radiation therapy, as well as a combination of both therapies, are used in an attempt to reduce tumor mass and halt disease progression. However, because such therapies are usually ineffective, the prognosis is very poor for most lung cancer patients (3). Therefore, development of effective prevention and therapy agents against lung cancer is critical for reducing mortality.
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) belongs to the tumor necrosis factor (TNF) superfamily that includes TNF, Fas ligand, lymphotoxin, CD27L, OX40, CD30L and CD40L (4). TRAIL is the most potential anticancer agent in the TNF superfamily due to its selective cytotoxicity in transformed cells. Endogenous TRAIL contributes to elimination of transformed cells (5), thus may play an important role in cancer prevention. The mechanism of the selective cytotoxicity in transformed cells of TRAIL is not well elucidated, but may be related to a high expression of decoy TRAIL receptors in normal cells (4). There are four main TRAIL receptors identified: death receptor (DR) 4/TRAIL-RI, DR5/TRAIL-R2, decoy receptor (DcR) 1/TRAIL-R3 and DcR2/TRAIL-R4. Like TNF receptor 1, DR4 and DR5 are DRs that contain a death domain in their cytoplasmic region and are able to mediate cell death (4). They are also able to transduce signals leading to activation of transcriptional factor nuclear factor-
B (NF-
B) and c-Jun N-terminal kinase (JNK) (6,7). Lacking a cytoplasmic region, DcR1 cannot transduce signals into the cell. DcR2 has a truncated death domain that is incapable in transmitting the death signal but it is still able to mediate NF-
B and JNK activation (4). Both DcR1 and DcR2 function as DcRs to block TRAIL-induced apoptosis (4). In addition, osteoprotegerin, which was originally identified as a regulator of bone density, is able to bind to TRAIL (4).
Similar to TNF-R1, TRAIL receptors transduce signals by forming a death-inducing signal complex consisting of TRAIL receptors. TNFR-1 associated death domain protein (TRADD), receptor-interacting protein (RIP), TNFR-associated factor 2 (TRAF2) and fas associated death domain (FADD) (4). TRAIL induces RIP-dependent NF-
B activation, an anti-apoptotic signal (6). The role of JNK activation through RIP and TRAF2 in cell death regulation is somewhat controversial (8,9). TRAIL-induced apoptosis is initiated by FADD-mediated activation of caspase-8. Activated caspase-8 then cleaves and activates the effector caspase-3 and -7 to initiate apoptosis (10). In addition, there is an amplification loop for the apoptotic signal through caspase-8-mediated cleavages of BID, a Bcl-2 homology (BH)3-only member of the Bcl-2 family, to generate an apoptotic product tBID that activates the mitochondrial apoptosis pathway. This process causes release of cytochrome C and Smac from mitochondria to cytosol to activate caspase-9 (10). The inhibitor of apoptosis proteins (IAPs), including cIAP1, cIAP2, X chromosome encoded IAP (XIAP) and survivin, negatively regulates the TRAIL-induced apoptosis through inhibiting caspases (10).
Although TRAIL is a promising therapeutic candidate for cancer therapy, numerous cancer cells are insensitive to TRAIL-induced cytotoxicity. The mechanism of TRAIL resistance in cancer cells has been attributed to dysfunction of different steps in the signaling pathways of TRAIL-induced apoptosis and/or elevation of survival signals. The former includes suppressed expression of the DRs, FADD or caspase-8 by mutation or imprinting. The survival signals consist of over-expression of cellular FADD-like interleukin-1-converting enzyme-inhibitory protein (c-FLIP), Bcl-2 or Bcl-XL and IAPs or activation of NF-
B (11). Modulation of these points would sensitize TRAIL-induced apoptosis in cancer cells.
Quercetin (3,3',4',5,7-pentahydroxyflavone) is one of the most abundant flavonoids found in vegetables and fruits. In the past two decades, flavonoids have been shown to have anti-oxidative, antiviral, antitumor and anti-inflammatory activities (12,13). Epidemiological studies suggest that dietary intake of flavonoids, including quercetin, is conversely associated with risk of lung, prostate, stomach and breast cancer (14–16). Quercetin is particularly implied in the prevention of lung cancer (16–18). In addition, the anticancer activity of quercetin has been demonstrated, which is attributed to its ability to induce DNA damage, cell-cycle arrest and apoptosis (19–21). In this study, we found that quercetin potently sensitizes TRAIL-induced apoptosis in non-small cell lung cancer (NSCLC) cells through PKC-mediated DR5 induction and blockage of Akt-mediated survivin expression, which may underlie the mechanism of the lung cancer preventive activity of quercetin. The results also suggest that a combination of quercetin and TRAIL could be an effective approach to increase the therapeutic efficacy of TRAIL for lung cancer therapy.
| Materials and methods |
|---|
|
|
|---|
Reagents
Quercetin dihydrate and anti-ß-actin were purchased from Sigma (St Louis, MO). The JNK inhibitor SP600125 and PKC inhibitor Gö6976 were from Calbiochem (La Jolla, CA). Anti-Akt, -survivin, -FADD, -TRAF2, -cIAP1 and -cIAP2 were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-phosphorylated-Akt and -XIAP and survivin small interfering RNA (siRNA) were from Cell Signaling (Beverly, MA). Anti-caspase-8 and -caspase-3 (active form) were from PharMingen (San Diego, CA). Anti-poly (adenosine diphosphate-ribose) polymerase (PARP) was from Biomol (Plymouth Meeting, PA). Anti-DR4, -DR5, -DcR1 and -DcR2 were from BioSource (Camarillo, CA). Recombinant GST-TRAIL has been described previously (22,23). pcDNA-Akt-DN is a kind gift from Dr David Stokoe (24). DR5 siRNA and scrambled siRNA control were from Ambion (Austin, TX).
Cell culture and transfection
Human NSCLC cell lines H460, A549, H2009 and H1299 were obtained from American Type Culture Collection (Manassas, VA). The cells were maintained in RPMI 1640 supplemented with 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin. HCCBE-2 and -3 human bronchial epithelial cells immortalized by insertion of cyclin-dependent kinase 4 and human telomerase reverse transcriptase were provided by Drs Jerry Shay and John Minna (University of Texas Southwestern Medical Center) and cultured in keratinocyte serum-free medium on collagen-coated plates (25). For stable transfection of dominant-negative Akt, the plasmid was transfected into A549 and H460 cells with FuGene 6 (Roche, Indianapolis, IN) and selected and maintained in selection medium with G418. siRNA was transfected with INTERFERinTM according to the manufacturer's instructions (PolyPlus-Transfection, San Marcos, CA). For western blotting, whole-cell protein was collected 24 h after transfection. For cell death analysis, 24 h post-transfection cells were treated as indicated in figure legends for an additional 24 h. Cell death was detected by lactate dehydrogenase (LDH) assay.
Cell death assays
Cytotoxicity was determined with a LDH release-base cytotoxicity detection kit according to the manufacturer's instruction (Promega, Madison, WI) (26). Cells were seeded in 48-well plates at 70–80% confluence, cultured overnight and then treated as indicated in figure legends. Culture supernatant from each well was collected and transferred to 96-well plates. After adding equal volumes of reaction mixture and incubating up to 30 min, the absorbance of the sample was read at 490 nm using a plate reader. Experiments were done in quadruplicate and repeated to confirm the results. Cell death was calculated using the formula:
|
|
Microscopy
For morphological study of cell death, H460 cells cultured on cover slips were pretreated with quercetin (40 µM) for 30 min followed by TRAIL (25 ng/ml) treatment for 6 h or remained untreated. The cells were stained with 50 µg/ml of acridine orange and 50 µg/ml of ethidium bromide, immediately visualized and photographed under a fluorescent microscope (27). For quantification of apoptosis, >500 cells of each sample were counted for apoptotic cells under a fluorescence microscope. Dead cells showed typical apoptotic features including cell shrinkage, cell membrane blebbing and nuclear condensation were considered apoptotic. Percentages of apoptotic cells in each sample were calculated.
Western blot
Cells were lysed in M2 buffer (20 mM Tris–HCl, pH 7.6, 0.5% NP-40, 250 mM NaCl, 3 mM ethylenediaminetetraacetic acid, 3 mM ethyleneglycol-bis(aminoethylether)-tetraacetic acid, 2 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 20 mM ß-glycerophosphate, 1 mM sodium vanadate and 1 µg/ml leupeptin). Equal amounts of cell extracts were resolved by 10–15% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and analyzed by Western blot. The proteins were visualized by enhanced chemiluminescence (Amersham, Piscataway, NJ) (28). Each experiment was repeated at least three times and representative results are shown in each figure.
Reverse transcription–polymerase chain reaction
Total RNA was extracted with the RNAeasy kit (Qiagen, Valencia, CA). One microgram of RNA from each sample was used as a template for cDNA synthesis with a reverse transcription kit (Promega). An equal volume of cDNA product was used in the polymerase chain reaction. The primers used were as follows: DR4, TTGTGTCCACCAGGATCTCA and GTCACTCCAGGGCGTACAAT; DR5, ACTCCTGGAATGACTACCTG and ATCCCAAGTGAACTTGAGCC and ß-actin, CCAGCCTTCCTTCCTGGGCAT and AGGAGCAATGATCTTGATCTTCATT. The reaction conditions were 94°C, 40 s; 52°C, 40 s and 72°C, 40 s for 27 cycles. Polymerase chain reaction products were run on 1% agarose gel with 0.5 µg/ml ethidium bromide, visualized and photographed.
Statistics
Data are expressed as means ± SDs. Statistical significance was examined by two-way analysis of variance pairwise comparison. In all analyses, P < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
Quercetin potentiates TRAIL-induced cytotoxicity in NSCLC cells
To explore the possibility of sensitizing TRAIL-induced cytotoxicity in human NSCLC cells by quercetin, we treated H460 cells with quercetin for 30 min followed by co-exposure the cells to TRAIL and quercetin for 24 h. Cell death was detected with a LDH release assay. The H460 cell line is moderately sensitive to TRAIL-induced cytotoxicity (Figure 1A). However, pretreatment with quercetin significantly triggered the TRAIL-induced cytotoxicity. This was shown by treating the cells with increasing concentrations of either TRAIL or quercetin with a fixed concentration of the other (Figure 1A and B). Quercetin alone also caused a moderate cytotoxicity in H460 cells at higher concentrations (Figure 1B). Because quercetin at 40 µM exerted limited cytotoxicity by itself but significantly potentiated TRAIL-induced cell death, this concentration of quercetin was used in later experiments. To determine whether the potentiation of TRAIL-induced cytotoxicity by quercetin is common in NSCLC cells, three additional human lung cancer cell lines, A549, H2009 and H1299, were tested similarly. All these cell lines are insensitive to TRAIL-induced cytotoxicity (Figure 1C). However, when TRAIL treatment followed exposure to quercetin, a synergistic cytotoxicity was detected in all the three NSCLC cell lines (Figure 1C). We further addressed whether treatment with quercetin, TRAIL or both would be toxic to non-transformed lung epithelial cells. HCCBE-2 and HCCBE-3, immortalized human bronchial epithelial cell lines, were tested. As shown in Figure 1D, both quercetin (40 µM) and TRAIL (25–100 ng/ml) were not toxic to these immortalized cells. Importantly, although co-treatment with quercetin and TRAIL effectively killed H460 cells, it caused marginal cytotoxicity in HCCBE-2 and HCCBE-3 cells, suggesting that the combination of quercetin and TNF may selectively kill malignant cells.
|
The sensitization of TRAIL-induced cytotoxicity by quercetin is associated with apoptosis
TRAIL-induced cancer cell death is mainly apoptotic (4). We next examined whether cell death caused by TRAIL plus quercetin is associated with apoptosis. H460 cells were treated with TRAIL, quercetin or both for 6 h. The cells were stained with acridine orange–ethidium bromide and observed microscopically. Under this condition, TRAIL or quercetin individually caused little cell death. However, co-treatment with TRAIL and quercetin induced significant cell death. The dead cells showed typical apoptotic features including cell shrinkage, cell membrane blebbing and nuclear condensation (Figure 2A and B). The cleavage of caspase-8 and -3, as well as the caspase-3 substrate PARP, a hallmark of DR-mediated apoptosis (4), was examined by Western blot. As shown in Figure 2C, quercetin did not cause detectable caspase activation whereas TRAIL alone induced a moderate activation of caspase-8 and -3 and cleavage of PARP. Although quercetin did not affect TRAIL-induced caspase activation at the 2 h time point, it markedly triggered TRAIL-induced activation of caspase-8 and -3 and cleavage of PARP started at 4 h after treatment. Furthermore, the pan-caspase inhibitor z-VAD-fmk effectively suppressed cytotoxicity induced by quercetin and TRAIL co-treatment (Figure 2D). Taken together, these data suggest that quercetin sensitizes TRAIL-induced apoptosis in H460 cells.
|
Quercetin-induced DR5 expression contributes to its sensitization of TRAIL-induced cytotoxicity in NSCLC cells
Because quercetin enhanced the activation of the initiator caspase-8, it is probable that quercetin targets an early step in the TRAIL-induced apoptosis pathway. Therefore, we examined whether quercetin treatment impacts expression of the TRAIL death-inducing signal complex component. In both H460 and A549 cells, quercetin stimulated the expression of DR5 starting at 4 h after treatment, while there was marginal effect on the expression of DR4, DcR1 and DcR2. Expression of RIP, TRAF2, TRADD and FADD was not affected by quercetin (Figure 3A, data not shown). The results suggested that DR5 is specifically induced by quercetin. Treatment with quercetin increased both the messenger RNA and protein level of DR5 (Figure 3A and B), suggesting that quercetin activates DR5 expression on the messenger RNA level presumably through transcription. Interestingly, quercetin did not induce DR5 expression in HCCBE-3 and -2 cells (Figure 3C, data not shown).
To determine if induction of DR5 is responsible for quercetin in sensitizing TRAIL-induced cytotoxicity, we used siRNA to block DR5 expression in H460 cells. A scrambled siRNA was used as a negative control. The DR5 siRNA specifically suppressed quercetin-induced DR5 expression and inhibited the synergistic cytotoxicity induced by quercetin and TRAIL co-treatment. In contrast, the scrambled siRNA control did not affect quercetin and TRAIL co-treatment-induced cell death (Figure 3D and E). Therefore, induction of DR5 contributes to one of the mechanisms by which quercetin sensitizes TRAIL-induced cell death.
|
Quercetin-induced DR5 expression involves PKC
NF-
B is involved in DR5 induction by diverse stimuli in different cells (29,30). However, quercetin did not affect NF-
B activity in NSCLC cells (data not shown). Because PKC
is involved in sensitization of Fas-induced apoptosis by quercetin (31), we examined whether PKC is involved in quercetin-induced DR5 expression. The treatment with the PKC inhibitor Gö6976, a relative specific inhibitor for classic PKC (
, ß1), reduced basal expression of DR5, suggesting that the constitutive PKC activity contributes to DR5 expression. Remarkably, Gö6976 potently suppressed the quercetin-induced DR5 expression (Figure 4A). Quercetin treatment had little effect on PKC activation (data not shown), suggesting that the constitutive PKC activity is required for quercetin-induced DR5 expression. Importantly, pre-exposure of Gö6976 also suppressed the synergistic cytotoxicity induced by quercetin and TRAIL. As a negative control, the JNK inhibitor SP600125 had no effect on cell death induced by quercetin and TRAIL (Figure 4B). These results suggest that PKC, possibly PKC
, mediates quercetin-induced DR5 expression, which in turn contributes to the sensitization of TRAIL-induced cytotoxicity by quercetin.
|
Inhibition of Akt by quercetin is involved in the synergistic cytotoxicity induced by quercetin and TRAIL
Quercetin is a potent phosphoinositide 3 kinase (PI3K)–Akt pathway inhibitor and Akt has been shown to contribute to TRAIL resistance (32,33). In H460, A549 and H1299 cells, quercetin treatment effectively blocked Akt activity, which was shown as a reduced level of phosphorylated Akt (Figure 5A, data not shown). To examine the role of Akt in TRAIL-induced cell death, stable transfection of Akt dominant-negative mutant (Akt-DN) in H460 and A549 cells was established (34). The Akt-DN partially blocked the endogenous Akt activity (Figure 5B, data not shown). The sensitivity to TRAIL-induced cell death in Akt-DN-transfected cells was markedly increased compared with their parental A549 or H460 cells (Figure 5C, data not shown). These results imply that Akt plays a role in resistance to TRAIL-induced cell death, and inhibition of Akt by quercetin may contribute to its effect in sensitizing TRAIL's cytotoxicity in lung cancer cells. Notably, the inhibition of Akt is unlikely related to induction of DR5 expression by quercetin, which is demonstrated by the result that there is normal quercetin-induced DR5 expression in the Akt-DN-transfected cells (Figure 5D), suggesting that Akt mediates a pathway for TRAIL resistance that is independent of induction of DR5 (see below).
|
Inhibition of Akt-mediated survivin expression by quercetin is involved in potentiation of TRAIL-induced cell death
We further examined the effect of quercetin on the anti-apoptotic pathways. The expression of the caspase-8 inhibitor c-FLIP was not affected by quercetin (Figure 6A). Then, we examined the expression of the IAP family proteins, another group of proteins involved in TRAIL resistance (11). Quercetin treatment significantly suppressed survivin expression, which was detected as early as 4 h. In contrast, the expression of other IAP family members, i.e. c-IAP1, c-IAP2 and XIAP were not altered by quercetin (Figure 6A). The suppression of survivin expression by quercetin is associated with the protein degradation pathway, because the decrease of survivin level was reversed by proteasome inhibitor MG132 (Figure 6B). In HCCBE-2 and -3 cells, survivin is expressed at a low level. It is remarkable that quercetin had no detectable effect on survivin expression in these untransformed cells (Figure 6C).
|
Because Akt regulates survivin expression (35,36), we examined whether quercetin suppresses survivin via inhibition of Akt. The suppression of Akt by LY294002 was accompanied by a reduction of survivin, akin to the effect of quercetin (Figure 6D). Interestingly, LY294002 had no effect on DR5 expression (Figure 6D), suggesting that the induction of DR5 is not associated with suppression of Akt. The expression of survivin controlled by Akt was further confirmed in Akt-DN-transfected cells, in which survivin was expressed at a lower level compared with the wild-type (WT) cells (Figure 6E). It is unlikely that PKC plays a role in quercetin's effect on survivin expression because PKC inhibitor Gö6976 did not affect the level of survivin in quercetin-treated cells (Figure 6F). These results suggest that quercetin induces DR5 and suppresses survivin expression through distinct pathways. Furthermore, suppressing the expression of survivin in H460 cells by survivin siRNA enhanced TRAIL-induced cytotoxicity (Figure 6G and H), suggesting that suppression of survivin underlies one of the mechanisms by which quercetin potentiates TRAIL-induced cytotoxicity in lung cancer cells.
| Discussion |
|---|
|
|
|---|
In this report, we demonstrate that quercetin is capable of sensitizing lung cancer cells to TRAIL-induced apoptosis. The potentiation of TRAIL-induced cytotoxicity by quercetin is achieved by two distinct pathways: PKC-mediated induction of DR5 and suppression of Akt-mediated survivin expression. This conclusion is supported by the following evidence: First, quercetin induced profound DR5 expression in lung cancer cells, which was effectively blocked by PKC inhibitor but not PI3K–Akt inhibitor or the Akt-DN. Second, quercetin induced survivin degradation, which was dependent on suppression of Akt but did not involve PKC. Third, blockage of DR5 induction effectively suppressed the synergistic cytotoxicity induced by TRAIL and quercetin. Lastly, suppression of survivin sensitized TRAIL-induced cytotoxicity. Our results indicate that the combination of quercetin and TRAIL would greatly improve the potency of TRAIL as a lung cancer therapeutic agent. Furthermore, quercetin, TRAIL or combination of both is not toxic in untransformed bronchial epithelial cells (HCCBE-2 and -3), suggesting that combination of quercetin and TRAIL could be a useful therapeutic approach for lung cancer therapy.
Tipping the balance from life to death of TRAIL signaling by either stimulating the pro-apoptotic signals or suppressing the survival signals could sensitize cancer cells to TRAIL-induced cytotoxicity in cancer cells (11). The former is often achieved through induction of TRAIL receptors (29,30) or the enhanced mitochondrial apoptosis pathway. The latter can be achieved by blockage of the NF-
B pathway (22,23,26). In addition, suppression of the caspase-8 inhibitor c-FLIP and the IAP members survivin and XIAP is also reported (37,38). It is remarkable that quercetin concurrently activates the pro-apoptotic pathway through induction of DR5 expression and suppresses the anti-apoptotic pathway through induction of survivin degradation. Along with the results in HCCBE cells, the induction of DR5 and suppression of survivin are well correlated with cytotoxicity in NSCLC cells, further strengthen the conclusion that these two pathways play a critical role in the sensitization of TRAIL's anticancer efficacy by quercetin. Thus, quercetin could be an ideal adjuvant therapeutic agent for TRAIL.
DR5 can be induced by a number of stimuli, including DNA damage and certain drugs (39). The mechanism is often associated with activated transcription of the dr5 gene. In this study, we show evidence that quercetin induces DR5 expression through a PKC-mediated mechanism. The stimulation of DR5 expression appears to be one of the major mechanisms underlying the potentiation of the cytotoxicity of TRAIL by quercetin in lung cancer cells, because this potentiation was effectively attenuated by knockdown DR5 expression by DR5 siRNA.
PKC is a group of serine/threonine kinases that are activated by numerous stimuli and is important in regulating cell proliferation, survival and death. PKC could be either apoptotic or anti-apoptotic, depending on cell types and the nature of its inducers (40,41). Although quercetin was reported to have inhibitory effect on PKC activity in certain cell types (42), we observed no detectable effect of this drug on the activity of PKC
and ß in lung cancer cells. Nevertheless, we found the constitutive PKC activity is required for quercetin-induced DR5 expression, which results in enhancement of TRAIL-induced cytotoxicity. Because Gö6976 is a relative specific inhibitor for PKC
and PKCß1, the effective blockage of quercetin-induced DR5 expression by this chemical suggests that PKC
or ß1 is the PKC isoform involved in this reaction. Indeed, classic PKC isoforms (PKC
, ß and
) have been found to be required for DR5 expression (43). Notably, quercetin promoted Fas-mediated apoptosis through facilitating the Fas ligand-induced PKC
activation in an acute lymphoblastic leukemia cell line (31). Therefore, it is remained to be determined if quercetin induces DR5 expression through PKC
.
The Akt–survivin pathway has been well defined and implicated in the resistance of cancer cells to therapeutics and TRAIL (33). As a potent Akt inhibitor, quercetin has been shown to suppress survivin expression in bladder cancer cells (44). A recent report showed that a quercetin derivative, methyl dihydro quercetin, also suppressed survivin expression in leukemia cells (45). Consistent with these reports, we demonstrate here that quercetin potently suppressed survivin expression in lung cancer cells. The inhibitory effect of quercetin on survivin expression appears to be resulted from suppression of Akt activity, because blockage of Akt by either chemical inhibitors or the Akt-DN similarly decreased survivin expression. Importantly, survivin siRNA sensitized the cytotoxicity induced by TRAIL. Therefore, suppression of survivin expression appears to be another mechanism by which quercetin potentiates TRAIL-induced apoptosis in lung cancer cells.
In this study, we demonstrate that quercetin sensitizes TRAIL-induced apoptosis in lung cancer cells through two independent pathways: induction of DR5 through PKC and suppression of Akt-mediated survivin expression. Because endogenous TRAIL plays an important role in eliminating transformed cells (5), the potentiation of TRAIL-induced lung cancer cell death by quercetin may underlie the mechanism of the lung cancer preventive activity of quercetin. The results also suggest that the combination of quercetin and TRAIL could be an effective approach for lung cancer therapy. It has been noticed recently that TRAIL could promote TRAIL-resistant cancer cell proliferation and metastasis (46). Thus, sensitization of TRAIL-induced cytotoxicity in cancer cells by a combination of TRAIL and quercetin may be particularly relevant in retaining the cancer-killing activity and circumventing the cancer-promoting potential of TRAIL. In vivo experiments with animal models are needed to verify the efficacy of the TRAIL and quercetin combination for lung cancer therapy.
| Supplementary material |
|---|
|
|
|---|
Supplementary Figure S1 can be found at http://carcin.oxfordjournals.org/.
| Funding |
|---|
|
|
|---|
National Institutes of Health/National Cancer Institute (R03 CA125796).
| Acknowledgments |
|---|
We would like to thank Dr David Stokoe, University of California, San Francisco for providing pcDNA-Akt-DN; Drs Jerry Shay and John Minna, University of Texas Southwestern Medical Center for the HCCBE-2 and -3 cells; and Drs Steven A. Belinsky, Lovelace Respiratory Research Institute and Honglian Shi, University of New Mexico for helpful discussions.
Conflicts of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Jemal A, et al. Cancer statistics, 2005. CA Cancer J. Clin. (2005) 55:10–30.
[Abstract/Free Full Text] - Wingo PA, et al. Long-term trends in cancer mortality in the United States, 1930-1998. Cancer (2003) 97:3133–3275.[CrossRef][Web of Science][Medline]
- Onn A, et al. Treatment of non-small-cell lung cancer: a perspective on the recent advances and the experience with gefitinib. Br. J. Cancer (2004) 91(suppl. 2):S11–S17.[CrossRef][Medline]
- Wajant H, et al. Tumor therapeutics by design: targeting and activation of death receptors. Cytokine Growth Factor Rev. (2005) 16:55–76.[CrossRef][Web of Science][Medline]
- Luo JL, et al. Inhibition of NF-kappaB in cancer cells converts inflammation-induced tumor growth mediated by TNFalpha to TRAIL-mediated tumor regression. Cancer Cell (2004) 6:297–305.[CrossRef][Web of Science][Medline]
- Lin Y, et al. The death domain kinase RIP is essential for TRAIL (Apo2L)-induced activation of IkappaB kinase and c-Jun N-terminal kinase. Mol. Cell. Biol. (2000) 20:6638–6645.
[Abstract/Free Full Text] - Wajant H. TRAIL and NFkappaB signaling—a complex relationship. Vitam. Horm. (2004) 67:101–132.[Medline]
- Lin A, et al. The true face of JNK activation in apoptosis. Aging Cell (2002) 1:112–116.[CrossRef][Web of Science][Medline]
- Ventura JJ, et al. JNK potentiates TNF-stimulated necrosis by increasing the production of cytotoxic reactive oxygen species. Genes Dev. (2004) 18:2905–2915.
[Abstract/Free Full Text] - Wang X. The expanding role of mitochondria in apoptosis. Genes Dev. (2001) 15:2922–2933.
[Free Full Text] - Zhang L, et al. Mechanisms of resistance to TRAIL-induced apoptosis in cancer. Cancer Gene Ther. (2005) 12:228–237.[CrossRef][Web of Science][Medline]
- Pietta PG. Flavonoids as antioxidants. J. Nat. Prod. (2000) 63:1035–1042.[CrossRef][Medline]
- Birt DF, et al. Dietary agents in cancer prevention: flavonoids and isoflavonoids. Pharmacol. Ther. (2001) 90:157–177.[CrossRef][Web of Science][Medline]
- Le Marchand L. Cancer preventive effects of flavonoids—a review. Biomed. Pharmacother. (2002) 56:296–301.[CrossRef][Medline]
- Wright ME, et al. Development of a comprehensive dietary antioxidant index and application to lung cancer risk in a cohort of male smokers. Am. J. Epidemiol. (2004) 160:68–76.
[Abstract/Free Full Text] - Khanduja KL, et al. Prevention of N-nitrosodiethylamine-induced lung tumorigenesis by ellagic acid and quercetin in mice. Food Chem. Toxicol. (1999) 37:313–318.[CrossRef][Web of Science][Medline]
- Neuhouser ML. Dietary flavonoids and cancer risk: evidence from human population studies. Nutr. Cancer (2004) 50:1–7.[CrossRef][Web of Science][Medline]
- Le Marchand L, et al. Intake of flavonoids and lung cancer. J. Natl Cancer Inst. (2000) 92:154–160.
[Abstract/Free Full Text] - Son YO, et al. Quercetin, a bioflavonoid, accelerates TNF-alpha-induced growth inhibition and apoptosis in MC3T3-E1 osteoblastic cells. Eur. J. Pharmacol. (2006) 529:24–32.[CrossRef][Web of Science][Medline]
- Brisdelli F, et al. Induction of apoptosis by quercetin: different response of human chronic myeloid (K562) and acute lymphoblastic (HSB-2) leukemia cells. Mol. Cell. Biochem. (2007) 296:137–149.[CrossRef][Web of Science][Medline]
- Watjen W, et al. Low concentrations of flavonoids are protective in rat H4IIE cells whereas high concentrations cause DNA damage and apoptosis. J. Nutr. (2005) 135:525–531.
[Abstract/Free Full Text] - Lin Y, et al. Cleavage of the death domain kinase RIP by caspase-8 prompts TNF-induced apoptosis. Genes Dev. (1999) 13:2514–2526.
[Abstract/Free Full Text] - Keane MM, et al. Inhibition of NF-kappaB activity enhances TRAIL mediated apoptosis in breast cancer cell lines. Breast Cancer Res. Treat. (2000) 64:211–219.[CrossRef][Web of Science][Medline]
- Stokoe D, et al. Dual role of phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase B. Science (1997) 277:567–570.
[Abstract/Free Full Text] - Ramirez RD, et al. Immortalization of human bronchial epithelial cells in the absence of viral oncoproteins. Cancer Res. (2004) 64:9027–9034.
[Abstract/Free Full Text] - Wang X, et al. 17-Allylamino-17-demethoxygeldanamycin synergistically potentiates tumor necrosis factor-induced lung cancer cell death by blocking the nuclear factor-kappaB pathway. Cancer Res. (2006) 66:1089–1095.
[Abstract/Free Full Text] - Lin Y, et al. Tumor necrosis factor-induced nonapoptotic cell death requires receptor-interacting protein-mediated cellular reactive oxygen species accumulation. J. Biol. Chem. (2004) 279:10822–10828.
[Abstract/Free Full Text] - Lin Y, et al. The essential role of the death domain kinase receptor-interacting protein in insulin growth factor-I-induced c-Jun N-terminal kinase activation. J. Biol. Chem. (2006) 281:23525–23532.
[Abstract/Free Full Text] - Wen J, et al. Antileukemic drugs increase death receptor 5 levels and enhance Apo-2L-induced apoptosis of human acute leukemia cells. Blood (2000) 96:3900–3906.[Medline]
- Graham B, et al. The two faces of NFkappaB in cell survival responses. Cell Cycle (2005) 4:1342–1345.[Web of Science][Medline]
- Russo M, et al. Flavonoid quercetin sensitizes a CD95-resistant cell line to apoptosis by activating protein kinase Calpha. Oncogene (2003) 22:3330–3342.[CrossRef][Web of Science][Medline]
- Spencer JP, et al. Modulation of pro-survival Akt/protein kinase B and ERK1/2 signaling cascades by quercetin and its in vivo metabolites underlie their action on neuronal viability. J. Biol. Chem. (2003) 278:34783–34793.
[Abstract/Free Full Text] - Nesterov A, et al. Elevated AKT activity protects the prostate cancer cell line LNCaP from TRAIL-induced apoptosis. J. Biol. Chem. (2001) 276:10767–10774.
[Abstract/Free Full Text] - Wang X, et al. Sensitization of TNF-induced cytotoxicity in lung cancer cells by concurrent suppression of the NF-kappaB and Akt pathways. Biochem. Biophys. Res. Commun. (2007) 355:807–812.[CrossRef][Web of Science][Medline]
- Papapetropoulos A, et al. Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway. J. Biol. Chem. (2000) 275:9102–9105.
[Abstract/Free Full Text] - Belyanskaya LL, et al. Cisplatin activates Akt in small cell lung cancer cells and attenuates apoptosis by survivin upregulation. Int. J. Cancer (2005) 117:755–763.[CrossRef][Web of Science][Medline]
- Shi RX, et al. Protein kinase C inhibition and x-linked inhibitor of apoptosis protein degradation contribute to the sensitization effect of luteolin on tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in cancer cells. Cancer Res. (2005) 65:7815–7823.
[Abstract/Free Full Text] - Chawla-Sarkar M, et al. Downregulation of Bcl-2, FLIP or IAPs (XIAP and survivin) by siRNAs sensitizes resistant melanoma cells to Apo2L/TRAIL-induced apoptosis. Cell Death Differ. (2004) 11:915–923.[CrossRef][Web of Science][Medline]
- Frese S, et al. Cardiac glycosides initiate Apo2L/TRAIL-induced apoptosis in non-small cell lung cancer cells by up-regulation of death receptors 4 and 5. Cancer Res. (2006) 66:5867–5874.
[Abstract/Free Full Text] - Gavrielides MV, et al. Protein kinase C and prostate carcinogenesis: targeting the cell cycle and apoptotic mechanisms. Curr. Drug Targets (2004) 5:431–443.[CrossRef][Web of Science][Medline]
- Martelli AM, et al. Nuclear protein kinase C isoforms and apoptosis. Eur. J. Histochem. (2004) 48:89–94.[Web of Science][Medline]
- Williams RJ. Flavonoids: antioxidants or signalling molecules? Free Radic. Biol. Med. (2004) 36:838–849.[CrossRef][Web of Science][Medline]
- Farrow B, et al. Activation of conventional PKC isoforms increases expression of the pro-apoptotic protein Bad and TRAIL receptors. Int. J. Gastrointest. Cancer (2002) 32:63–72.[CrossRef][Web of Science][Medline]
- Ma L, et al. Growth inhibitory effects of quercetin on bladder cancer cell. Front. Biosci. (2006) 11:2275–2285.[CrossRef][Web of Science][Medline]
- Hasegawa H, et al. Dihydroflavonol BB-1, an extract of natural plant Blumea balsamifera, abrogates TRAIL resistance in leukemia cells. Blood (2006) 107:679–688.
[Abstract/Free Full Text] - Malhi H, et al. TRAIL resistance results in cancer progression: a TRAIL to perdition? Oncogene (2006) 25:7333–7335.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
E. Szliszka, Z. P. Czuba, J. Bronikowska, A. Mertas, A. Paradysz, and W. Krol Ethanolic Extract of Propolis Augments TRAIL-Induced Apoptotic Death in Prostate Cancer Cells Evid. Based Complement. Altern. Med., November 5, 2009; (2009) nep180v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bai, W. Chen, W. Chen, X. Wang, H. Tang, and Y. Lin IKK{beta}-mediated nuclear factor-{kappa}B activation attenuates smac mimetic-induced apoptosis in cancer cells Mol. Cancer Ther., June 1, 2009; 8(6): 1636 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Siegelin, D. E. Reuss, A. Habel, A. Rami, and A. von Deimling Quercetin promotes degradation of survivin and thereby enhances death-receptor-mediated apoptosis in glioma cells Neuro-oncol, January 1, 2009; 11(2): 122 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Tazzari, G. Tabellini, F. Ricci, V. Papa, R. Bortul, F. Chiarini, C. Evangelisti, G. Martinelli, A. Bontadini, L. Cocco, et al. Synergistic Proapoptotic Activity of Recombinant TRAIL Plus the Akt Inhibitor Perifosine in Acute Myelogenous Leukemia Cells Cancer Res., November 15, 2008; 68(22): 9394 - 9403. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, W. Chen, W. Zeng, L. Bai, Y. Tesfaigzi, S. A. Belinsky, and Y. Lin Akt-mediated eminent expression of c-FLIP and Mcl-1 confers acquired resistance to TRAIL-induced cytotoxicity to lung cancer cells Mol. Cancer Ther., May 1, 2008; 7(5): 1156 - 1163. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









