Skip Navigation


Carcinogenesis Advance Access originally published online on July 25, 2007
Carcinogenesis 2007 28(11):2328-2336; doi:10.1093/carcin/bgm173
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/11/2328    most recent
bgm173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, L. H.
Right arrow Articles by Hersey, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, L. H.
Right arrow Articles by Hersey, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Thapsigargin sensitizes human melanoma cells to TRAIL-induced apoptosis by up-regulation of TRAIL-R2 through the unfolded protein response

Li Hua Chen{dagger}, Chen Chen Jiang{dagger}, Kelly A. Kiejda, Yu Fang Wang, Rick F. Thorne, Xu Dong Zhang and Peter Hersey*

Immunology and Oncology Unit, David Maddison Clinical Sciences Building, Newcastle Misericordiae Hospital, Cnr. King & Watt Streets, Newcastle, New South Wales 2300, Australia

* To whom correspondence should be addressed. Tel: +61 2 49 236828; Fax: +61 2 49236184;Email: peter.hersey{at}newcastle.edu.au Correspondence may also be addressed to Dr Xu Dong Zhang. Tel: +61 2 49 236194; Fax: +61 2 49 236184Email: xu.zhang{at}newcastle.edu.au


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
We have previously reported that sensitivity of melanoma cells to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis is largely correlated with the levels of expression of TRAIL death receptors, in particular, TRAIL-R2 on the cell surface. However, fresh melanoma isolates and melanoma tissue sections express, in general, low levels of death receptors for TRAIL. We show in this study that the endoplasmic reticulum stress inducer, thapsigargin (TG), selectively up-regulated TRAIL-R2 and enhanced TRAIL-induced apoptosis in melanoma cells. However, the TRAIL-R2 pathway did not appear to be involved in induction of apoptosis by TG alone. Up-regulation of TRAIL-R2 appeared to be cooperatively mediated by the inositol-requiring transmembrane kinase and endonuclease 1{alpha} (IRE1{alpha})- and activation of transcription factor (ATF)-6-signaling pathways of the unfolded protein response (UPR) and the transcription factor CCAAT/enhancer-binding protein-homologous protein (CHOP). The latter played a critical role in the initial phase of the increase in TRAIL-R2 as small interfering RNA (siRNA) knockdown of CHOP blocked up-regulation of TRAIL-R2 only at a relatively early stage (16 h) after exposure to TG. In contrast, IRE1{alpha} and ATF6 appeared to be crucial in maintaining the increased levels of TRAIL-R2 in that siRNA knockdown of IRE1{alpha} or ATF6 had no effect on the increase in TRAIL-R2 at the initial phase, but blocked TRAIL-R2 up-regulation at a relatively late stage (36 h). Our results indicate that modulation of the UPR may be useful in sensitizing melanoma cells to TRAIL-induced apoptosis by up-regulation of TRAIL-R2.

Abbreviations: ATF, activation of transcription factor; eIF2{alpha}, eukaryotic initiation factor {alpha}; ER, endoplasmic reticulum; HUVEC, human umbilical vein endothelial cell; IRE1{alpha}, inositol-requiring transmembrane kinase and endonuclease 1{alpha}; mRNA, messenger RNA; PCR, polymerase chain reaction; PERK, protein kinase-like endoplasmic reticulum kinase; siRNA, small interfering RNA; TG, thapsigargin; TNF, tumor necrosis factor; TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; XBP1, X-box-binding protein 1; CHOP, CCAAT/enhancer-binding protein-homologous protein; FADD, Fas-associated death domain


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a member of the tumor necrosis factor (TNF) family that appears to be a promising candidate for cancer therapeutics because of its selective cytotoxicity against malignancies (13). The potential significance of TRAIL as an anticancer agent has been supported by studies in animal models showing selective toxicity to human tumor xenografts but not normal tissues (4,5). Induction of apoptosis by TRAIL is mediated by its interaction with two death domain-containing receptors, TRAIL-R1 and -R2. This in turn orchestrates the assembly of the death-inducing signaling complex that contains adapter components such as Fas-associated death domain (FADD) that activates initiator caspases, caspase-8 and -10, leading eventually to activation of effector caspases such as caspase-3 and apoptosis (13).

We have shown previously that sensitivity of cultured melanoma cells to TRAIL-induced apoptosis is correlated with the levels of cell-surface expression of TRAIL death receptors, in particular, TRAIL-R2 (6,7). Subsequent studies demonstrated that fresh melanoma isolates are relatively resistant to TRAIL-induced apoptosis due to low levels of TRAIL-death receptor expression (8). Moreover, melanoma cells selected for TRAIL resistance by prolonged exposure to TRAIL express substantially reduced levels of TRAIL-R2 on their surface (9,10). Studies on melanoma tissue sections revealed that reduced TRAIL-R2 expression is associated with disease progression and a poor prognosis (11). Taken together, these studies indicate that clinical potential of TRAIL in treatment of melanoma may be limited unless given with agents that increase the cell-surface expression of TRAIL death receptors, in particular, TRAIL-R2.

The cellular response to endoplasmic reticulum (ER) stress, the unfolded protein response (UPR), is currently known to consist of three distinct yet coordinated signaling pathways initiated, respectively, by inositol-requiring transmembrane kinase and endonuclease 1{alpha} (IRE1{alpha}), activation of transcription factor (ATF)-6 and protein kinase-like endoplasmic reticulum kinase (PERK) (1214). As an adaptive response, the UPR is activated to alleviate the stress condition imposed on the ER and is orchestrated by transcriptional activation of multiple genes mediated by IRE1{alpha} and ATF6, a general decrease in translation initiation and selective translation of specific messenger RNAs (mRNAs) mediated by PERK (1214). However, if the stress on ER remains unresolved, prolonged activation of the UPR can lead to apoptosis (1214). Thapsigargin (TG), a sesquiterpene lactone that induces ER stress by depletion of Ca2+ within the ER through inhibiting ER Ca2+ ATPases (15), has been reported to induce apoptosis via a TRAIL-R2-dependent apoptotic pathway (16). In addition, TG was shown to enhance TRAIL-induced apoptosis in a number of human cancer cells via up-regulation of TRAIL-R2 (1719). Although the transcription factor CHOP is believed to be involved (16), a potential role of the UPR in regulation of TRAIL-R2 by TG has not been fully studied. Moreover, the effect of TG-induced ER stress on the expression of TRAIL death receptors in melanoma cells is unknown.

We show in this study that TG selectively up-regulated cell-surface expression of TRAIL-R2 and enhanced TRAIL-induced apoptosis in human melanoma cells. However, apoptosis of melanoma cells induced by TG alone did not appear dependent on the TRAIL-R2-mediated apoptotic pathway. Up-regulation of TRAIL-R2 expression on the cell surface was associated with enhanced TRAIL-R2 gene transcription and elevated TRAIL-R2 total protein levels. The IRE1{alpha}- and ATF6-mediated signaling pathways of the UPR, along with the transcription factor CHOP, appeared to play key roles in up-regulation of TRAIL-R2 by TG in melanoma cells.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Cell lines
Human melanoma cell lines Mel-RM, MM200, IgR3, Mel-CV, Me4405, Sk-Mel-28 and Mel-FH have been described previously and were cultured in Dulbecco's modified Eagle's medium containing 5% fetal calf serum (Commonwealth Serum Laboratories, Melbourne, Australia) (6,20). Melanocytes were kindly provided by Dr P.Parsons (Queensland Institute of Medical Research, Brisbane, Australia) and cultured in medium supplied by Clonetics (Edward Keller, Victoria, Australia). Human umbilical vein endothelial cells (HUVECs) were kindly supplied by D.Clark (Transplantation Unit, John Hunter Hospital, Australia) and were cultured as described elsewhere (21). Human embryonic fibroblasts (FLOW 2000) were cultured in Dulbecco's modified Eagle's medium containing 5% fetal calf serum as described previously (22).

Generation of TRAIL-selected cells
Generation of TRAIL-selected Mel-RM and MM200 cells was performed as described previously (9,10). The resulting TRAIL-resistant cell lines were designated as Mel-RM.S and MM200.S, respectively.

Antibodies, recombinant proteins and other reagents
TG was purchased from Sigma Chemical Co. (Castle Hill, Australia). It was dissolved in dimethyl sulfoxide to make up a stock solution of 1 mM. Recombinant human TRAIL and the TRAIL-R2/Fc chimera were supplied by Immunex (Seattle, WA). The mouse mAbs against TRAIL-R1, -R2, -R3 and -R4, Fas, TNF-R1 and -R2 were also supplied by Immunex. The cell-permeable pan caspase inhibitor Z-Val-Ala-Asp(OMe)-CH2F (z-VAD-fmk) and the caspase-8-specific inhibitor Z-lle-Glu(Ome)-Thr-Asp(Ome)-CH2F (z-IETD-fmk) were purchased from Calbiochem (La Jolla, CA). The rabbit polyclonal antibodies against caspase-3 and -8 were from Stressgen (Victoria, British Columbia, Canada). The mouse mAbs against PARP and Bid were from PharMingen (Bioclone, Marrickville, Australia). The rabbit mAbs against Bip1, eukaryotic initiation factor2{alpha} (eIF2{alpha}), phosphorylated eIF2{alpha}, X-box-binding protein 1 (XBP1), IRE1{alpha}, ATF6, PERK and CHOP were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Isotype control antibodies used were the ID4.5 (mouse IgG2{alpha}) mAb against Salmonella typhi supplied by Dr L.Ashman (Institute for Medical and Veterinary Science, Adelaide, Australia), the 107.3 mouse IgG1 mAb purchased from PharMingen and rabbit IgG from Sigma Chemical Co.

Flow cytometry
Immunostaining on intact and permeabilized cells was carried out as described previously (6,20). Analysis was carried out using a Becton Dickinson (Mountain View, CA) FACScan flow cytometer.

Apoptosis
Quantitation of apoptotic cells by measurement of subG1 DNA content using the propidium iodide method was carried out as described elsewhere (6,20).

Mitochondrial membrane potential
Melanoma cells were seeded at 1 x 105 cells per well in 24-well plates and allowed to reach exponential growth for 24 h before treatment. JC-1 staining was performed according to the manufacture's instructions (Molecular Probes, Eugene, OR) as described previously (9,23).

Western blot analysis
Western blot analysis was carried out as described previously (9,23). Labeled bands were detected by Immun-StarTM HRP chemiluminescent kit, and images were captured and the intensity of the bands was quantitated with the Bio-Rad VersaDocTM image system (Bio-Rad, Regents Park, New South Wales, Australia).

Detection of XBP1 mRNA splicing
The method used for detection of unspliced and spliced XBP1 mRNAs was as described previously (24). Briefly, reverse transcription–polymerase chain reaction (PCR) products of XBP1 mRNA were obtained from total RNA extracted using primers 5'-cggtgcgcggtgcgtagtctgga-3' (sense) and 5'-tgaggggctgagaggtgcttcct-3' (anti-sense). Because a 26 bp fragment containing an Apa-LI site is spliced upon activation of XBP-1 mRNA, the reverse transcription–PCR products were digested with Apa-LI to distinguish the active spliced form from the inactive unspliced form. Subsequent electrophoresis revealed the inactive form as two cleaved fragments and the active form as a non-cleaved fragment.

Real-time PCR
Total RNA was isolated with SV total RNA isolation system (Promega). Reverse transcription PCR was carried out using Moloney murine leukemia virus (MMLV) transcriptase and Oligo d(T) and the resulting cDNA products were used as templates for real-time PCR assays. Real-time PCR was performed using the ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA). For TRAIL-R2, 25 µl mixture was used for reaction, which contains 5 µl cDNA sample (0.5–1 µg/µl), 300 nM forward primers for TRAIL-R2 (CGCTGCACCAGGTGTGATT), 300 nM reverse primers for TRAIL-R2 (GTGCCGGCTTCGCACTGACA), 200 nM probes for TRAIL-R2 (6FAM-CCCTGCACCACGACCAGAAACACAG-TAMRA) and 9 mM MgCI2. After incubation at 50°C for 2 min followed by 95°C for 10 min, the reaction was carried out for 45 cycles of the following: 95°C for 15 s and 60.6°C for 45 s. For TRAIL-R1, assay-on-demand for TRAIL-R1 (Assay ID: Hs01560092-g1) was used according to the manufacturer's protocol (Applied Biosystems). Analysis of cDNA for ß-actin was included as a control. The threshold cycle value (Ct) was normalized against ß-actin cycle numbers. The relative abundance of mRNA expression of a control sample was arbitrarily designated as 1, and the values of the relative abundance of mRNA of other samples were calculated accordingly.

Small interfering RNA
Melanoma cells were seeded at 3.5 x 104 cells per well in 24-well plates and allowed to reach ~50% confluence on the day of transfection. The small interfering RNA (siRNA) constructs used were obtained as the siGENOME SMARTpool reagents (Dharmacon, Lafayette, CO), the siGENOME SMARTpool IRE1{alpha} (M-004951-01-0010), the siGENOME SMARTpool ATF6 (M-009917-01-0010) and the siGENOME SMARTpool CHOP (M-004819-01-0010). The non-targeting siRNA control, SiConTRol non-targeting SiRNA pool (D-001206-13-20) was also obtained from Dharmacon. Cells were transfected with 50–100 nM siRNA diluted in Opti-Eagle's Minimal Essential Medium (MEM) (Invitrogen, Carlsbad, CA) in no-antibody Dulbecco's modified Eagle's medium with 5% fetal calf serum using Lipofectamine reagent (Invitrogen) according to the manufacturer's transfection protocol. Efficiency of siRNA was measured by western blot analysis 24 h after transfection.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
TG sensitizes melanoma cells to TRAIL-induced apoptosis
We studied if TG induces apoptosis of melanoma cells by treating a panel of melanoma cell lines with the compound at 1 µM for 48 h. As shown in Figure 1A, TG induced only minimal to moderate levels of apoptosis in all the lines with the exception of Me1007, in which >80% of the cells were found to undergo apoptosis. Figure 1B shows that both Mel-RM and MM200 cells remained relatively resistant to TG-induced apoptosis with no more than 20% of the cells undergoing apoptosis even when treated with the compound at 8 µM.


Figure 1
View larger version (41K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. TG sensitizes melanoma cells to TRAIL-induced apoptosis. (A) TG induces minimal to moderate levels of apoptosis in the majority of melanoma cells. Melanoma cells treated with TG (1 µM) for 48 h were subjected to measurement of apoptosis by the propidium iodide method using flow cytometry. The data shown are the mean ± SE of three individual experiments. (B) Mel-RM and MM200 cells were treated with TG at 8 µM for 48 h before measurement of apoptosis by the propidium iodide method using flow cytometry. The data shown are representative flow cytometric histograms of three individual experiments. (C) Kinetics of sensitization of Mel-RM and MM200 cells to TRAIL-induced apoptosis by TG. Mel-RM (left panel) and MM200 (right panel) cells were treated with the combination of TG (1 µM) and TRAIL (200 ng/ml) for indicated periods before measurement of apoptosis by the propidium iodide method using flow cytometry. The data shown are the mean ± SE of three individual experiments. (D) TG potentiates TRAIL-induced caspase activation. Mel-RM and MM200 cells were treated with TG alone (1 µM) for 16 h, TRAIL (200 ng/ml) alone for 3 h or TG (1 µM) for 16 h followed by the addition of TRAIL (200 ng/ml) for another 3 h. Whole cell lysates were subjected to western blot analysis. The data shown are representative of three individual experiments. (E) TG potentiates TRAIL-induced reduction in mitochondrial membrane potential. Mel-RM and MM200 cells were treated with TG alone (3 µM) for 16 h, TRAIL (200 ng/ml) alone for 3 h or TG (1 µM) for 16 h followed by the addition of TRAIL (200 ng/ml) for another 3 h. mitochondrial membrane potential was measured using JC-1 in flow cytometry. The number in each low left quadrant plot represents the percentage of cells with reduction in mitochondrial membrane potential. The data shown are representative of three individual experiments. (F) TG enhances TRAIL-induced apoptosis in a panel of melanoma cell lines and normal cells (melanocytes, FLOW 2000 fibroblasts and HUVECs). Cells treated with TG alone (1 µM) for 40 h, TRAIL (200 ng/ml) alone for 24 h or TG (1 µM) for 16 h followed by the addition of TRAIL (200 ng/ml) for a further 24 h were subjected to measurement of apoptosis by the propidium iodide method using flow cytometry. The data shown are the mean ± SE of three individual experiments.

 
To examine if TG sensitizes melanoma cells to TRAIL-induced apoptosis, we treated Mel-RM and MM200 cells with the combination of TG (1 µM) and TRAIL (200 ng/ml) for varying periods up to 48 h. Figure 1C shows that the levels of TRAIL-induced apoptosis increased in both cell lines in the presence of TG, which was observed as early as 16 h and reached a peak at 36 h after treatment. As shown in Figure 1D and E, sensitization of Mel-RM and MM200 cells to TRAIL-induced apoptosis by TG was associated with enhanced TRAIL-induced activation of caspase-8 and Bid, reduction in mitochondrial membrane potential, activation of caspase-3 and cleavage of its substrate PARP.

A summary of studies on the effect of TG on TRAIL-induced apoptosis in a panel of melanoma cell lines and normal cells including melanocytes, HUVECs and fibroblasts is shown in Figure 1F. As reported before (6,7), TRAIL induced varying degrees of apoptosis in the melanoma cell lines. Pretreatment with TG markedly enhanced TRAIL-induced apoptosis in all but Me1007. TRAIL alone did not induce apoptosis in melanocytes, HUVECs and fibroblasts, but treatment with TG alone resulted in apoptosis in >30% of HUVECs (Figure 1F). Notably, pretreatment with TG followed by the addition of TRAIL led to marked apoptosis in all three types of normal cells (Figure 1F). It was of interest that Me1007 did not express caspase-8 and Bid at either the protein or the mRNA level (7).

TG selectively up-regulates TRAIL-R2 in melanoma cells
To study if sensitization of melanoma cells to TRAIL-induced apoptosis by TG results from changes in the cell-surface expression of TRAIL receptors, we treated Mel-RM and MM200 cells with TG at 1 µM for varying intervals. As shown in Figure 2A and B, TG markedly up-regulated cell-surface expression of TRAIL-R2 in both cell lines, with a significant increase being detected at 16 h, and further increases at 24 and 36 h after exposure to the compound. In contrast, it did not induce any change in the expression of the other TNF receptor family members, TRAIL-R1, -R3 and -R4, Fas and TNF-R1 and -R2 on the cell surface or did it cause up-regulation of TRAIL-R2 on the surface of melanocytes, fibroblasts and HUVECs (Figure 2A and C and data not shown). Studies on the panel of melanoma cell lines revealed that TG could up-regulate TRAIL-R2 on the cell surface in all but Me1007 (Figure 2C).


Figure 2
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. TG selectively up-regulates TRAIL-R2 in melanoma cells. (A) Melanoma cells (Mel-RM and MM200) and melanocytes with (thin lines) or without (thick lines) treatment with TG (1 µM) for 16 h were subjected to measurement of cell-surface expression of TRAIL-R2 and -R1 and Fas in flow cytometry. The filled histograms are isotype controls. The data shown are representative of three individual experiments. (B) Kinetics of up-regulation of TRAIL-R2 by TG. Mel-RM and MM200 cells with or without treatment with TG (1 µM) for indicated time periods were subjected to measurement of cell-surface TRAIL-R2 expression in flow cytometry. The data shown are the mean fluorescence intensities of TRAIL-R2 and are the mean ± SE of three individual experiments. (C) A summary of studies on up-regulation of TRAIL-R2 by TG in a panel of melanoma cells and normal cells (melanocytes, FLOW 2000 fibroblasts and HUVECs). Cells with or without treatment with TG (1 µM) for 16 h were subjected to measurement of cell-surface TRAIL-R2 expression in flow cytometry. The data shown are mean fluorescence intensities of TRAIL-R2 and are the mean ± SE of three individual experiments. (D) TG up-regulates TRAIL-R2 total protein levels. Left panel: Mel-RM and MM200 with or without treatment with TG (1 µM) for indicated time periods were permeabilized and subjected to measurement of TRAIL-R2 expression in flow cytometry. The data shown are the mean fluorescence intensities of TRAIL-R2 in permeabilized cells and are the mean ± SE of three individual experiments. Right panel: Mel-RM and MM200 cells were treated with TG (1 µM) for indicated time periods. Whole cell lysates were subjected to western blot analysis. The data shown are representative of three individual experiments. (E) TG up-regulates TRAIL-R2 mRNA levels. Mel-RM and MM200 cells were treated with TG (1 µM) for the indicated time periods before total RNA was isolated and subjected to real-time PCR analysis for TRAIL-R2 and -R1 mRNA expression. The relative abundance of mRNA expression before treatment was arbitrarily designated as 1. The data shown are the mean ± SE of three individual experiments.

 
We next studied if TG regulates TRAIL-R2 total protein levels by measuring TRAIL-R2 expression in permeabilized Mel-RM and MM200 cells in flow cytometry. Figure 2D shows that TG induced a marked increase in the levels of the TRAIL-R2 total protein with a similar kinetics to that of up-regulation of TRAIL-R2 on the cell surface (Figure 2B). Up-regulation of the TRAIL-R2 total protein levels by TG was confirmed by western blot analysis (Figure 2D).

To understand the mechanism by which TG up-regulates TRAIL-R2 expression in melanoma cells, we quantitated TRAIL-R2 mRNA expression in Mel-RM and MM200 cells before and after exposure to the compound for varying intervals. As shown in Figure 2E, treatment with TG up-regulated the levels of TRAIL-R2 mRNA in both cell lines. In contrast, there was no alteration in the levels of TRAIL-R1 mRNA after exposure to TG.

Because a significant increase in TRAIL-R2 expression at either the protein or the mRNA level was initially observed at 16 h and a tendency of the increase retained for up to 36 h, after treatment with TG, we hereafter arbitrarily designated 16 h as a relatively early stage and 36 h a relatively late stage, in regard to TG-induced up-regulation of TRAIL-R2 in melanoma cells.

Up-regulation of TRAIL-R2 is responsible for sensitization of melanoma cells to TRAIL-induced apoptosis by TG
The role of up-regulation of TRAIL-R2 in sensitization of melanoma cells to TRAIL-induced apoptosis by TG was studied by inhibition of the interaction between TRAIL and TRAIL-R2 using a TRAIL-R2/Fc chimeric protein. Figure 3A shows that the TRAIL-R2/Fc chimera significantly inhibited TRAIL-induced apoptosis in both Mel-RM and MM200 cells in the absence or presence of TG. In contrast, it had no effect on the low levels of apoptosis induced by TG alone. Similarly, the TRAIL-R2/Fc chimera did not inhibit TG-induced apoptosis in Me1007 cells (data not shown). As shown in Figure 3B, TG-mediated sensitization of melanoma cells to TRAIL-induced apoptosis was blocked by either the pan caspase inhibitor z-VAD-fmk or the caspase-8-specific inhibitor z-IETD-fmk.


Figure 3
View larger version (26K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Up-regulation of TRAIL-R2 is responsible for sensitization of melanoma cells to TRAIL-induced apoptosis by TG. (A) TRAIL-R2/Fc chimera inhibits sensitization of melanoma cells to TRAIL-induced apoptosis by TG. Mel-RM and MM200 cells with or without pretreatment with a TRAIL-R2/Fc chimera (10 µg/ml) for 1 h followed by the addition of TG (1 µM) for 40 h, TRAIL (200 ng/ml) for 24 h or TG (1 µM) for 16 h before adding TRAIL (200 ng/ml) for another 24 h were subjected to measurement of apoptosis by the propidium iodide method using flow cytometry. The data shown are the mean ± SE of three individual experiments. (B) Caspase inhibitors inhibit sensitization of melanoma cells to TRAIL-induced apoptosis by TG. Mel-RM and MM200 cells with or without pretreatment with the pan caspase inhibitor z-VAD-fmk (30 µM) or the caspase-8-specific inhibitor z-IETD-fmk (30 µM) for 1 h followed by the addition of TG (1 µM) for 40 h, TRAIL (200 ng/ml) for 24 h or TG (1 µM) for 16 h before adding TRAIL (200 ng/ml) for another 24 h were subjected to measurement of apoptosis by the propidium iodide method using flow cytometry. The data shown are the mean ± SE of three individual experiments. (C) Inhibition of TRAIL-R2 expression by siRNA. Mel-RM and MM200 cells were transfected with the control or TRAIL-R2 siRNA. Twenty-four hours later, the cells were treated with TG (1 µM) for 16 h. Left panel: Whole cell lysates were subjected to western blot analysis. Right panel: Cell-surface TRAIL-R2 expression was measured in flow cytometry. The filled histograms: isotype controls; the thick lines: TRAIL-R2 expression on the cells transfected with the control siRNA and the thin lines: TRAIL-R2 expression on the cells transfected with the TRAIL-R2 siRNA. The data shown are representative of two individual experiments. (D) Knockdown of TRAIL-R2 by siRNA inhibits sensitization of melanoma cells to TRAIL-induced apoptosis by TG. Mel-RM and MM200 cells were transfected with the control or TRAIL-R2 siRNA. Twenty-four hours later, the cells were treated with TG (1 µM) for 16 h with or without the addition of TRAIL (200 ng/ml) for a further 24 h. Apoptosis was measured by the propidium iodide method using flow cytometry. The data shown are the mean ± SE of three individual experiments.

 
To confirm that up-regulation of TRAIL-R2 expression is responsible for sensitization of melanoma cells to TRAIL-induced apoptosis by TG, we transfected a TRAIL-R2-specific siRNA pool into Mel-RM and MM200 cells. Figure 3C and D shows that inhibition of TRAIL-R2 expression by the TRAIL-R2 siRNA pool markedly blocked TRAIL-induced apoptosis in the absence or presence of TG. Similar to the TRAIL-R2/Fc chimera, the TRAIL-R2 siRNA had no effect on apoptosis induced by TG alone.

The role of the IRE1{alpha}- and ATF6-mediated signaling pathways of the UPR in up-regulation of TRAIL-R2 by TG in melanoma cells
We next studied if TG induces the UPR in melanoma cells. Figure 4A and B shows that, similar to our findings in a separate study with another ER stress inducer tunicamycin (25), exposure of melanoma cells to TG resulted in changes consistent with activation of the UPR including up-regulation of the ER chaperone protein Bip/GRP78, phosphorylation of the translation initiator eIF2{alpha}, increases in XBP1 mRNA and protein levels and XBP1 mRNA splicing, increases in the expression of the UPR transducers, IRE1{alpha} and ATF6 and appearance of cleaved form of ATF6 (1214,24).


Figure 4
View larger version (50K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. The IRE1{alpha}- and ATF6-mediated signaling pathways of the UPR contribute to up-regulation of TRAIL-R2 by TG in melanoma cells. (A and B) TG induces the UPR in melanoma cells. (A) Whole cell lysates from Mel-RM and MM200 cells with or without treatment with TG (1 µM) for indicated time periods were subjected to western blot analysis. The data shown are representative of three individual experiments. (B) Reverse transcription–PCR products of XBP1 mRNA from Mel-RM and MM200 cells with or without treatment with TG (1 µM) for indicated periods were digested with Apa-LI for 90 min followed by electrophoresis. The longer fragment derived from the active form of XBP1 mRNA and two shorter bands derived from the inactive form are indicated. (C) Knockdown of IRE1{alpha} and ATF6 by siRNA decreases the levels of expression of IRE1{alpha} and ATF6, respectively, in the absence or presence of TG. Mel-RM and MM200 cells were transfected with the control, IRE1{alpha} (upper panels) or ATF6 (lower panels) siRNA. Twenty-four hours later, the cells were treated with TG (1 µM) for 24 h. Whole cell lysates were then subjected to western blot analysis. The data shown are representative of two individual experiments. (D) Inhibition of IRE1{alpha} or ATF6 by siRNA does not block up-regulation of TRAIL-R2 at an early stage after exposure to TG in melanoma cells. Mel-RM and MM200 cells were transfected with the control, IRE1{alpha} or ATF6 siRNA. Twenty-four hours later, the cells were treated with TG (1 µM) for 16 h before measurement of TRAIL-R2 expression in flow cytometry. The data shown are the mean fluorescence intensities of TRAIL-R2 and are the mean ± SE of duplicate assays in two individual experiments. (E) Inhibition of IRE1{alpha} or ATF6 by siRNA inhibits up-regulation of TRAIL-R2 at a late stage after exposure to TG in melanoma cells. Mel-RM and MM200 cells were transfected with the control, IRE1{alpha} or ATF6 siRNA. Twenty-four hours later, the cells were treated with TG (1 µM) for 36 h before measurement of cell-surface TRAIL-R2 expression in flow cytometry. The data shown are the mean fluorescence intensities of TRAIL-R2 and are the mean ± SE of duplicate assays in two individual experiments.

 
To elucidate if any of the known UPR-signaling pathways play a role in up-regulation of TRAIL-R2 by TG in melanoma cells, we silenced IRE1{alpha} and ATF6 by specific siRNA pools in Mel-RM and MM200 cells, respectively. Figure 4C shows that siRNA knockdown of IRE1{alpha} markedly inhibited its basal expression and its up-regulation by TG. Similarly, inhibition of ATF6 by siRNA reduced its expression levels as either the native p90 form or as the cleaved p50 form in cells before and after treatment with TG. As shown in Figure 4D and E, siRNA knockdown of either IRE1{alpha} or ATF6 had no effect on up-regulation of TRAIL-R2 measured at 16 h after treatment with TG. In contrast, by 36 h, the levels of TRAIL-R2 expression in cells transfected with either the IRE1{alpha} or ATF6 siRNA were markedly reduced in comparison with those transfected with the control siRNA, with the mean fluorescence intensities being approximately the same as those in parental cells.

CHOP is involved in up-regulation of TRAIL-R2 by TG in melanoma cells
We studied the expression of the transcription factor CHOP, which is a UPR effector primarily downstream of PERK and has been shown to be responsible for up-regulation of TRAIL-R2 induced by TG (1214,1618), in Mel-RM and MM200 cells before and after treatment with TG. As shown in Figure 5A, surprisingly, CHOP was constitutively expressed at relatively high levels in both cell lines, but was not up-regulated by TG. Instead, treatment with TG resulted in a marked decrease in CHOP expression.


Figure 5
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. CHOP is involved in up-regulation of TRAIL-R2 by TG in melanoma cells. (A) TG decreases the CHOP expression in melanoma cells. Whole cell lysates from Mel-RM and MM200 cells with or without treatment with TG (1 µM) for the indicated time periods were subjected to western blot analysis. The data shown are representative of three individual experiments. (B) Inhibition of CHOP expression by siRNA. Mel-RM and MM200 cells were transfected with the control or CHOP siRNA. Twenty-four hours later, the cells were harvested and whole cell lysates were subjected to western blot analysis. The data shown are representative of two individual experiments. (C) Inhibition of CHOP by siRNA blocks up-regulation of TRAIL-R2 at an early stage after exposure to TG in melanoma cells. Mel-RM and MM200 cells were transfected with the control or CHOP siRNA. Twenty-four hours later, the cells were treated with TG (1 µM) for 16 h before measurement of cell-surface TRAIL-R2 expression in flow cytometry. The data shown are the mean fluorescence intensities of TRAIL-R2 and are the mean ± SE of duplicate assays in two individual experiments. (D) Inhibition of CHOP by siRNA does not block up-regulation of TRAIL-R2 at a late stage after exposure to TG in melanoma cells. Mel-RM and MM200 cells were transfected with the control or CHOP siRNA. Twenty-four hours later, the cells were treated with TG (1 µM) for 36 h before measurement of TRAIL-R2 expression in flow cytometry. The data shown are the mean fluorescence intensities of TRAIL-R2 and are the mean ± SE of duplicate assays in two individual experiments.

 
To clarify a potential role of CHOP in up-regulation of TRAIL-R2 by TG, we inhibited CHOP by transiently transfecting a CHOP siRNA pool into Mel-RM and MM200 cells. Figure 5B shows that siRNA knockdown of CHOP inhibited its expression in both cell lines. As shown in Figure 5C and D, the CHOP siRNA markedly inhibited the increase in TRAIL-R2 at 16 h after treatment with TG. However, by 36 h, the inhibitory effect of CHOP on up-regulation of TRAIL-R2 in both cell lines was attenuated, with the levels of the TRAIL-R2 in cells transfected with the CHOP siRNA being only moderately lower than those in cells transfected with the control siRNA.

TG reversed resistance of TRAIL-selected melanoma cells to TRAIL-induced apoptosis by restoring TRAIL-R2 expression
We have previously reported that melanoma cells selected for TRAIL resistance expressed low levels of TRAIL-R2 (810). To study if TG may up-regulate TRAIL-R2 and enhance TRAIL-induced apoptosis in these cells, we treated Mel-RM.S and MM200.S cells with TG for 24 h. As shown in Figure 6A and B, treatment with TG markedly increased the levels of TRAIL-R2 on the cell surface and the TRAIL-R2 total protein levels in both Mel-RM.S and MM200.S cells. Figure 6C shows that pretreatment with TG followed by the addition of TRAIL resulted in a marked increase in the percentages of apoptotic cells. Sensitization of the TRAIL-selected melanoma cells to TRAIL-induced apoptosis by TG was substantially inhibited by a recombinant TRAIL-R2/Fc chimera (Figure 6D), indicating that the effect of TG on TRAIL-induced apoptosis in the TRAIL-selected cells is accounted for by the increase in TRAIL-R2 expression on the cell surface.


Figure 6
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. TG up-regulates TRAIL-R2 and enhances TRAIL-induced apoptosis in melanoma cells selected for TRAIL resistance. (A) Mel-RM.S and MM200.S cells with (thick lines) or without (thin lines) treatment with TG (1 µM) for 24 h were subjected to measurement of cell-surface TRAIL-R2 expression in flow cytometry. The filled histograms are isotype controls. The data shown are representative of three individual experiments. (B) Whole cell lysates from Mel-RM.S and MM200.S cells with or without treatment with TG (1 µM) for 24 h were subjected to western blot analysis. The data shown are representative of two individual experiments. (C) TG sensitizes the TRAIL-selected melanoma cells to TRAIL-induced apoptosis. Mel-RM.S and MM200.S cells with or without treatment with TG (1 µM) for 16 h before the addition of TRAIL (200 ng/ml) for a further for 24 h were subjected to measurement of apoptosis by the propidium iodide method using flow cytometry. The data shown are the mean ± SE of duplicate assays in two individual experiments. (D) A TRAIL-R2/Fc chimera inhibits sensitization of TRAIL-selected melanoma cells to TRAIL-induced apoptosis by TG. Mel-RM.S and MM200.S with or without pretreatment with a TRAIL-R2/Fc chimera (10 µg/ml) were treated with TG (1 µM) for 16 h before the addition of TRAIL (200 ng/ml) for another 24 h. Apoptosis was measured by the propidium iodide method using flow cytometry. The data shown are the mean ± SE of duplicate assays in two individual experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
The present study shows that TG, an inhibitor of ER Ca2+ ATPases (15), can potently enhance TRAIL-induced apoptosis in human melanoma cells by selectively up-regulating TRAIL-R2 on the cell surface. In contrast to previous reports in other cellular systems (1618), TG by itself induced only minimal apoptosis in the majority of melanoma cell lines, which did not appear to involve in the TRAIL-R2-mediated apoptotic pathway. We demonstrate, for the first time, that the IRE1{alpha}- and ATF6-mediated signaling pathways of the UPR and the transcription factor CHOP both contribute to up-regulation of TRAIL-R2 by TG in melanoma cells.

Although TRAIL appears to be a promising candidate for cancer therapy (15), our past studies indicated that fresh isolates of melanoma and melanoma in tissue sections frequently had low TRAIL death receptor expression and therefore may be unresponsive to TRAIL (811). However, unlike studies in many other solid cancers, in which TRAIL death receptors could be up-regulated by other therapeutic drugs (2629), we have not found these to increase TRAIL death receptor expression in melanoma. Agents tested have included DNA-damaging agents, microtubulin-targeting agents, histone deacetylase inhibitors and extracellular signal-regulated protein kinase kinase (MEK) inhibitors (23) (data not shown). The ability of TG to up-regulate TRAIL-R2 in melanoma is therefore of particular interest. Importantly, up-regulation of TRAIL-R2 by TG appeared to be highly selective and did not up-regulate receptors for the other TNF receptor family members, TRAIL-R1, -R3 and -R4, TNF-R1 and -R2 and Fas. Moreover, TG did not up-regulate TRAIL-R2 expression in normal cells, including melanocytes, fibroblasts and HUVECs. Our results and those showing that TG can also increase TRAIL-R2 expression in other solid cancer cells indicate that selective up-regulation of TRAIL-R2 by TG would be an advantage for its potential clinical use (1618).

Up-regulation of TRAIL-R2 by TG was associated with enhanced apoptotic signaling induced by TRAIL. This was shown by increased activation of caspase-8 and Bid, reduction in mitochondrial membrane potential, activation of caspase-3 and cleavage of its substrate PARP. Caspase-8 and -3 are the major initiator and effector caspase, respectively, in TRAIL-induced apoptosis of melanoma cells, whereas Bid is the essential mediator that links the death receptor apoptotic pathway to the mitochondrial apoptotic pathway (3,7,3032). The latter is known to play an important role in TRAIL-induced apoptosis of melanoma (7,33). The finding that a TRAIL-R2/Fc chimera, a caspase-8-specific inhibitor, or a TRAIL-R2 siRNA pool efficiently blocked TRAIL-induced apoptosis in the presence of TG indicates that enhanced apoptotic signaling was due to the increased interactions between TRAIL and TRAIL-R2.

Although these results show that TG up-regulated TRAIL-R2 and enhanced TRAIL-induced apoptosis of melanoma, our studies show that direct induction of apoptosis by TG appeared to be largely independent of the TRAIL-R2 apoptotic-signaling pathway, e.g. the majority of melanoma cell lines were insensitive to TG-induced apoptosis despite up-regulation of TRAIL-R2 by the compound. Second, TG induced marked apoptotic cell death in a cell line that expressed low levels of TRAIL-R2 even in the presence of TG and contained no caspase-8 and Bid. Third, a TRAIL-R2/Fc chimera and/or TRAIL-R2 siRNA did not inhibit TG-induced apoptosis in melanoma cells. Besides TRAIL-R2, a number of potential regulators have been identified to participate in ER stress-induced apoptosis, such as the caspase-12 in mice and its human homolog, caspase-4, the BH3-only protein p53 up-regulated modulator of apoptosis (PUMA), and activation of c-jun N-terminal kinase (3437). Irrespective of the pathway involved in induction of apoptosis in melanoma cells by ER stress, the present results show that it is inhibited in the majority of melanoma cell lines.

The transcription factor CHOP is known to be induced by ER stress and involved in ER-mediated apoptosis (1214,1618). However, we show here that CHOP is constitutively expressed at relatively high levels in melanoma cells and is decreased rather than increased by the ER stress inducer TG. CHOP transcription has been shown to be primarily regulated by the transcription factor ATF4, which was up-regulated as a result of preferential translation of its mRNA upon phosphorylation/inactivation of eIF2{alpha} by activation of PERK (1214). The high expression of CHOP in melanoma cells may indicate that the UPR is constitutively activated as reported in other cancer cells (3841). However, phosphorylation of eIF2{alpha} was merely detectable in melanoma cells before treatment with TG. This suggests that factors other than ATF4 may be responsible for the constitutively high levels of CHOP in the melanoma cells. The mechanism involved in the decrease of CHOP after exposure to TG is unknown, but it may be associated with reduced stability of CHOP mRNA and protein in ER stress-adapted cells (42).

Despite its TG-induced reduction, CHOP appeared to play a critical role at the initial phase of up-regulation of TRAIL-R2 induced by TG. This was shown by knockdown experiments with CHOP siRNA, which inhibited up-regulation of TRAIL-R2 at 16 h, but had minimal effects by 36 h after treatment with TG. The TRAIL-R2 promoter is known to contain a CHOP-binding site, which has been shown to play a role in up-regulation of TRAIL-R2 upon activation of the UPR (16,41). Inhibition of IRE1{alpha} or ATF6 by siRNA did not block the initial increase in TRAIL-R2 induced by TG, suggesting that CHOP acts independently of IRE1{alpha} or ATF6 in melanoma cells. The minimal effect of CHOP on up-regulation of TRAIL-R2 at later stages of the UPR may be due to the decrease in the CHOP expression levels after exposure to TG.

In contrast to CHOP the siRNA knockdown studies showed that the IRE1{alpha}- and ATF6-mediated signaling pathways of the UPR did not appear to be involved in the initial phase of the increase in TRAIL-R2 but was responsible for the late stage (36 h) of the increase after exposure to TG. Both IRE1{alpha} and ATF6 are ER membrane-localized proteins that act as UPR transducers (1214). On activation of the UPR, IRE1{alpha} displays its RNase activity that cleaves XBP1 mRNA generating a splicing variant of XBP1 mRNA that encodes a potent transcription factor. This in turn activates transcription of many UPR target genes. ATF6 itself is a transcription factor that, on activation, relocates to the Golgi where it is cleaved into the smaller active form that activates transcription of UPR target genes. It is conceivable that both the effector of IRE1{alpha}, XBP1 and ATF6 may act directly or indirectly via other transcription factors to activate transcription of TRAIL-R2 in melanoma cells (1214). No binding site for XBP1 or ATF6 has so far been identified in TRAIL-R2 promoter region. The only other transcription factor that is known to regulate TRAIL-R2 is p53 (26,27), which does not appear to play a role in the increase of TRAIL-R2 transcription induced by TG in that TRAIL-R2 was also up-regulated in melanoma cells deficient in p53 or containing mutant p53 (data not shown). Further studies are required to identify the factors that are responsible for up-regulation of TRAIL-R2 by the IRE1{alpha}- and ATF6-signaling pathways.

Our finding that TG could up-regulate TRAIL-R2 and re-sensitize melanoma cells that had been selected for resistance to TRAIL would appear to be of potential importance in the clinical use of TRAIL. TRAIL-selected cells are known to mimic fresh melanoma isolates in that the latter are also relatively resistant to TRAIL-induced apoptosis due to low levels of TRAIL death receptor expression (810). However, treatment with TG followed by the addition of TRAIL resulted in increased toxicity against melanocytes, fibroblasts and HUVECs. TRAIL-R2 was not up-regulated in the normal cells which indicates that mechanisms other than regulation of TRAIL-R2 are involved in modulating their sensitivity to TRAIL-induced apoptosis by the UPR. Further studies are therefore needed to assess the safety of this approach e.g. whether low doses of TG in combination with low concentrations of TRAIL may be effective. Alternatively, whether other agents togethering the ER Ca2+ ATPase may have more selective effects on melanoma compared with normal cells.


    Funding
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
New South Wales State Cancer Council; the Melanoma and Skin Cancer Research Institute Sydney; the Hunter Melanoma Foundation, New South Wales; the National Health and Medical Research Council (Project grant 351114), Australia.


    Footnotes
 
{dagger} These authors contributed equally to this work. Back


    Acknowledgments
 
X.D.Z. is a Cancer Institute New South Wales Fellow.

Conflict of Interest Statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 

  1. Nagata S. Apoptosis by death factor. Cell (1997) 88:355–365.[CrossRef][Web of Science][Medline]
  2. Ashkenazi A, et al. Death receptors: signaling and modulation. Science (1998) 281:1305–1308.[Abstract/Free Full Text]
  3. Walczak H, et al. The CD95 (APO-1/Fas) and the TRAIL (APO-2L) apoptosis systems. Exp. Cell Res. (2000) 256:58–66.[CrossRef][Web of Science][Medline]
  4. Walczak H, et al. Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo. Nat. Med. (1999) 5:157–163.[CrossRef][Web of Science][Medline]
  5. Ashkenazi A, et al. Safety and antitumor activity of recombinant soluble Apo2 ligand. J. Clin. Invest. (1999) 104:155–162.[Web of Science][Medline]
  6. Zhang XD, et al. Relation of TNF-related apoptosis-inducing ligand (TRAIL) receptor and FLICE-inhibitory protein expression to TRAIL-induced apoptosis of melanoma. Cancer Res. (1999) 59:2747–2753.[Abstract/Free Full Text]
  7. Hersey P, et al. How melanoma cells evade trail-induced apoptosis. Nat. Rev. Cancer (2001) 1:142–150.[CrossRef][Medline]
  8. Nguyen T, et al. Relative resistance of fresh isolates of melanoma to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis. Clin. Cancer Res. (2001) 7:966s–973s.[Web of Science][Medline]
  9. Zhang XD, et al. Human melanoma cells selected for resistance to apoptosis by prolonged exposure to tumor necrosis factor-related apoptosis-inducing ligand are more vulnerable to necrotic cell death induced by cisplatin. Clin. Cancer Res. (2006) 12:1335–1364.
  10. Wu JJ, et al. Selection for TRAIL resistance results in melanoma cells with high proliferative potential. FEBS Lett. (2005) 579:1940–1944.[CrossRef][Web of Science][Medline]
  11. Zhuang L, et al. Progression in melanoma is associated with decreased expression of death receptors for tumor necrosis factor-related apoptosis-inducing ligand. Hum. Pathol. (2006) 37:1286–1294.[CrossRef][Web of Science][Medline]
  12. Harding HP, et al. Transcriptional and translational control in the mammalian unfolded protein response. Annu. Rev. Cell Dev. Biol. (2002) 18:575–599.[CrossRef][Web of Science][Medline]
  13. Zhang K, et al. Signaling the unfolded protein response from the endoplasmic reticulum. J. Biol.Chem. (2004) 279:25935–25938.[Free Full Text]
  14. Schroder M, et al. The mammalian unfolded protein response. Annu. Rev. Biochem. (2005) 74:739–789.[CrossRef][Web of Science][Medline]
  15. Sagara Y, et al. Inhibition of the sarcoplasmic reticulum Ca2+ transport ATPase by thapsigargin at subnanomolar concentrations. J. Biol. Chem. (1991) 266:13503–13506.[Abstract/Free Full Text]
  16. Yamaguchi H, et al. CHOP is involved in endoplasmic reticulum stress-induced apoptosis by enhancing DR5 expression in human carcinoma cells. J. Biol. Chem. (2004) 279:45495–45502.[Abstract/Free Full Text]
  17. He Q, et al. Endoplasmic reticulum calcium pool depletion-induced apoptosis is coupled with activation of the death receptor 5 pathway. Oncogene (2002) 21:2623–2633.[CrossRef][Web of Science][Medline]
  18. Huang L, et al. Thapsigargin potentiates TRAIL-induced apoptosis in giant cell tumor of bone. Bone (2004) 34:971–981.[Medline]
  19. He Q, et al. Effect of Bax deficiency on death receptor 5 and mitochondrial pathways during endoplasmic reticulum calcium pool depletion-induced apoptosis. Oncogene (2003) 22:2674–2679.[CrossRef][Web of Science][Medline]
  20. Zhang XD, et al. Ingenol 3-angelate induces dual modes of cell death and differentially regulates tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in melanoma cells. Mol. Cancer Ther. (2004) 3:187–197.[Abstract/Free Full Text]
  21. Zhang XD, et al. Mechanisms of resistance of normal cells to TRAIL induced apoptosis vary between different cell types. FEBS Lett. (2000) 482:193–199.[CrossRef][Web of Science][Medline]
  22. Bates RC, et al. Individual embryonic fibroblasts express multiple beta chains in association with the alpha v integrin subunit. Loss of beta 3 expression with cell confluence. J. Biol. Chem. (1991) 266:18593–18599.[Abstract/Free Full Text]
  23. Gillespie S, et al. Bim plays a crucial role in synergistic induction of apoptosis by the histone deacetylase inhibitor SBHA and TRAIL in melanoma cells. Apoptosis (2006) 11:2251–2265.[CrossRef][Web of Science][Medline]
  24. Nakamura M, et al. Activation of the endoplasmic reticulum stress pathway is associated with survival of myeloma cells. Leuk. Lymphoma (2006) 47:531–539.[CrossRef][Web of Science][Medline]
  25. Jiang CC, et al. Tunicamycin sensitizes human melanoma cells to TRAIL-induced apoptosis by up-regulation of TRAIL-R2 via the unfolded protein response. Cancer Res. (2007) 67:5880–5888.[Abstract/Free Full Text]
  26. Sheikh MS, et al. p53-dependent and -independent regulation of the death receptor KILLER/DR5 gene expression in response to genotoxic stress and tumor necrosis factor alpha. Cancer Res. (1998) 58:1593–1598.[Abstract/Free Full Text]
  27. Singh TR, et al. Synergistic interactions of chemotherapeutic drugs and tumor necrosis factor-related apoptosis-inducing ligand/Apo-2 ligand on apoptosis and on regression of breast carcinoma in vivo. Cancer Res. (2003) 63:5390–5400.[Abstract/Free Full Text]
  28. Nakata S, et al. Histone deacetylase inhibitors upregulate death receptor 5/TRAIL-R2 and sensitize apoptosis induced by TRAIL/APO2-L in human malignant tumor cells. Oncogene (2004) 19:6261–6271.
  29. Chinnaiyan AM, et al. Combined effect of tumor necrosis factor-related apoptosis-inducing ligand and ionizing radiation in breast cancer therapy. Proc. Natl Acad. Sci. USA (2000) 97:1754–1759.[Abstract/Free Full Text]
  30. Griffith TS, et al. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J. Immunol. (1998) 161:2833–2840.[Abstract/Free Full Text]
  31. Li H, et al. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell (1998) 94:491–501.[CrossRef][Web of Science][Medline]
  32. Luo X, et al. Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell (1998) 94:481–490.[CrossRef][Web of Science][Medline]
  33. Zhang XD, et al. Tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis of human melanoma is regulated by smac/DIABLO release from mitochondria. Cancer Res. (2001) 61:7339–7348.[Abstract/Free Full Text]
  34. Nakagawa T, et al. Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature (2000) 403:98–103.[CrossRef][Medline]
  35. Hitomi J, et al. Involvement of caspase-4 in endoplasmic reticulum stress-induced apoptosis and Abeta-induced cell death. J. Cell Biol. (2004) 165:347–356.[Abstract/Free Full Text]
  36. Li J, et al. Endoplasmic reticulum stress-induced apoptosis: multiple pathways and activation of p53-up-regulated modulator of apoptosis (PUMA) and NOXA by p53. J. Biol. Chem. (2006) 281:7260–7270.[Abstract/Free Full Text]
  37. Nishitoh H, et al. ASK1 is essential for endoplasmic reticulum stress-induced neuronal cell death triggered by expanded polyglutamine repeats. Genes Dev. (2002) 16:1345–1355.[Abstract/Free Full Text]
  38. Ma Y, et al. The role of the unfolded protein response in tumour development: friend or foe? Nat. Rev. Cancer (2004) 4:966–977.[CrossRef][Web of Science][Medline]
  39. Jamora C, et al. Inhibition of tumor progression by suppression of stress protein GRP78/BiP induction in fibrosarcoma B/C10ME. Proc. Natl Acad. Sci. USA (1996) 93:7690–7694.[Abstract/Free Full Text]
  40. Shuda M, et al. Activation of the ATF6, XBP1 and grp78 genes in human hepatocellular carcinoma: a possible involvement of the ER stress pathway in hepatocarcinogenesis. J. Hepatol. (2003) 38:605–614.[CrossRef][Web of Science][Medline]
  41. Shiraishi T, et al. Tunicamycin enhances tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in human prostate cancer cells. Cancer Res. (2005) 65:6364–6370.[Abstract/Free Full Text]
  42. Rutkowski DT, et al. Adaptation to ER stress is mediated by differential stabilities of pro-survival and pro-apoptotic mRNAs and proteins. PLoS Biol. (2006) 4:e374.[CrossRef][Medline]
Received May 9, 2007; revised June 19, 2007; accepted July 17, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
C. C. Jiang, Z. G. Mao, K. A. Avery-Kiejda, M. Wade, P. Hersey, and X. D. Zhang
Glucose-regulated protein 78 antagonizes cisplatin and adriamycin in human melanoma cells
Carcinogenesis, February 1, 2009; 30(2): 197 - 204.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. B. Stathopulos, L. Zheng, and M. Ikura
Stromal Interaction Molecule (STIM) 1 and STIM2 Calcium Sensing Regions Exhibit Distinct Unfolding and Oligomerization Kinetics
J. Biol. Chem., January 9, 2009; 284(2): 728 - 732.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. E. Lovat, M. Corazzari, J. L. Armstrong, S. Martin, V. Pagliarini, D. Hill, A. M. Brown, M. Piacentini, M. A. Birch-Machin, and C. P.F. Redfern
Increasing Melanoma Cell Death Using Inhibitors of Protein Disulfide Isomerases to Abrogate Survival Responses to Endoplasmic Reticulum Stress
Cancer Res., July 1, 2008; 68(13): 5363 - 5369.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/11/2328    most recent
bgm173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, L. H.
Right arrow Articles by Hersey, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, L. H.
Right arrow Articles by Hersey, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?