Carcinogenesis Advance Access originally published online on August 8, 2007
Carcinogenesis 2007 28(12):2467-2475; doi:10.1093/carcin/bgm185
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Role of p14ARF in TWIST-mediated senescence in prostate epithelial cells
Department of Anatomy
1 Department of Pathology, Faculty of Medicine, The University of Hong Kong, 21 Sassoon Road, Hong Kong SAR, China
* To whom correspondence should be addressed. Tel: +852 2819 2867; Fax: +852 2817 0857; Email: xhwang{at}hkucc.hku.hk
Correspondence may also be addressed to Y-C.Wong. Tel: +852 2819 9226; Fax: +852 2817 0857; Email: ycwong{at}hkucc.hku.hk
| Abstract |
|---|
|
|
|---|
Recently, TWIST, a basic helix–loop–helix transcription factor, is suggested to be an oncogene because of its over-expression in many types of human cancer and its positive role in promoting cell survival. The aim of this study was to investigate the role of TWIST on the growth of human epithelial cells. Using two immortalized human prostate epithelial cell lines, we demonstrated that inactivation of TWIST by small RNA technology led to the promotion of cellular senescence and growth arrest, suggesting that TWIST plays a key role in the continuous proliferation of immortalized cells. Over-expression of TWIST, in contrast, resulted in suppression of cellular senescence in response to genotoxic damage and promotion of cell proliferation with DNA damage accumulation, indicating that TWIST promotes genomic instability. In addition, we also found that the TWIST-mediated cellular senescence was regulated through its negative effect on p14ARF and subsequent suppression of MDM2/p53 and Chk1/2 DNA damage response pathways. Our results suggest that over-expression of TWIST results in down-regulation of p14ARF, which leads to the impairment of DNA damage checkpoint in response to genotoxic stress. This negative effect of TWIST on DNA damage response facilitates uncontrolled cell proliferation with genomic instability and tumorigenesis in non-malignant cells.
Abbreviations: BrdUrd, bromodeoxyuridine; CP, cisplatin; H2O2, hydrogen peroxide; MEF, mouse embryo fibroblasts; mRNA, messenger RNA; PrEC, prostate epithelial cell; SA-β-gal, senescence-associated β-galactosidase; siRNA, small interfering RNA
| Introduction |
|---|
|
|
|---|
TWIST is a highly conserved basic helix–loop–helix transcription factor that plays a key role in cell type determination and cell differentiation during development (1). Recently, TWIST is suggested as a potential oncogene. For example, ectopic TWIST expression in mouse embryo fibroblasts (MEF) promotes anchorage-independent growth (2,3) and over-expression of TWIST in neuroblastoma cells promotes tumor growth in nude mice (3). In addition, up-regulation of TWIST is one of the significant changes during malignant transformation from melanocytes to melanoma (4) and the development of T-cell lymphoma (5). Moreover, over-expression of TWIST induces metastasis through induction of epithelial–mesenchymal transition in breast cancer cells (6,7) and confers resistance to chemotherapeutic drugs such as taxol in breast, prostate and nasopharyngeal carcinoma cells (7–9). Recent evidence on clinical specimens also demonstrates that up-regulation of TWIST is a frequent event in many types of cancer, such as breast cancer (6), prostate cancer (9,10), bladder cancer (11), osteosarcoma (12), neuroblastoma (3), hepatocarcinoma (13) and melanoma (4), and its expression level is positively correlated with poor clinical outcome. These lines of evidence strongly implicate an oncogenic role of TWIST in the development and progression of human cancer.
Although the molecular basis for the positive role of TWIST in tumorigenesis is not clear, it is suggested that TWIST is a negative regulator of ARF (p14ARF in human and p19ARF in mouse), a tumor suppressor and a positive regulator of the p53 pathway (14). For example, the TWIST-induced anchorage-independent growth in MEFs is reported to mediate through transcriptional suppression of p19ARF (2). In addition, in the TWIST over-expressing MEF cells that grew in soft agar, the MDM2/p53-mediated DNA damage response was severely impaired (3). Previously, we found that the TWIST-induced acquired drug resistance was associated with up-regulation of MDM2 and down-regulation of p53 and p21 (8). These results suggest that the TWIST-mediated oncogenic effect may be regulated through its negative effect on p53 pathway. It is thought that p14ARF positively regulates p53 pathway through its physical interaction with MDM2. The binding of p14ARF to MDM2 results in inhibition of its ubiquitin ligase activity on p53, leading to stabilization of p53 and subsequent growth arrest or apoptosis (15). This mechanism provides an important barrier to uncontrolled cell growth. Loss or de-regulation of ARF/p53 leads to promotion of cell proliferation and tumorigenesis. For example, MEFs derived from ARF–/– mice show increased growth rate and less responsive to contact inhibition (16). In human fibroblast cells, over-expression of ARF leads to cell growth arrest and premature senescence (17), and loss of p53 abrogates the ability of ARF to induce premature senescence (18). These results suggest that the ARF-mediated senescence in human cells may be dependent on a functional p53. Although ARF is not directly induced by DNA damage, its positive interaction with p53 pathway suggests that it is a key factor in DNA damage response. Indeed, recently, several studies have suggested that p14ARF interacts with DNA damage response pathways such as ataxia teleangiectasia (ATM)/ATM- and Rad 3-related (ATR) pathways to regulate cell proliferation via p53-dependent and -independent manners (19,20).
Previously, we found that TWIST was up-regulated in prostate cancer specimens and its expression level was positively associated with advanced disease (9,10). In addition, we found that ectopic TWIST expression was able to promote prostate cancer cell survival and invasion (9), suggesting that TWIST may be a positive factor in prostate tumorigenesis. To further elucidate the role of TWIST in the development of prostate cancer and its underlying molecular mechanisms, in this study, we investigated the effect of TWIST on the growth of non-malignant prostate epithelial cells (PrEC), and studied the involvement of p14ARF/MDM2/p53 and Chk1/2 DNA damage response pathways in this process.
| Materials and methods |
|---|
|
|
|---|
Cell culture conditions
Two human papilloma virus 16E6/E7 immortalized non-malignant PrEC lines, NPTX (21) and HPr-1 (22), were maintained in keratinocyte serum-free medium (Invitrogen, Carlsbad, CA) supplemented with penicillin/streptomycin (100 U/ml) at 37°C, 5% CO2 (Invitrogen).
Generation of stable Sh-TWIST transfectants
A pLenti-Sh-TWIST expression vector was constructed by cloning a short hairpin RNA (shRNA) against TWIST messenger RNA (mRNA) sequence (5'-GGACAAGCTGAGCAAGATTCA-3') using the BLOCK-iT Lentiviral RNAi Expression System (Invitrogen). The control vector (Sh-Con) was constructed using the same procedures, except that the short hairpin interfering RNA sequence was replaced with non-sense sequence (5'-GCGTATTGCCTAGCATTAC-3') that is not homologous to the human genome.
Stable transfectants were generated from a pool of >20 positive clones after 6 days selection in blasticidin (4 µg/ml for NPTX and 6.5 µg/ml for HPr-1) using the Viral PowerTM Lentiviral Expression System (Invitrogen).
Generation of transient TWIST transfectants
Cells were plated onto six-well plates (IWAKI, Tokyo, Japan) the day before transfection. Four microliters of Fugene 6 (Invitrogen) was diluted in 100 µl antibiotic-free culture medium and incubated for 5 min at room temperature. FLAG-tagged TWIST pcDNA3.1 plasmid (1.5 µg; a gift from Prof. L.Kedes, Department of Biochemistry and Molecular Biology, University of Southern California School of Medicine, CA) (23) was then added to the mixture and incubated for further 30 min at room temperature. The transfection mixture was then added to cell culture and incubated for 24 h. Same amount of pcDNA3.1 empty vector was used as a control and transfected using the same procedures.
Bromodeoxyuridine staining
Detailed experimental procedures have been described previously (24). The percentage of bromodeoxyuridine (BrdUrd)-positive cells was calculated by counting a total of 500–1000 cells. Results were generated from three experiments.
Senescence-associated β-galactosidase staining
Detailed experimental procedures have been described previously (25). Briefly, cells were grown on 12-well plates (Corning, New York) and treated with a range of cisplatin (CP) doses (10, 25, 50 and 100 ng/ml) for 96 h or hydrogen peroxide (H2O2) (50, 100, 200, 300 and 400 µM) for 2 h followed by 4 days culture in normal medium. The senescence-associated β-galactosidase (SA-β-gal)-stained cells were then visualized and captured by PC-based image analyzing system (Stereo Investigato, Williston, VT) under x200 magnification. Positively, SA-β-gal-stained cells were identified by their blue–green cytoplasmic staining. At least 500 cells were counted from three random fields in each experiment and the percentage of SA-β-gal-stained cells was calculated. The error bars indicate the standard deviation from three independent experiments.
Western blotting
Detailed experimental procedures have been described previously (24). The details of the primary antibodies are as follows: polyclonal TWIST (H-18, 1:250, Santa Cruz Biotechnology, Santa Cruz, CA), monoclonal p14ARF (NA70, 1:500, Calbiochem, Darmstadt, Germany), monoclonal MDM2 (D-12, 1:100, Santa Cruz Biotechnology), polyclonal Bcl-xL (2762, 1:500, Cell Signaling Biotechnology, Beverly, MA), monoclonal p21 (SX118, 1:500, Dakocytomation, Glostrup, Denmark), monoclonal p53 (M7001, 1:1000, DakoCytomation), polyclonal phospho-Chk1 (Ser317) (2344, 1:500, Cell Signaling Biotechnology) and polyclonal phospho-Chk2 (Thr68) (2661, 1:500, Cell Signaling Biotechnology), monoclonal
-H2AX (Ser139) (05-636, 1:2000, Upstate Biotechnology, Lake Placid, NY), polyclonal p16 (C-20, 1:100, Santa Cruz Biotechnology), monoclonal p27 (40932, 1:500, BD Biosciences, Franklin Lakes, NJ), polyclonal caspase-3 (9662, 1:250, Cell Signaling Biotechnology), polyclonal poly ADP ribose polymerase (PARP) (9542, 1:500, Cell Signaling Biotechnology). Expression of actin was also measured as an internal loading control using a polyclonal antibody (C-11, 1:1000, Santa Cruz Biotechnology). Results represent three independent experiments.
Immunofluorescent staining of
-H2AX
Detailed experimental procedures have been described previously (24).
p14ARF small interfering RNA oligonucleotide transfection
Cells (3 x 105) were plated onto six-well plates (IWAKI) the day before small interfering RNA (siRNA) duplex transfection and maintained in keratinocyte serum-free medium (Invitrogen) without antibiotics. Five milligrams of Lipofectamine 2000TM (Invitrogen) and 100 pmol siRNA duplex (5'GCGGAAGGUCCCUCAGACAUU3') targeted p14ARF (si-p14ARF; Dharmacon, Lafayette, CO) were diluted in 250 µl culture medium without antibiotics, respectively. After 5 min incubation at room temperature, the diluted lipofectamine reagent was mixed with the diluted siRNA duplex and further incubated for 20 min at room temperature. The mixture was then added to cultured cells for 5 h. The siRNA duplex mixture was then removed and fresh keratinocyte serum free-medium culture medium without antibiotics was added. One day after transfection, cells were then treated with a range of CP doses (10, 25, 50 and 100 ng/ml) for 72 h or H2O2 (50, 100, 200, 300 and 400 µM) for 2 h followed by 3 days culture in normal medium. Same amount of non-targeting siRNA duplex (si-con, 5' UAAGGCUAUGAAGAGAUAC 3'; Dharmacon) was used as a control and transfected using the same procedures.
Semi-quantitative reverse transcriptase–polymerase chain reaction
RNA was extracted using Trizol reagent (Invitrogen). Two micrograms of RNA was subjected to reverse transcription using SuperScript II RT kit (Invitrogen). glyceraldehyde-3-phosphate dehydrogenase (GAPDH), expression was examined as an internal control. The TWIST primer sequences were 5'-CGGACAAGCTGAGCAAGATT-3' (forward) and 5'-CCTTCTCTGGAAACAATGAC-3' (reverse) and p14ARF primer sequences were 5'-GTTTTCGTGGTTCACATCCC-3' (forward) and 5'-ACCAGCGTGTCCAGGAA G-3' (reverse) (26) and GAPDH primer sequences were 5'-ACCACAGTCCATGCCATCAC-3' (forward) and 5'-TCCACCACCCTGTTGCTGTA-3' (reverse). Polymerase chain reaction amplification for TWIST mRNA consisted of one denaturation cycle at 94°C for 10 min followed by 35 cycles at 94°C for 30 s, 46°C for 30 s, 72°C for 2 min and a final extension at 72°C for 7 min. The amplification condition for p14ARF was 94°C for 10 min followed by 30 cycles at 94°C for 30 s, 50°C for 30 s, 72°C for 2 min and a final extension at 72°C for 7 min. The amplification condition for GAPDH was 94°C for 10 min followed by 25 cycles at 94°C for 30 s, 58°C for 30 s, 72°C for 2 min and a final extension at 72°C for 7 min. Polymerase chain reaction conditions for each set of primers were optimized to ensure that the reaction was at logarithmic phase.
| Results |
|---|
|
|
|---|
Inactivation of TWIST results in up-regulation of p14ARF
To investigate if TWIST was essential for the continuous growth of non-malignant PrECs, we transfected a vector containing a small hairpin RNA that targeted the TWIST gene (Sh-TWIST) and a control vector (Sh-Con) into two HPV16E6/E7 immortalized PrEC lines, NPTX and Hpr-1, which showed a moderate TWIST expression compared with a prostate cancer cell line, PC3 (Figure 1A). As shown in Figure 1B, both TWIST protein and mRNA expression levels were significantly suppressed in the Sh-TWIST stable transfectants compared with Sh-Con-transfected cells. BrdUrd incorporation assay showed that there was no significant alteration in cell proliferation rate between the Sh-TWIST transfectants and the vector control (Figure 1C, P > 0.05), suggesting that TWIST is not essential for cell proliferation. However, we found that p14ARF expression was much higher in the Sh-TWIST transfectants, which was associated with deceased expression levels of MDM2, p53 and p21 (Figure 1D). Previously, it was reported that the TWIST-induced p14ARF down-regulation occurred at transcription level; in this study, reverse transcriptase–polymerase chain reaction analysis also showed that the mRNA levels of p14ARF were much higher in the Sh-TWIST transfectants (Figure 1E). In contrast, the expression level of p16 was not effected by TWIST inactivation (Figure 1D), indicating a specific negative effect of TWIST on p14ARF.
|
TWIST suppression promotes cellular senescence
To investigate if the increased p14ARF expression in the Sh-TWIST transfectants played a positive role in promoting cellular senescence in PrECs, we treated both pairs of transfectants with CP and H2O2 and performed SA-β-gal staining, a commonly used marker for identification of senescent cells (27). As shown in Figure 2A, higher percentage of SA-β-gal-positive cells was found in the Sh-TWIST transfectants (filled columns) compared with the controls (open columns) in response to both agents in a dose-dependent manner. This was associated with a decreased cell proliferation rate examined by BrdUrd incorporating assay (Figure 2B, filled columns versus open columns). These results suggest that suppression of TWIST expression promotes cellular senescence in PrEC. Western blotting analysis showed that the expression levels of p14ARF were much higher in the Sh-TWIST transfectants after exposure to H2O2 (Figure 2C) or CP (Figure 2D) in a dose-dependent manner. In contrast, the level of MDM2 was decreased, which was associated with up-regulation of p53 and p21, suggesting that inactivation of TWIST promotes p14ARF-MDM2-p53-mediated DNA damage response pathway.
|
Inactivation of TWIST leads to accumulation of phosphorylated histone H2AX and activation of Chk1/2
Stress induced by DNA damage, i.e. double-strand breaks, activates certain signaling kinases which lead to phosphorylation of histone H2A.X (
H2AX) to the site of DNA damage. It is suggested that the phosphorylation of H2AX facilitates the assembly of repair factors and activation of the Chk1/2 transducer kinases, which play a key role in activation of p53-mediated growth arrest and subsequent cellular senescence (28). Next, we investigated if increased sensitivity to DNA damage-induced senescence in the Sh-TWIST cells was associated with an increased
H2AX accumulation. As shown in Figure 3A, after exposure to H2O2 and CP, increased number of Sh-TWIST transfectants showed positive
H2AX staining compared with vector control. Western blotting also demonstrated that
H2AX expression levels were much higher in the Sh-TWIST cells than the Sh-Con cells after exposure to H2O2 (Figure 3B, left panels) and CP (right panels) in both cell lines. To exclude the possibility that the increased
H2AX expression was the result of DNA fragmentation, which occurred in apoptotic cells as reported previously (29), we then examined the levels of caspase-3 and PARP cleavage. As shown in Figure 3B, there was no apparent difference in the levels of cleaved caspase-3 or PARP between the cells with high and low levels of
H2AX, indicating that the accumulation of
H2AX in Sh-TWIST cells is not due to increased apoptosis. We also found that the levels of phosphorylated forms of Chk1 and Chk2 kinases at Ser 317 and Thr 68, respectively, which are indicators of activation of the Chk1/2-mediated DNA damage response (30), were much higher in the Sh-TWIST transfectants compared with Sh-Con after exposure to H2O2 (Figure 3C, left panels) and CP (right panels). These results demonstrate that inactivation of TWIST promotes double-strand break accumulation and subsequent Chk1/2 activation.
|
Inactivation of p14ARF reverses the DNA damage-induced cellular senescence in Sh-TWIST cells
To further confirm the role of p14ARF in TWIST-mediated cellular senescence, we then suppressed p14ARF gene expression in the Sh-TWIST transfectants using siRNA technology to study if down-regulation of p14ARF could reverse the Sh-TWIST-induced senescence. As shown in Figure 4A, p14ARF expression was significantly suppressed in the Sh-TWIST cells treated with si-p14ARF compared with the same cells treated with the control sequence (si-con) in both cell lines. In addition, down-regulation of p14ARF in the Sh-TWIST cells resulted in up-regulation of MDM2, which was associated with suppression of p53 and p21 expression in response to H2O2 and CP. In addition, as shown in Figure 4B, the levels of
H2AX were much higher in the Sh-TWIST + si-p14ARF cells which were correlated with lower levels of p-Chk1/2 compared with the Sh-TWIST cells treated with si-con. These results suggest that suppression of p14ARF in the Sh-TWIST cells leads to inhibition of the MDM2/p53 DNA damage response pathway and subsequent increased accumulation of double-strand breaks. In addition, we also found that after exposure to H2O2 and CP, much lower percentage of Sh-TWIST + si-p14ARF cells showed SA-β-gal-positive staining (Figure 4C, solid columns) compared with the Sh-TWIST + si-con cells (filled columns). In contrast, the reverse correlation was found in BrdUrd incorporation rate between these two cell lines (Figure 4D). These results suggest that suppression of p14ARF can reverse the sensitivity to senescence induced by TWIST inactivation. However, when we compared the difference in the percentage of SA-β-gal- and BrdUrd-positive cells between the Sh-TWIST + si-p14ARF cells (solid columns) and the parental cells (open columns), no significant difference was found (P > 0.05). These results suggest that inactivation of both TWIST and p14ARF does not provide growth advantage for PrECs.
|
Over-expression of TWIST expression leads to down-regulation of p14ARF, suppression of DNA response and cellular senescence
To further confirm the negative role of TWIST in cellular senescence, we then transfected a FLAG-tagged TWIST expression vector into both NPTX and HPr-1 cell lines and studied if TWIST over-expression could suppress the p14ARF-mediated DNA damage response and subsequent cellular senescence. As shown in Figure 5A (left panel), the FLAG-tagged TWIST protein was detected in the TWIST transfectants but not in the vector control, indicating a successful ectopic TWIST expression. Reverse transcriptase–polymerase chain reaction analysis showed that the expression of TWIST was also up-regulated at transcription level which was associated with down-regulation of p14ARF (right panel). We also found that the p14ARF expression levels were much lower in the TWIST over-expressing cells, either before or after exposure to H2O2 (Figure 5B, left panels) and CP (right panels), compared with the vector control, confirming the negative effect of TWIST on p14ARF. In addition, the p53 and p21 levels were lower in the TWIST over-expressing cells compared with the vector control, especially after drug treatment (Figure 5B). Furthermore, we found that the level of
H2AX was higher in the TWIST over-expressing cells either before or after drug treatment compared with the vector control (Figure 5C), which was associated with lower levels of phosphorylated Chk1/2 proteins, especially after drug treatment. These results implicate an impaired DNA damage response in the TWIST over-expressing cells even in the presence of high levels of DNA damage. SA-β-gal staining experiments revealed that cells with high levels of TWIST (solid columns) had lower percentage of β-gal-positive cells (Figure 5D) compared with the vector control (open columns) after exposure to H2O2 or CP in a dose-dependent manner. In contrast, the BrdUrd incorporation rate was much higher in the TWIST over-expressing cells (Figure 5E). These results suggest that in the presence of increased DNA damage, the TWIST over-expressing cells are able to proliferate through inhibition of cellular senescence.
|
| Discussion |
|---|
|
|
|---|
The hypothesis that TWIST may be a novel oncogene was first suggested <10 years ago when it was reported to promote anchorage-independent growth in MEFs (2). More recently, TWIST was demonstrated to be a key factor in promoting epithelial–mesenchymal transition during metastasis of breast cancer (6). Since then, increased number of studies have reported the positive involvement of TWIST in the development and progression of cancer through protection against apoptosis (7–9,31,32) and promoting cancer cell invasion via a number of signaling pathways (7,9,13,33). In this study, we have demonstrated a novel role of TWIST in suppressing cellular senescence and its association with DNA damage response pathways in non-malignant PrECs. Unlike reported previously in rodent cells, which showed that the TWIST-induced soft agar colony formation was mediated through suppression of apoptosis pathway (2), we found that TWIST was able to promote cell proliferation through negative regulation of p14ARF-mediated cellular senescence. Over-expression of TWIST in non-malignant human epithelial cells led to inhibition of p14ARF-mediated MDM2/p53 and Chk1/2 DNA damage response pathways resulting in accumulation of DNA damage. However, instead of growth arrest as observed in the cells with low levels of TWIST, the TWIST over-expressing cells continued to proliferate, suggesting that TWIST plays a positive role in promoting genomic instability. Our results demonstrate a novel oncogenic effect of TWIST through abolishing p14ARF-mediated DNA damage response, leading to escape of cellular senescence.
Cellular senescence is regarded as an intrinsic protective mechanism that removes uncontrolled proliferating cells, and acts as a safeguard against immortalization and malignant transformation. Over-expression of oncogenes such as Ras and Myc in normal cells induces up-regulation of p14ARF, which in turn leads to cellular senescence (34,35). In contrast, during transformation induced by certain oncogenes such as TWIST, p14ARF is down-regulated (2,36), suggesting that inactivation of p14ARF is essential for uncontrolled cell proliferation. In this study, we found that p14ARF level was increased when TWIST expression was suppressed in the immortalized human PrECs (Figure 1D), confirming previous reports of the negative association between TWIST and p14ARF (2,8). The p14ARF up-regulation became more significant after these cells were treated with H2O2 and CP, which was associated with high percentage of cells undergoing senescent-like growth arrest (Figure 2A and B). In contrast, over-expression of TWIST led to suppression of p14ARF expression and subsequently decreased SA-β-gal-positive cells (Figure 5A, D and E), suggesting that the negative role of TWIST on cellular senescence is associated with its inhibitory effect on p14ARF. Recently, it was reported that inactivation of p14ARF-mediated p53 DNA damage pathway played a key role in the immortalization of human mammary epithelial cells (18,37). Although the cell lines used in this study were immortalized by HPV16E6/E7 oncogenes, the p53-mediated DNA response seemed to be functional (Figure 2C and D) as reported previously in certain HPV16E6/E7 immortalized cell lines (38). We found that the TWIST-induced p14ARF down-regulation was correlated with a suppression of p53/p21 expression in response to H2O2 and CP (Figure 5B), indicating a negative effect of TWIST on p53-mediated DNA damage response. However, a more significant correlation was found between decreased p14ARF expression and suppression of Chk1/2 phosphorylation in response to DNA damage (Figures 3, 4B and 5C![]()
), suggesting a possible p53-independent DNA damage response. This hypothesis is supported by previous reports that activation of Chk1/2 kinase plays a key role in the p14ARF-mediated cell cycle arrest in both p53-dependent and -independent manners (19,20). It is possible that the TWIST-induced p14ARF down-regulation may be able to promote cell proliferation through suppression of cellular senescence on one hand and to induce impairment of DNA damage response on other. As a consequence, cells with high levels of TWIST are able to achieve uncontrolled proliferation in the presence of genomic instability (Figure 5).
Recently, it is demonstrated that
H2AX accumulation accompanied with activation of the DNA damage checkpoint Chk1/2 kinases is one of the characteristics of human senescent fibroblasts (39). In this study, we found that increased
H2AX accumulation was observed in the sh-TWIST-transfected cells which was associated with increased Chk1/2 activation and high percentage of cells undergoing senescence (Figures 2 and 3). However, increased
H2AX expression was also observed in TWIST over-expressing cells (Figure 5C), which seems to be contradictory to the results generated in the sh-TWIST cells. However, in contrast to that observed in the sh-TWIST cells, the levels of p53/p21 and Chk1/2 phosphorylation were much lower in the TWIST over-expressing cells in the presence of high levels of
H2AX (Figure 5C). It is possible that the low levels of p14ARF in these cells may prevent activation of both p53-dependent and -independent DNA damage response resulting in accumulation of DNA damage. Most importantly, unlike the sh-TWIST cells which underwent cell growth arrest (Figure 2A and B), the lack of DNA damage response led to escape of cell growth arrest in the TWIST over-expressing cells, which may result in accumulation of genomic instability. To further support this view, recently, several studies demonstrated frequent aberrations of the ATM/ATR DNA damage checkpoint in human cancer samples (40–42). Therefore, we propose that over-expression of TWIST leads to down-regulation of p14ARF which may impair the DNA damage checkpoint that is normally activated in normal cells, thus promoting uncontrolled cell proliferation with genomic instability and tumorigenesis. Our results provide a novel molecular mechanism that accounted for the oncogenic function of TWIST in the development of human cancer.
Over the last few years, numerous studies have reported up-regulation of TWIST in the clinical specimens of many types of human cancer and its expression levels are negatively correlated with drug resistance and poor clinical outcome (3,4,6,9–13). Previously, we found that amplification of TWIST played a key role in the development of acquired resistance to one of the commonly used anticancer drugs, taxol (8). In addition, inactivation of TWIST leads to increased sensitivity to a DNA-damaging agent, etopside (43). The evidence demonstrated in this study may also provide a possible molecular explanation responsible for the role of TWIST in the development of drug resistance and poor clinical response in cancer patients.
| Acknowledgments |
|---|
The work was supported by the Research Grants Council of Hong Kong) grants HKU7470/04M, and HKU7490/03M (Y. C. Wong).
Conflict of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Rose CS, et al. A TWIST in development. Trends Genet. (1997) 13:384–387.[CrossRef][Web of Science][Medline]
- Maestro R, et al. Twist is a potential oncogene that inhibits apoptosis. Genes Dev. (1999) 13:2207–2217.
[Abstract/Free Full Text] - Valsesia-Wittmann S, et al. Oncogenic cooperation between H-Twist and N-Myc overrides failsafe programs in cancer cells. Cancer Cell (2004) 6:625–630.[CrossRef][Web of Science][Medline]
- Hoek K, et al. Expression profiling reveals novel pathways in the transformation of melanocytes to melanomas. Cancer Res. (2004) 64:5270–5282.
[Abstract/Free Full Text] - van DR, et al. Aberrant expression of the tyrosine kinase receptor EphA4 and the transcription factor twist in Sezary syndrome identified by gene expression analysis. Cancer Res. (2004) 64:5578–5586.
[Abstract/Free Full Text] - Yang J, et al. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell (2004) 117:927–939.[CrossRef][Web of Science][Medline]
- Cheng GZ, et al. Twist transcriptionally up-regulates AKT2 in breast cancer cells leading to increased migration, invasion, and resistance to paclitaxel. Cancer Res. (2007) 67:1979–1987.
[Abstract/Free Full Text] - Wang X, et al. Identification of a novel function of TWIST, a bHLH protein, in the development of acquired taxol resistance in human cancer cells. Oncogene (2004) 23:474–482.[CrossRef][Web of Science][Medline]
- Kwok WK, et al. Up-regulation of TWIST in prostate cancer and its implication as a therapeutic target. Cancer Res. (2005) 65:5153–5162.
[Abstract/Free Full Text] - Yuen HF, et al. Significance of TWIST and E-cadherin expression in the metastatic progression of prostatic cancer. Histopathology (2007) 50:648–658.[CrossRef][Web of Science][Medline]
- Zhang Z, et al. Significance of TWIST expression and its association with E-cadherin in bladder cancer. Hum. Pathol. (2007) 38:598–606.[CrossRef][Web of Science][Medline]
- Man TK, et al. Expression profiles of osteosarcoma that can predict response to chemotherapy. Cancer Res. (2005) 65:8142–8150.
[Abstract/Free Full Text] - Lee TK, et al. Twist overexpression correlates with hepatocellular carcinoma metastasis through induction of epithelial-mesenchymal transition. Clin. Cancer Res. (2006) 12:5369–5376.
[Abstract/Free Full Text] - Lowe SW, et al. Tumor suppression by Ink4a-Arf: progress and puzzles. Curr. Opin. Genet. Dev. (2003) 13:77–83.[CrossRef][Web of Science][Medline]
- Sherr CJ. Divorcing ARF and p53: an unsettled case. Nat. Rev. Cancer (2006) 6:663–673.[CrossRef][Web of Science][Medline]
- Kamijo T, et al. Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF. Cell (1997) 91:649–659.[CrossRef][Web of Science][Medline]
- Dimri GP, et al. Regulation of a senescence checkpoint response by the E2F1 transcription factor and p14(ARF) tumor suppressor. Mol. Cell. Biol. (2000) 20:273–285.
[Abstract/Free Full Text] - Wei W, et al. Role of p14(ARF) in replicative and induced senescence of human fibroblasts. Mol. Cell. Biol. (2001) 21:6748–6757.
[Abstract/Free Full Text] - Rocha S, et al. Regulation of NF-kappaB and p53 through activation of ATR and Chk1 by the ARF tumour suppressor. EMBO J. (2005) 24:1157–1169.[CrossRef][Web of Science][Medline]
- Eymin B, et al. p14ARF activates a Tip60-dependent and p53-independent ATM/ATR/CHK pathway in response to genotoxic stress. Mol. Cell. Biol. (2006) 26:4339–4350.
[Abstract/Free Full Text] - Bright RK, et al. Generation and genetic characterization of immortal human prostate epithelial cell lines derived from primary cancer specimens. Cancer Res. (1997) 57:995–1002.
[Abstract/Free Full Text] - Choo CK, et al. Immortalization of human prostate epithelial cells by HPV 16 E6/E7 open reading frames. Prostate (1999) 40:150–158.[CrossRef][Web of Science][Medline]
- Hamamori Y, et al. Regulation of histone acetyltransferases p300 and PCAF by the bHLH protein twist and adenoviral oncoprotein E1A. Cell (1999) 96:405–413.[CrossRef][Web of Science][Medline]
- Cheung HW, et al. Inactivation of human MAD2B in nasopharyngeal carcinoma cells leads to chemosensitization to DNA-damaging agents. Cancer Res. (2006) 66:4357–4367.
[Abstract/Free Full Text] - Wang X, et al. Evidence of cisplatin-induced senescent-like growth arrest in nasopharyngeal carcinoma cells. Cancer Res. (1998) 58:5019–5022.
[Abstract/Free Full Text] - Xing EP, et al. Mechanisms of inactivation of p14ARF, p15INK4b, and p16INK4a genes in human esophageal squamous cell carcinoma. Clin. Cancer Res. (1999) 5:2704–2713.
[Abstract/Free Full Text] - Dimri GP, et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl Acad. Sci. U S A (1995) 92:9363–9367.
[Abstract/Free Full Text] - von ZT, et al. Human cell senescence as a DNA damage response. Mech. Ageing Dev. (2005) 126:111–117.[CrossRef][Web of Science][Medline]
- Rogakou EP, et al. Initiation of DNA fragmentation during apoptosis induces phosphorylation of H2AX histone at serine 139. J. Biol. Chem. (2000) 275:9390–9395.
[Abstract/Free Full Text] - Zhou BB, et al. Targeting the checkpoint kinases: chemosensitization versus chemoprotection. Nat. Rev. Cancer (2004) 4:216–225.[CrossRef][Web of Science][Medline]
- Pham CG, et al. Upregulation of Twist-1 by NF-{kappa}B blocks cytotoxicity induced by chemotherapeutic drugs. Mol. Cell. Biol. (2007) 27((11)):3920–3935.
[Abstract/Free Full Text] - Zhang X, et al. Anti-apoptotic role of TWIST and its association with Akt pathway in mediating taxol resistance in nasopharyngeal carcinoma cells. Int. J. Cancer (2007) 120:1891–1898.[CrossRef][Web of Science][Medline]
- Elias MC, et al. TWIST is expressed in human gliomas and promotes invasion. Neoplasia (2005) 7:824–837.[CrossRef][Web of Science][Medline]
- Palmero I, et al. p19ARF links the tumour suppressor p53 to Ras. Nature (1998) 395:125–126.[CrossRef][Medline]
- Zindy F, et al. Myc signaling via the ARF tumor suppressor regulates p53-dependent apoptosis and immortalization. Genes Dev. (1998) 12:2424–2433.
[Abstract/Free Full Text] - Jacobs JJ, et al. Bmi-1 collaborates with c-Myc in tumorigenesis by inhibiting c-Myc-induced apoptosis via INK4a/ARF. Genes Dev. (1999) 13:2678–2690.
[Abstract/Free Full Text] - Shamanin VA, et al. Immortalization of human mammary epithelial cells is associated with inactivation of the p14ARF-p53 pathway. Mol. Cell. Biol. (2004) 24:2144–2152.
[Abstract/Free Full Text] - Butz K, et al. Functional p53 protein in human papillomavirus-positive cancer cells. Oncogene (1995) 10:927–936.[Web of Science][Medline]
- d'Adda di FF, et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature (2003) 426:194–198.[CrossRef][Medline]
- DiTullio RA Jr, et al. 53BP1 functions in an ATM-dependent checkpoint pathway that is constitutively activated in human cancer. Nat. Cell Biol. (2002) 4:998–1002.[CrossRef][Web of Science][Medline]
- Bartkova J, et al. Aberrations of the Chk2 tumour suppressor in advanced urinary bladder cancer. Oncogene (2004) 23:8545–8551.[CrossRef][Web of Science][Medline]
- Gorgoulis VG, et al. Activation of the DNA damage checkpoint and genomic instability in human precancerous lesions. Nature (2005) 434:907–913.[CrossRef][Medline]
- Dupont J, et al. Insulin-like growth factor 1 (IGF-1)-induced twist expression is involved in the anti-apoptotic effects of the IGF-1 receptor. J. Biol. Chem. (2001) 276:26699–26707.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




