Skip Navigation


Carcinogenesis Advance Access originally published online on August 11, 2007
Carcinogenesis 2007 28(12):2476-2483; doi:10.1093/carcin/bgm186
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/12/2476    most recent
bgm186v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Shao, J.
Right arrow Articles by Sheng, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shao, J.
Right arrow Articles by Sheng, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Heterozygous disruption of the PTEN promotes intestinal neoplasia in APCmin/+ mouse: roles of osteopontin

Jinyi Shao, M.Kay Washington1, Romil Saxena2 and Hongmiao Sheng*

Department of Surgery, Indiana University School of Medicine, Indianapolis, IN 46202, USA
1 Department of Pathology, Vanderbilt University, Nashville, TN 37232, USA
2 Department of Pathology, Indiana University School of Medicine, Indianapolis, IN 46202, USA

* To whom correspondence should be addressed. Tel: +317-274-2630; Fax: +317-274-7334;Email: hsheng{at}iupui.edu


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
The persistent activation of the phosphatidylinositol 3-kinase (PI3K)/Akt pathway is oncogenic and involved in colorectal neoplasia. Mutations of both regulatory subunit and catalytic subunit of PI3K have been demonstrated in colon cancers. In the present study, we show that heterozygous disruption of the phosphatase and tensin homolog (PTEN) tumor suppressor gene promoted tumor progression in APCmin/+ mice. Number and size of intestinal tumors were significantly increased in mice bearing both adenomatous polyposis coli (APC) and PTEN mutations. While APCmin/+PTEN+/+ mice developed adenomas, invasive carcinomas developed in APCmin/+PTEN+/– mice. Large tumors often resulted in intestinal intussusception and early death of APCmin/+PTEN+/– mice. Targeted array revealed that osteopontin (OPN) was the leading gene whose expression was strongly induced by deficiency of PTEN. In colon cancer cells, gain-of-function mutation of PI3K robustly increased levels of OPN and treatment with OPN reduced growth factor deprivation-induced programmed cell death. Moreover, OPN expression was strongly increased in Ras-induced transformation of intestinal epithelial cells in a PI3K-dependent manner. Inhibition of OPN expression by specific small interfering RNA reduced uncontrolled growth and invasiveness of Ras-transformed intestinal epithelial cells. Thus, our results suggest that the PI3K pathway promotes the transformation of intestinal adenoma to adenocarcinoma. OPN, a downstream effector of PI3K, protects transformed intestinal epithelial cells from programmed cell death and stimulates their anchorage-independent growth.

Abbreviations: ELISA, enzyme-linked immunosorbent assay; IPTG, isopropyl-1-thio-β-D-galactopyranoside; mRNA, messenger RNA; OPN, osteopontin; RT–PCR, reverse transcription–polymerase chain reaction; siRNA, small interfering RNA


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 Funding
 References
 
Colorectal cancer is the second leading cause of cancer-related death in USA. While it is clear that (APC) mutation is an initiating factor in ~85% of colorectal carcinomas, a number of other pathways play critical roles during the adenoma to carcinoma sequence of events involved in the neoplastic transformation of colonic epithelium (1); one of these is the PI3K/Akt pathway (2). A number of components of the PI3K pathway are genetically altered in human colon cancers. Somatic mutations of the p85{alpha} regulatory subunit of the PI3K{alpha} have been demonstrated in human colon cancer, which lead to constitutive activation of PI3K (3). PIK3CA, which encodes the p110{alpha} catalytic subunit, is mutated in ~32% colon cancers, which often cluster in the helical and catalytic domains (4). Studies of PIK3CA mutants suggest that mutations in both helical and catalytic domains increase the lipid kinase activity of the PIK3CA, thereby enhancing its pro-neoplastic actions (5,6). Functionally, activation of PI3K promotes a wide range of cellular processes associated with malignant behavior of cancers. PI3K activity is critical for proliferation of transformed and non-transformed intestinal epithelial cells (7,8). Colon cancer cells that contain mutant PIK3CA possess significant advantage in cell growth and invasion (5). Activation of the PI3K/Akt pathway is important for Ras transformation of mammalian cells and essential in Ras-induced cytoskeletal re-organization (9). We have demonstrated previously the critical role of the PI3K/Akt pathway in Ras-mediated transformation of intestinal epithelial cells (7).

The PI3K/Akt-signaling pathway transmits signals from tyrosine kinase-coupled receptors and plays critical roles in mitogenic signaling (10). Class IA PI3Ks (PI3K{alpha}, PI3Kβ and PI3K{delta}) consist of an 85 kDa regulatory subunit and a catalytic 110 kDa subunit (p110{alpha}, p110β and p110{delta}). The PI3K catalytic subunit phosphorylates the D3 hydroxyl group of phosphoinositides; products include phosphatidylinositol-3,4,-P2 (PtdIns-3,4-P2) and PtdIns-3,4,5-P3, which then phosphorylate and activate Akt kinase. The serine/threonine kinase, Akt, regulates gene transcription by direct phosphorylation of some of the forkhead transcription factors, such as FKHR, FKHRL and AFX (11–13) or indirectly by modifying the cAMP-responsive element-binding protein (14,15), E2F (16) or nuclear factor-{kappa}B (17). On the other hand, the tumor suppressor PTEN (phosphatase and tensin homolog) dephosphorylates the 3rd position of both PtdIns-3,4,5,-P3 and PtdIns-3,4,-P2, reverses the reaction catalyzed by PI3K and restrains the activation of Akt (18,19). PTEN is often deleted or mutated in a variety of human tumor types (20,21). Inactivation of the PTEN in mouse models, results in development of a range of tumors, including prostate and breast cancer, as well as hyperplasia of the lymphoid, gynecological and gastrointestinal mucosa (22).

In the present study, we attempted to elucidate the role of the PI3K pathway in malignant transformation of intestinal epithelium initiated by APC mutations in an animal model. We cross-bred PTEN+/– mice with APCmin/+ mice. PTEN deficiency significantly promoted tumor development, stimulating tumor growth and invasion. Intestinal obstruction resulting from intussusception was the major cause for the early death of APCmin/+PTEN+/– mice. The observations from animal studies led us to compare the gene expression profile between APCmin/+PTEN+/+ and APCmin/+PTEN+/– tumors. Focused oligo array determined that osteopontin (OPN) was the leading gene whose expression was induced by heterozygous mutation of PTEN. Furthermore, we found that OPN was significantly increased in transformed intestinal epithelial cells in a PI3K-dependent manner and played crucial roles in the growth of transformed intestinal epithelial cells.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 Funding
 References
 
Animal experiments
All animals were treated in a manner which complied with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and the study was approved by the Institutional Animal Care and Use Committee of Indiana University. APCmin/+ mice on C57BL/6J background were purchased from Jackson Laboratory (Bar Harbor, ME). PTEN+/– mice on 129/C57/BL6 background were kindly provided by Dr Pier Paolo Pandolfi (Memorial Sloan-Kettering Cancer Center, New York, NY) (23). Mice were housed in an animal-holding room under controlled light, temperature and humidity.

Cell culture and reagents
Human colon cancer HCT116 cells containing wild-type (HCT116/PI3K WT) or mutated (HCT116/PI3K MU) PIK3CA were provided by Drs Yardena Samuels and Bert Vogelstein (The Johns Hopkins University Medical Institutions, Baltimore, MD) (5). The rat RIE-iHa-Ras cell line with an inducible Ha-RasVal12 cDNA was generated by using LacSwitch eukaryotic expression system (Stratagene, La Jolla, CA) and grown in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum (7,8). The mutated Ras cDNA is under the transcriptional control of the Lac operon. IPTG (isopropyl-1-thio-β-D-galactopyranoside; Gibco BRL, Gaithersburg, MD) at a concentration of 5 mM was used to induce the expression of mutated Ha-Ras. LY 294002 and PD-98059 were purchased from Calbiochem (San Diego, CA). Human OPN was purchased from R&D Systems (Minneapolis, MN).

Cancer PathwayFinder Oligo GEArray
To determine the relative expression levels of cancer-related genes, Mouse Cancer PathwayFinder Oligo GEArray (SuperArray Bioscience Corporation, Frederick, MD) was carried out that profiles the expression of 113 genes representative of six biological pathways involved in transformation and tumorigenesis. Biotin-labeled probe was synthesized from total RNA and hybridized with a nylon membrane printed with proprietary probes. The array image was captured with chemiluminescence detection and analyzed using the software of GEArray Expression Analysis Suite.

Reverse transcription–polymerase chain reaction
Levels of OPN in mouse tumors and rat intestinal epithelial cells were determined using reverse transcription–polymerase chain reaction (RT–PCR) as described previously (24). Primer set for mouse OPN was based on mouse OPN messenger RNA (mRNA) sequence (NM_009263 [GenBank] ) including forward primer, AAAGTGACTGATTCTGGCAGC and reverse primer, GGAAACTCCTAGACTTTGACC. PCR products were 421 bp in length. The primers used to amplify 295 bp of the rat OPN (NM_012881 [GenBank] ) include forward primer, ATGAGGCTATCAAGGTCATCC and reverse primer, TGTGAAACTCGTGGCTCT GAT. RT–PCR was carried out using ProStar RT–PCR system (Stratagene) according to the manufacturer's instructions.

Real-time RT–PCR
OPN expression was quantified using real-time quantitative PCR (Applied Biosystems, Foster City, CA). The sequence of the primer/probe set was based on rat OPN mRNA sequence (GeneBank NM_012881 [GenBank] ) and includes forward primer, CGCCATGCTATCGACAGTCAGGCG, and reverse primer, TGTGAAACTCGTGGCTCTGATG. An 18S ribosomal RNA TaqMan® assay reagent was used for internal control. One-step RT–PCR was performed with 10 ng RNA for both target gene and endogenous controls. Duplicate CT values were analyzed in Microsoft Excel using the comparative CT ({Delta}{Delta}CT) method as described by the manufacturer (Applied Biosystems). The expression of OPN was normalized to the levels of 18S and relative to the OPN levels in non-transformed RIE-iHa-Ras cells.

Immunoblot analysis
Immunoblot analysis was performed as described previously (25). Anti-OPN antibodies were purchased from Developmental Studies Hybridoma Bank (Iowa, IA).

Immunohistochemistry
Tumors were fixed in 10% formalin, paraffin-embedded and sectioned. Endogenous peroxidase activity was quenched by incubating the sections in 0.3% hydrogen peroxide for 20 min at room temperature. After blocking in 1.5% normal serum in phosphate-buffered saline for 1 h, {alpha}-OPN antibody (Developmental Studies Hybridoma Bank, 1:200) or mouse pre-immune IgG (negative control) was added to the sections and incubated overnight at 4°C. The sections were then incubated with biotinylated secondary antibody and ABC-Alkaline phosphatase (AP) reagent (Vectorstain ABC-AP kit, Vector Laboratories, Burlingame, CA). Peroxidase activity was demonstrated by applying 3,3'-diaminobenzidine containing 0.02% of hydrogen peroxide for 10 min. The sections were counterstained with toluidine blue O.

Enzyme-linked immunosorbent assay
Levels of human or rat OPN protein in cell culture media were quantified using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems). Cells (5 x 105) were seeded in 60 mm plates and conditioned media were collected at the indicated time points for ELISA assays. Cells were then lysed in lysis buffer; protein concentrations were determined by Bio-Rad protein assay and used to standardize the levels of OPN in conditioned media. The results were expressed as the amount of OPN in conditioned media per milligram of cellular protein.

Cellular DNA fragmentation
DNA fragmentation was determined by either electrophoresis or ELISA. HCT116 cells were grown to confluence in 60 mm plates. After a 48 h serum deprivation, floating and attached cells were collected and lysed in lysis buffer (1% NP-40 in 20 mM ethylenediaminetetraacetic acid and 50 mM Tris, pH 7.5). The supernatant containing fragmented DNA was clarified by centrifugation for 5 min at 1600g. The cell lysates were treated with a solution containing RNase A (5 mg/ml) and proteinase K (2.5 mg/ml). The DNA was then separated on 1.6% agarose gels. For ELISA assay, Cellular DNA Fragmentation ELISA kit from Roche (Mannheim, Germany) was used according to the manufacturer's instruction. Cells were seeded in 96-well plates and labeled with BrdU. BrdU-labeled DNA fragments in cytosolic fraction were detected by ELISA.

RNA interference
OPN-specific small interfering RNA (siRNA) sequences were purchased from Ambion, Austin, TX (GeneBank accession number NM_012881, siRNA ID 197203 and 197204). Transfection was accomplished using XtremGene transfection reagent (Roche) according to the supplier's instruction. Conditioned media were collected 72 h after transfection and levels of OPN were determined by ELISA assays.

Anchorage-independent growth assay
RIE-i-Ha-Ras cells were placed in 24-well plates and transfected with siRNA. After cells were trypsinized, 1 x 104 cells were mixed with Sea Plaque Agarose (Hoeffer Scientific Instrument, San Francisco, CA) at a final concentration of 0.4% in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum. Cell mixtures were then placed on top of a 0.8% agarose layer in 35 mm plates. One milliter of cover medium containing IPTG was added after the gel was polymerized. Colonies were photographed after a 10 day incubation using a computerized digital camera. The size of colonies was measured manually on a computer screen.

Data analysis
All statistical analyses were performed on a personal computer with the StatView 5.0.1 software (SAS Institute, Cary, NC). Analyses between two groups were determined using the unpaired Student's t-test. Differences with a P value of <0.05 were considered as statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 Funding
 References
 
PTEN deficiency stimulated tumor progression in APCmin/+ mice
The APCmin/+ mouse serves as a murine model for familial adenomatous polyposis (26). Mice heterozygous for PTEN (PTEN+/– mice), which have increased PI3K/Akt activity, spontaneously develop malignant tumors in a variety of organs (23,27). In order to determine whether elevated PI3K activity stimulated tumor progression in APCmin/+ mice, we cross-bred PTEN-deficient mice with APCmin/+ mice to generate double-heterozygous offspring. To control for the variation of genetic backgrounds, littermates were used for this study. Since most of animals carrying both APC and PTEN mutations died within 5 months, we killed all F1 mice at age between 4 and 4.5 months. The results of tumor growth in mouse intestine were summarized in Table I. There was no intestinal tumor in both APC+/+PTEN+/+ and APC+/+PTEN+/– mice at this age. While approximately six tumors were found in the gut of APCmin/+PTEN+/+ mice, on average, 22 tumors were observed in the intestine of APCmin/+PTEN+/– littermates. The size of tumors in APCmin/+PTEN+/– mice were significantly larger than those in APCmin/+PTEN+/+ mice (P < 0.0001) (Figure 1A).


View this table:
[in this window]
[in a new window]

  		Table I. Comparison of tumor number, tumor size and carcinoma incidence

 


Figure 1
View larger version (64K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. PTEN deficiency promoted the progression of intestinal neoplasia in APCmin/+ mice. (A) APCmin/+PTEN+/+ or APCmin/+PTEN+/– mice were killed at 4.5 months. Entire intestine was opened longitudinally and fixed in 10% formalin. (B) Micrographs of hematoxylin and eosin stained tumor sections. Low-grade dysplasia in APCmin/+PTEN+/+ polyp (a, x200). Advanced adenoma in APCmin/+PTEN+/– mice (b, x200). Invasive adenocarcinoma in APCmin/+PTEN+/– mice and the arrow indicates carcinoma penetrating into the muscle layer (c, x200). (C) PTEN deficiency led to intestinal intussusception in APCmin/+PTEN+/– mice. (a) Intestinal obstruction resulted from intussusception (arrow). (b) Demonstration of intussusceptum (right arrow) and intussuscipiens (left arrow). (c) A large tumor (arrow) was the causative lead point of the intestinal intussusception.

 
Histologic analysis showed that adenomas of APCmin/+PTEN+/+ mouse intestine were similar to APCmin/+ tumors. The irregular crypts comprising the adenoma are lined by columnar cells that are larger than normal intestinal epithelial cells, with increased nuclear to cytoplasmic ratio (Figure 1B, left panel). Most adenomas show changes of low-grade dysplasia; in more advanced lesions with high-grade dysplasia, complex crypt outlines with cribriform glands and loss of nuclear polarity are seen. In contrast, adenomas from PTEN-deficient APCmin/+ mice showed a much more advanced growth pattern which were more solid with higher grade of dysplasia (Figure 1B, middle panel). Stromal desmoplasia and infiltrative appearance of glands at the base of lesions suggested early invasion. Moreover, invasive carcinomas were identified in 8/10 of APCmin/+PTEN+/– mouse intestine (Figure 1B, right panel). Intestinal intussusception resulted from large tumors was observed in >50% of APCmin/+PTEN+/– mice which led to chronic intestinal obstruction (Figure 1C). As a result, most APCmin/+PTEN+/– mice were ill and inactive by 4.5 months and the life span for these mice was ~5 months. In contrast, APCmin/+PTEN+/+ mice were healthy and active at the end of the experiment. These results suggest that increased PI3K activity, which resulted from PTEN deficiency, promoted APC mutation-initiated intestinal neoplasia in mice.

PTEN deficiency induced OPN
The PI3K pathway regulates the expression of a large number of genes. In order to determine the mechanism by which PTEN deficiency promoted the growth and invasion of intestinal tumors, we next compared the gene expression profile between APCmin/+PTEN+/+ tumors and APCmin/+PTEN+/– tumors, using Mouse Cancer PathwayFinder Oligo GEArray. The expression of 113 genes representative of six biological pathways involved in cell cycle control, apoptosis, signal transduction molecules, cell invasion and angiogenesis were analyzed. Three independent assays were conducted to compare differential gene expression profile between APCmin/+PTEN+/+ intestinal adenomas and invasive APCmin/+PTEN+/– adenocarcinomas. As demonstrated in Table II, the expression of a number of genes which related to cell growth and death was modestly differential. Interestingly, OPN was determined as the leading gene which was expressed in APCmin/+PTEN+/+ tumors at relatively low levels; however, it was increased 4- to 5-fold in APCmin/+PTEN+/– tumors. To confirm the array results, RT–PCR and western analysis were conducted. RNA was extracted from APC+/+PTEN+/+ mucosa and tumors of both APCmin/+PTEN+/+ and APCmin/+PTEN+/– mice. While OPN mRNA was barely detected in normal intestinal mucosa, expression of OPN was increased in APCmin/+PTEN+/+ tumors. Levels of OPN mRNA were further elevated in APCmin/+PTEN+/– tumors (Figure 2A). Western analysis reproduced similar results; levels of ~66 kDa OPN protein were significantly higher in APCmin/+PTEN+/– tumors compared with those in APCmin/+PTEN+/+ littermates (Figure 2B). Immunohistochemistry revealed that expression of OPN in normal intestine was barely detected (Figure 2C, panel a). Levels of OPN protein were increased in APCmin/+PTEN+/+ adenomas (Figure 2C, panel b). However, abundant OPN was detected in APCmin/+PTEN+/– adenocarcinomas, which was predominantly localized to the cytoplasm of epithelial cells (Figure 2C, panel d and e). However, immunoreactivity of OPN was clearly detected in the stroma surrounding tumor cells (Figure 2C, panel e). Since OPN has been identified as lead marker of colon cancer progression (28), we decided to further investigate the roles of OPN in PI3K pro-neoplastic actions.


View this table:
[in this window]
[in a new window]

  		Table II. Results of Cancer PathwayFinder Array

 


Figure 2
View larger version (63K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. Induction of OPN in PTEN-deficient APCmin/+ mouse tumors. (A) Total RNA was extracted from intestinal mucosa of APC+/+PTEN+/+ mice, tumors of APCmin/+PTEN+/+ and APCmin/+PTEN+/– mice. Levels of OPN mRNA in APC+/+PTEN+/+ mucosa (WT Mu), APCmin/+PTEN+/+ tumors (PTEN+/+ T) and APCmin/+PTEN+/– tumors (PTEN+/– T) were determined by RT–PCR. (B) Protein was extracted from both APCmin/+PTEN+/+ (PTEN+/+ T) and APCmin/+PTEN+/– (PTEN+/– T) tumors. Levels of OPN protein were determined by western analysis. (C) OPN immunoreactivity in mouse intestine. (a) Normal APC+/+PTEN+/+ mucosa (x100), (b) APCmin/+PTEN+/+ adenoma (x100) and (c) negative control of APCmin/+PTEN+/– adenocarcinoma (x100). Instead of anti-OPN antibody, mouse pre-immune IgG was used in the procedure (x100). (d) APCmin/+PTEN+/– adenocarcinoma (x100), (e) epithelial localization of OPN in APCmin/+PTEN+/– adenocarcinoma (x400) and (f) stromal localization of OPN in APCmin/+PTEN+/– adenocarcinoma (x400).

 
OPN promoted the survival of colon cancer cells
HCT116 colon cancer cell line contains one wild-type PIK3CA allele and one kinase domain mutated PIK3CA allele. Samuels et al. (5) disrupted either the wild-type or mutant alleles and established HCT116 cell lines which express either wild-type PIK3CA (HCT116/PIK3CAWT) or mutant PIK3CA (HCT116/PIK3CAMU) (5). These isogenic cell lines provide excellent models for studying roles of PI3K in colorectal neoplasia. HCT116/PIK3CAWT and HCT116/PIK3CAMU cells grow at similar rates in the presence of serum; deprivation of growth factors results in strong apoptosis in HCT116/PIK3CAWT cells. Large number of floating cells was observed in HCT116/PIK3CAWT cells 48 h after withdrawal of serum (Figure 3A). DNA fragmentation assay revealed that serum deprivation-induced programmed cell death (Figure 3B). In contrast, withdrawal of serum did not lead to significant cell death in HCT116/PIK3CAMU cells. Levels of OPN in HCT116/PIK3CAMU cell-conditioned media were modestly higher than those in HCT116/PIK3CAWT cell-conditioned media when grown in the medium containing 10% fetal bovine serum. Serum deprivation increased the secretion of OPN, particularly in PI3K-mutated HCT116 cells. After a 72 h serum starvation, levels of OPN in HCT116/PIK3CAMU conditioned media were significantly higher than those in HCT116/PIK3CAWT culture media (Figure 3C). In order to determine whether OPN played any roles in HCT116 cell survival, we pre-coated cell culture plates with OPN. Serum deprivation-induced apoptosis was significantly reduced when HCT116/PIK3CAWT cells were grown on OPN-treated plates (Figure 3D). These results suggest that the expression of OPN was correlated to PI3K activity and OPN promoted the survival of colon cancer cells.


Figure 3
View larger version (77K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3. OPN in HCT116 cell lines with wild-type PIK3CA (HCT116/PIK3CAWT) or mutant PIK3CA (HCT116/PIK3CAMU). (A) Serum deprivation-induced apoptosis in HCT116/PIK3CAWT cells. HCT116/PIK3CAWT (WT) or HCT116/PIK3CAMU (MU) cells were placed in 60 mm plates. Cells were cultured in the presence (+S) or absence (–S) of 10% fetal bovine serum for 48 h and photographed using an inverted microscope (x100). (B) DNA fragmentation assay. HCT116/PIK3CAWT (WT) or HCT116/PIK3CAMU (MU) cells were grown to confluence in 60 mm plates. After a 48 h serum deprivation, floating and attached cells were collected and lysed in lysis buffer. The supernatant containing fragmented DNA was treated with RNase A and proteinase K. The DNA was then separated on 1.6% agarose gels. (C) HCT116/PIK3CAWT or HCT116/PIK3CAMU cells (5 x 105) were placed in 60 mm plates. Conditioned media were collected after a 72 h incubation in the presence or absence of 10% fetal bovine serum. Levels of OPN were analyzed by ELISA. Results were normalized to the amount of cellular protein and expressed as OPN per milligram protein. (D) Human recombinant OPN and bovine albumin (Alb) at various ratios were mixed in phosphate-buffered saline, so that the final concentration of protein was 5 µg/ml. The mixture was used to pre-coat 96-well plates (200 µl per well) for 24 h at 4°C. HCT116/PIK3CAWT cells were grown in pre-coated plates for 24 h. BrdU-labeled DNA fragments in cytosolic fraction were quantitated by ELISA after serum was deprived for 24 h. Results were relative to the cells grown in medium containing 10% serum (S).

 
Ras induced OPN in a PI3K- and MAPK-dependent manner
Ectopic expression of mutated Ras leads to transformation of intestinal epithelial cells and activation of the PI3K pathway is essential for this transformation (7). In order to elucidate the roles of OPN in Ras-mediated transformation of intestinal epithelial cells, RIE-i-Ha-Ras cell line with an inducible Ha-RasVal12 cDNA was employed (7). Non-transformed RIE-i-Ha-Ras cells grew as a monolayer and underwent apoptosis when they reached confluence, noted by floating cells (Figure 4A). Following Ras induction, RIE cells acquired a transformed appearance characterized by spindle morphology and growth in overlapping clusters. Addition of a specific inhibitor for PI3K, LY 294002 (20 µM), significantly inhibited the overgrowth and morphologic transformation of Ras-induced RIE cells. On the other hand, a specific inhibitor for MAPK/ERK Kinase (MEK), PD-98059 (25 µM), completely attenuated Ras-mediated transformation, restoring epithelial morphology and inducing apoptosis in RIE-i-Ha-Ras cells. Interestingly, the levels of OPN were low in non-transformed RIE-i-Ha-Ras cells; induction of Ras by IPTG robustly increased levels of OPN mRNA by 48 h. Real-time PCR assay demonstrated that levels of OPN mRNA were increased ~100-fold in Ras-transformed RIE cells compared with non-transformed RIE-i-Ha-Ras cells (Figure 4B, left panel). While OPN protein was barely detected in non-transformed RIE-i-Ha-Ras cell culture media, levels of OPN increased ~16-fold in RIE-i-Ha-Ras conditioned media by 72 h after addition of IPTG (Figure 4B, right panel). Activation of PI3K was required for Ras induction of OPN, since the presence of LY 294002 completely attenuated the induction of OPN mRNA and protein (Figure 4C). LY 294002 concentration dependently inhibited the secretion of OPN by Ras-transformed RIE cells. Additionally, MEK/extracellular signal-regulated kinase activity was also essential for Ras-induced OPN production; PD-98059 completely blocked the induction of OPN as well.


Figure 4
View larger version (42K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4. Expression of OPN in transformation of RIE-i-Ha-Ras cells. (A) RIE-i-Ha-Ras cells were treated with vehicle (a), 5 mM IPTG (b), IPTG plus 20 µM LY 294002 (c) or IPTG plus 25 µM PD-98059 (d) for 72 h and photographed (x100). (B) RIE-i-Ha-Ras cells were treated with vehicle (V) or 5 mM IPTG (I) for the indicated times. Relative levels of OPN mRNA were determined by real-time RT–PCR (left panel). The quantity of OPN protein in conditioned media was determined by ELISA. Results were normalized to cellular protein content and expressed as OPN per milligram protein (right panel), *P < 0.05. (C) RIE-i-Ha-Ras cells were treated with vehicle (V), 5 mM IPTG (I), IPTG (I) plus 20 µM LY 294002 (LY) or IPTG (I) plus 25 µM PD-98059 (PD) for indicated times. Total RNA was extracted. Levels of OPN mRNA were determined by RT–PCR (left panel). RIE-i-Ha-Ras cells were treated with vehicle (V), 25 µM PD-98059 (PD) or 20 µM LY 294002 (LY) in the presence (IPTG) or absence (C) of 5 mM IPTG. Relative levels of OPN mRNA were determined by real-time RT–PCR after a 48 h treatment (middle panel). The amount of OPN protein in conditioned media was quantitated by ELISA after cells were treated by vehicle (V), 25 µM PD-98059 (PD) or LY 294002 (5, 10 or 20 µM) in the presence (IPTG) of 5 mM IPTG for 72 h (right panel). Results were normalized to cellular protein content and expressed as OPN per milligram protein, *P < 0.05.

 
OPN played important roles in intestinal epithelial transformation
In order to elucidate the functional roles of Ras-induced OPN in intestinal epithelial transformation, we performed an acute knock-down of OPN expression using siRNA. RIE-i-Ha-Ras cells were transfected with OPN siRNA prior to IPTG treatment. Efficient down-regulation of OPN protein was achieved 72 h after siRNA transfection. As a result, Ras-induced OPN expression was significantly inhibited by two independent siRNA sequences in RIE-i-Ha-Ras cells, reducing Ras-induced OPN by 50–70% (Figure 5A). Reduction of OPN expression did not attenuate Ras-mediated morphologic transformation of RIE cells; however, it reduced uncontrolled cell growth. Cell number was increased ~3-fold 72 h after addition of IPTG in negative siRNA transfected RIE-i-Ha-Ras cells (Figure 5B). Transfection with OPN siRNA inhibited Ras-stimulated cell growth and reduced the cell number by 30%. Next, we placed RIE-i-Ha-Ras cells, which were transfected with either negative siRNA or OPN siRNA into soft agarose. While non-transformed RIE cells did not grow colonies in soft agarose; RIE-i-Ha-Ras cells form colonies in the presence of IPTG. Acute knock-down of OPN expression did not significantly alter the number of colonies formed by IPTG-induced RIE-i-Ha-Ras cells. However, the size of colonies formed by OPN siRNA transfected cells was significantly smaller than those formed by negative siRNA transfected RIE-i-Ha-Ras cells (Figure 5C). In addition, negative siRNA transfected RIE-i-Ha-Ras cells formed invasive colonies; cells migrated from colonies into surrounding agarose (Figure 5D). In contrast, OPN siRNA transfected RIE-i-Ha-Ras cells formed non-invasive colonies, which were surrounded by cell debris.


Figure 5
View larger version (43K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5. OPN promoted RIE cell transformation. (A) RIE-i-Ha-Ras cells were transfected with negative control siRNA (Neg) or OPN-specific siRNA1 (OPN1 and ID 197203) and siRNA2 (OPN2 and ID 197204). Transfection was accomplished using XtremGene transfection reagent. Cells without siRNA transfection served as controls (No). Levels of OPN in cell culture media were determined by ELISA assay 72 h after addition of IPTG. Results were normalized to cellular protein content and expressed as OPN per milligram protein, *P < 0.05. (B) RIE-i-Ha-Ras cells were transfected with negative control siRNA (Neg) or OPN-specific siRNA1 (OPN1) in 24-well plates. Vehicle (–) or IPTG (+) were added after a 48 h incubation. Cell numbers were counted after an additional 72 h incubation using a hemacytometer. (C) RIE-i-Ha-Ras cells were placed in soft agarose 24 h after they were transfected with indicated siRNA. Colonies were photographed 10 days after addition of IPTG (x40). Panel (a) negative siRNA transfected RIE-i-Ha-Ras cells. Panel (b) OPN siRNA1 transfected RIE-i-Ha-Ras cells. Relative colony size were measured and normalized by cells without siRNA transfection (right panel). (D) RIE-i-Ha-Ras cells were transfected with negative siRNA (a) or OPN siRNA1 (b). Cells (104) were seeded in soft agarose in 35 mm plates 24 h after the transfection. Colonies were photographed 10 days after addition of IPTG (x200). Arrows in panel a, invasive cells; arrows in panel b, cell debris.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
Funding
 References
 
Aberrant activation of the PI3K pathway is oncogenic and plays critical roles in a variety of cancers. In contrast, PTEN dephosphorylates and inactivates the lipid second messenger phosphorylated by PI3K, therefore, acting as a tumor suppressor (29). Disruption of PTEN activity results in increased growth signals and promotion of tumor formation (23,30). Numerous in vitro studies demonstrate the important role of PI3K in colorectal neoplasia. Activation of the PI3K pathway is essential for Ras-mediated transformation of intestinal epithelial cells (7). Colon cancer HCT116 cells which contain mutant PI3KCA display significant growth advantage compared with the cells in which mutant PI3KCA is disrupted (5). Our data from animal experiments suggest that increase in PI3K activity by reduction of PTEN expression promotes intestinal tumor progression. While low-grade dysplasia was observed in most APCmin/+PTEN+/+ mice by age 5 months, advanced adenoma and invasive adenocarcinoma developed in animals bearing both mutated APC and PTEN, suggesting the critical roles of the PI3K pathway in malignant transformation of colonic epithelium.

An interesting finding from the present study is a high incidence of intestinal intussusception, which often led to the death of APCmin/+PTEN+/– mice by 5 months. Intussusception is the invagination of a bowel loop with its mesenteric fold into the lumen of a contiguous portion of bowel as a result of peristalsis. Intussusception in APCmin/+PTEN+/– mouse was caused by large adenomas or adenocarcinomas, which acted as the lead point of the invaginating bowel. Additionally, PI3K plays important role in intestinal smooth muscle growth and increases intestinal motility (31,32). Thus, PTEN deficiency may stimulate intestinal motility and result in dysrhythmic contraction further promoting intestinal intussusception.

Agrawal et al. (28) analyzed gene profile of colon tumors at multiple stages using oligonucleotide expression arrays and found that OPN is most consistently and differentially expressed in conjunction with tumor progression. Expression of OPN is linked to survival of colorectal cancer patients; profiling a core set of 43 genes including OPN was 90% accurate in predicting 36 month overall survival in these patients (33). Our results of targeted microarray determined OPN as a leading marker in intestinal carcinoma of APCmin/+PTEN+/– mice, suggesting that OPN is a PI3K target gene and may play crucial roles in relatively early stage of colorectal carcinogenesis, promoting the transformation of benign adenoma to invasive adenocarcinoma. OPN is a downstream effector of the PI3K pathway in melanomas; PTEN aberrations significantly increase the expression of OPN (34). We found that HCT116 cells that contain kinase domain mutated PIK3CA allele secreted significantly higher levels of OPN in culture media compared with cells carrying wild-type PIK3CA allele when grown in growth factor-deprived media. OPN is a secreted glycosylated phosphoprotein and involved in a number of biological functions including cell adhesion, survival, migration and bone calcification (35). Numerous studies suggest that OPN plays critical roles in tumor progression (36). OPN promotes tumor cell growth; down-regulation of OPN expression reduced the growth of Ras-transformed 3T3 cells in soft agarose and in animal implants (37). OPN protein is activated both by interleukin-3 and granulocyte-macrophage colony-stimulating factor and contributes to their pro-survival activities (38). Our data show that growth factor deprivation induced strong apoptosis in HCT116/PIK3CAWT cells, which produced low levels of OPN. Pre-coating the surface of the culture with OPN significantly reduced programmed cell death. These results suggest that promoting cell survival by OPN may be an important mechanism for tumor progression and metastasis.

About 50% of colorectal carcinomas contain K-Ras mutations (39) and the K-Ras oncogene plays key roles in colorectal neoplasia (1). The mechanism governing Ras-mediated transformation is complex and involves a number of downstream signaling pathways. Previous studies show that PI3K catalytic subunit can be directly activated by Ras (40) and the PI3K/Akt pathway is a key mediator for Ras-mediated carcinogenesis in intestinal epithelial cells (7). Ras rapidly induces the expression of a number of pro-neoplastic genes in intestinal epithelial cells, including cyclin D1, cycooxygenase-2, Bcl-2 and Bcl-xL (41–43). In the present study, we found that expression of oncogenic Ras increased levels of OPN mRNA in RIE cells; a ~100-fold induction was observed after Ras was induced for 48 h. Additional experiments are required to address mechanisms by which Ras increases OPN expression. Increase in OPN expression was closely associated with the transformation of RIE cells. Inhibitors for MEK and PI3K completely attenuated Ras-mediated morphological transformation as well as the induction of OPN expression. OPN-specific siRNA reduced the levels of OPN in cell culture media by 50–70%, which modestly inhibited the growth of Ras-transformed RIE cells. An interesting observation was that Ras-transformed RIE cells were able to penetrate and survive in surrounding agarose forming invasive colonies. On the other hand, RIE-i-Ha-Ras cells in which OPN was knocked down underwent cell death when they migrated into agarose, as evidenced by cell debris surrounding the colonies. These results suggest that OPN plays critical roles in anchorage-independent growth of transformed intestinal epithelial cell through promoting cell survival.

Although mutations of PI3K catalytic subunit are detected in ~30% of colon cancers (4), many oncogenic signaling pathways involved in colorectal carcinogenesis activate the PI3K pathway. For example, the epidermal growth factor receptor signaling system, the Ras oncogene and the cycooxygenase-2/prostaglandin E2-signaling pathway directly or indirectly increase PI3K activity, suggesting that PI3K plays a central role during the adenoma to carcinoma transformation in colonic epithelium. The APCmin/+PTEN+/+ mouse which develops invasive carcinoma in the gut provides a novel animal model for mechanistic and therapeutic research in colorectal carcinogenesis. In addition, our data show that OPN is up-regulated by PI3K and contributes to PI3K pro-neoplastic actions in colonic neoplasia. OPN regulates cell adhesion, migration and survival through interacting with CD44, integrins and matrix metalloprotease. The expression of OPN has been repeatedly shown to correlate with tumor progression and metastasis in a variety of carcinomas. Further evaluation of the clinical significance of OPN in colorectal cancer patients is warranted.


   Funding
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
References
 
National Institutes of Health (DK-065615, DK-64593) to H.S.


   Acknowledgments
 
We thank Dr Pier Paolo Pandolfi (Memorial Sloan-Kettering Cancer Center, New York, NY) for providing PTEN+/– mice.

Conflict of Interest Statement: None declared.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 

  1. Kinzler WK, et al. Lessons from hereditary colorectal cancer. Cell (1996) 87:159–170.[CrossRef][Web of Science][Medline]
  2. Phillips WA, et al. Increased levels of phosphatidylinositol 3-kinase activity in colorectal tumors. Cancer (1998) 83:41–47.[CrossRef][Web of Science][Medline]
  3. Philp AJ, et al. The phosphatidylinositol 3'-kinase p85alpha gene is an oncogene in human ovarian and colon tumors. Cancer Res. (2001) 61:7426–7429.[Abstract/Free Full Text]
  4. Samuels Y, et al. High frequency of mutations of the PIK3CA gene in human cancers. Science (2004) 304:554.[Free Full Text]
  5. Samuels Y, et al. Mutant PIK3CA promotes cell growth and invasion of human cancer cells. Cancer Cell (2005) 7:561–573.[CrossRef][Web of Science][Medline]
  6. Ikenoue T, et al. Functional analysis of PIK3CA gene mutations in human colorectal cancer. Cancer Res. (2005) 65:4562–4567.[Abstract/Free Full Text]
  7. Sheng H, et al. Akt/PKB activity is required for Ha-Ras-mediated transformation of intestinal epithelial cells. J. Biol. Chem. (2001) 276:14498–14504.[Abstract/Free Full Text]
  8. Sheng H, et al. Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells. Gut (2003) 52:1472–1478.[Abstract/Free Full Text]
  9. Rodriguez-Viciana P, et al. Role of phosphoinositide 3-OH kinase in cell transformation and control of the actin cytoskeleton by Ras. Cell (1997) 89:457–467.[CrossRef][Web of Science][Medline]
  10. Katso R, et al. Cellular function of phosphoinositide 3-kinases: implications for development, homeostasis, and cancer. Annu. Rev. Cell Dev. Biol. (2001) 17:615–675.[CrossRef][Web of Science][Medline]
  11. Davis RJ, et al. Structural characterization of the FKHR gene and its rearrangement in alveolar rhabdomyosarcoma. Hum. Mol. Genet. (1995) 4:2355–2362.[Abstract/Free Full Text]
  12. Borkhardt A, et al. Cloning and characterization of AFX, the gene that fuses to MLL in acute leukemias with a t(X;11)(q13;q23). Oncogene (1997) 14:195–202.[CrossRef][Web of Science][Medline]
  13. Anderson MJ, et al. Cloning and characterization of three human forkhead genes that comprise an FKHR-like gene subfamily. Genomics (1998) 47:187–199.[CrossRef][Web of Science][Medline]
  14. Du K, et al. CREB is a regulatory target for the protein kinase Akt/PKB. J. Biol. Chem. (1998) 273:32377–32379.[Abstract/Free Full Text]
  15. Wang JM, et al. The antiapoptotic gene mcl-1 is up-regulated by the phosphatidylinositol 3-kinase/Akt signaling pathway through a transcription factor complex containing CREB. Mol. Cell. Biol. (1999) 19:6195–6206.[Abstract/Free Full Text]
  16. Brennan P, et al. Phosphatidylinositol 3-kinase couples the interleukin-2 receptor to the cell cycle regulator E2F. Immunity (1997) 7:679–689.[CrossRef][Web of Science][Medline]
  17. Kane LP, et al. Induction of NF-kappaB by the Akt/PKB kinase. Curr. Biol. (1999) 9:601–604.[CrossRef][Web of Science][Medline]
  18. Sun H, et al. PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc. Natl Acad. Sci. U S A (1999) 96:6199–6204.[Abstract/Free Full Text]
  19. Tolkacheva T, et al. Inhibition of H-Ras transformation by the PTEN/MMAC1/TEP1 tumor suppressor gene. Oncogene (2000) 19:680–689.[CrossRef][Web of Science][Medline]
  20. Steck PA, et al. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat. Genet. (1997) 15:356–362.[CrossRef][Web of Science][Medline]
  21. Sansal I, et al. The biology and clinical relevance of the PTEN tumor suppressor pathway. J. Clin. Oncol. (2004) 22:2954–2963.[Abstract/Free Full Text]
  22. Freeman D, et al. Genetic background controls tumor development in PTEN-deficient mice. Cancer Res. (2006) 66:6492–6496.[Abstract/Free Full Text]
  23. Di Cristofano A, et al. Pten is essential for embryonic development and tumour suppression. Nat. Genet. (1998) 19:348–355.[CrossRef][Web of Science][Medline]
  24. Sheng H, et al. Prostaglandin E2 increases growth and motility of colorectal carcinoma cells. J. Biol. Chem. (2001) 276:18075–18081.[Abstract/Free Full Text]
  25. Shao J, et al. Roles of myofibroblasts in prostaglandin E2-stimulated intestinal epithelial proliferation and angiogenesis. Cancer Res. (2006) 66:846–855.[Abstract/Free Full Text]
  26. Moser AR, et al. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science (1990) 247:322–324.[Abstract/Free Full Text]
  27. Stambolic V, et al. High incidence of breast and endometrial neoplasia resembling human Cowden syndrome in pten+/– mice. Cancer Res. (2000) 60:3605–3611.[Abstract/Free Full Text]
  28. Agrawal D, et al. Osteopontin identified as lead marker of colon cancer progression, using pooled sample expression profiling. J. Natl Cancer Inst. (2002) 94:513–521.[Abstract/Free Full Text]
  29. Samuels Y, et al. Oncogenic PI3K and its role in cancer. Curr. Opin. Oncol. (2006) 18:77–82.[Web of Science][Medline]
  30. Podsypanina K, et al. Mutation of Pten/Mmac1 in mice causes neoplasia in multiple organ systems. Proc. Natl Acad. Sci. U S A (1999) 96:1563–1568.[Abstract/Free Full Text]
  31. Kuemmerle JF, et al. IGF-I stimulates intestinal muscle cell growth by activating distinct PI 3-kinase and MAP kinase pathways. Am. J. Physiol. (1998) 275:G151–G158.[Web of Science][Medline]
  32. Ward SM, et al. Role of PI3-kinase in the development of interstitial cells and pacemaking in murine gastrointestinal smooth muscle. J. Physiol. (1999) 516:835–846. (Pt 3).[Abstract/Free Full Text]
  33. Eschrich S, et al. Molecular staging for survival prediction of colorectal cancer patients. J. Clin. Oncol. (2005) 23:3526–3535.[Abstract/Free Full Text]
  34. Packer L, et al. Osteopontin is a downstream effector of the PI3-kinase pathway in melanomas that is inversely correlated with functional PTEN. Carcinogenesis (2006) 27:1778–1786.[Abstract/Free Full Text]
  35. Tiniakos DG, et al. Osteopontin expression in ovarian carcinomas and tumors of low malignant potential (LMP). Hum. Pathol. (1998) 29:1250–1254.[CrossRef][Web of Science][Medline]
  36. Rittling SR, et al. Role of osteopontin in tumour progression. Br. J. Cancer (2004) 90:1877–1881.[CrossRef][Web of Science][Medline]
  37. Behrend EI, et al. Reduced malignancy of ras-transformed NIH 3T3 cells expressing antisense osteopontin RNA. Cancer Res. (1994) 54:832–837.[Abstract/Free Full Text]
  38. Lin YH, et al. The osteopontin-CD44 survival signal involves activation of the phosphatidylinositol 3-kinase/Akt signaling pathway. J. Biol. Chem. (2001) 276:46024–46030.[Abstract/Free Full Text]
  39. Bos JL. ras oncogenes in human cancer: a review. Cancer Res. (1989) 49:4682–4689.[Abstract/Free Full Text]
  40. Rodriguez-Viciana P, et al. Phosphatidylinositol-3-OH kinase as a direct target of Ras. Nature (1994) 370:527–532.[CrossRef][Medline]
  41. Shao J, et al. Oncogenic Ras-mediated cell growth arrest and apoptosis are associated with increased ubiquitin-dependent cyclin D1 degradation. J. Biol. Chem. (2000) 275:22916–22924.[Abstract/Free Full Text]
  42. Sheng H, et al. K-Ras-mediated increase in COX-2 mRNA stability involves activation of the Akt/PKB. Cancer Res. (2001) 61:2670–2675.[Abstract/Free Full Text]
  43. Shao J, et al. Roles of phosphatidylinositol 3'-kinase and mammalian target of rapamycin/p70 ribosomal protein S6 kinase in K-Ras-mediated transformation of intestinal epithelial cells. Cancer Res. (2004) 64:229–235.[Abstract/Free Full Text]
Received April 5, 2007; revised August 3, 2007; accepted August 5, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 FASEB J.Home page
M.-J. Langlois, S. A. B. Roy, B. A. Auclair, C. Jones, F. Boudreau, J. C. Carrier, N. Rivard, and N. Perreault
Epithelial phosphatase and tensin homolog regulates intestinal architecture and secretory cell commitment and acts as a modifier gene in neoplasia
FASEB J, June 1, 2009; 23(6): 1835 - 1844.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
L. H. El Touny and P. P. Banerjee
Identification of a Biphasic Role for Genistein in the Regulation of Prostate Cancer Growth and Metastasis
Cancer Res., April 15, 2009; 69(8): 3695 - 3703.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/12/2476    most recent
bgm186v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Shao, J.
Right arrow Articles by Sheng, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shao, J.
Right arrow Articles by Sheng, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?