Skip Navigation


Carcinogenesis Advance Access originally published online on August 14, 2007
Carcinogenesis 2007 28(12):2624-2631; doi:10.1093/carcin/bgm184
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/12/2624    most recent
bgm184v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cheung, R. S.Y.
Right arrow Articles by Fausto, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheung, R. S.Y.
Right arrow Articles by Fausto, N.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Interactions between MYC and transforming growth factor alpha alter the growth and tumorigenicity of liver progenitor cells

Ronald S.Y. Cheung1,2, John T. Brooling1, Melissa M. Johnson1, Kimberly J. Riehle1,3, Jean S. Campbell1 and Nelson Fausto1,*

1 Department of Pathology
2 Molecular and Cellular Biology Graduate Program
3 Department of Surgery, University of Washington, Seattle, WA 98195, USA

* To whom correspondence should be addressed. Tel: +1 206 616 4550; Fax: +1 206 543 3967; Email: nfausto{at}u.washington.edu


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
The MYC oncogene induces both cell proliferation and apoptosis. The apoptotic function of MYC is thought to inhibit carcinogenesis; thus, when disrupted, tumorigenic potential is increased. Both MYC and transforming growth factor alpha (TGF{alpha}) are commonly over-expressed in hepatocellular carcinomas, and transgenic mice expressing these genes rapidly develop tumors via the suppression of MYC-induced apoptosis by the growth factor. However, the nature of the interactions between MYC and TGF{alpha} are not well understood. Specifically, it is unclear whether TGF{alpha} acts only as an anti-apoptotic factor in its interactions with MYC or whether it has substantial effects on cell growth. We investigated whether TGF{alpha} can provide additional mitogenic signals if it is not required to act as an anti-apoptotic factor. We demonstrate that expression of MYC and TGF{alpha} in liver progenitor cells (known as oval cells) results in enhanced cell proliferation in culture and the generation of poorly differentiated tumors after inoculation into nude mice. We further demonstrate that while the apoptosis-deficient T58A and S71F alleles of MYC retain their ability to promote oval cell proliferation, they have opposite growth interactions with TGF{alpha}. The T58A allele has a stimulatory effect on both proliferation and tumorigenicity. In contrast, co-expression of the S71F allele reduces proliferation and slows tumor development. We conclude that the tumorigenic growth effects of MYC in TGF{alpha}-expressing liver progenitor cells are not solely dependent on its apoptotic activity.

Abbreviations: FACS, fluorescence activated cell sorting; GFP, green fluorescent protein; HCC, hepatocellular carcinoma; MMP, matrix metalloproteinase; PCR, polymerase chain reaction; TACE, TNF-alpha converting enzyme; TGF{alpha}, transforming growth factor alpha; VEGF, vascular endothelial growth factor


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 Funding
 References
 
The MYC oncogene encodes a transcription factor with multiple effects on diverse cellular activities (1,2). A central paradox of MYC is that it acts as a dual-function protein, capable of inducing both cell proliferation and apoptosis, processes that have opposite biological outcomes (3–5). Given the known relationships between apoptosis and tumor development, it has been proposed that the apoptotic activity of Myc eliminates cells that over-express the gene, thereby reducing its tumorigenic activity (6). This hypothesis has been supported by the observation that either activation of survival pathways or the disruption of cell death pathways enhances MYC-induced tumorigenesis (7,8). In human hepatocellular carcinomas (HCCs), there is a significant positive correlation between MYC expression and degree of apoptosis (9).

The acceleration of tumorigenesis by activation of survival pathways is illustrated by studies of transgenic mice that express both Myc and Tgf{alpha} in hepatocytes. These mice develop HCCs more rapidly and at a higher frequency than mice that express either of these transgenes individually (10). Tumors from Myc/Tgf{alpha} mice show high transforming growth factor alpha (TGF{alpha}) expression and proliferation, and reduced apoptosis as compared with surrounding tissues and tumors produced in Myc single transgenic animals (11). These observations suggest that TGF{alpha} may have an anti-apoptotic function in Myc/Tgf{alpha} double transgenic mice (12,13).

Proliferation and apoptosis constitute distinct functions of Myc that can be dissociated and are genetically separable (14,15). Numerous MYC alleles that are deficient in apoptosis but retain proliferative activity have been isolated and characterized, largely from patients with lymphoma (16–18). A conserved element within Myc known as Myc box II (MbII; amino acids 129–143) is a negative regulator of apoptosis (19). Its disruption increases MYC-induced apoptosis and inhibits its capacity to produce lymphomas, suggesting that MYC oncogenicity is linked to decreased apoptotic activity. In contrast, mutations within the Myc box I (MbI; amino acids 43–69) region decrease MYC-induced cell death. For example, the T58A and P57S MYC alleles isolated from Burkitt's lymphomas have reduced apoptotic capacities that correlate with augmented oncogenic activity (18).

It is unknown whether TGF{alpha} acts strictly as an anti-apoptotic factor in its interactions with MYC or whether it is capable of making additional contributions to tumorigenic growth. Specifically, we wished to address the question of whether TGF{alpha} could increase the growth of cells expressing apoptosis-inhibiting MYC alleles. For this purpose, we utilized two alleles of MYC, S71F and T58A, which have been shown previously to disrupt MYC's apoptotic function without significantly altering MYC's ability to drive cell proliferation (18). We hypothesized that the expression of these alleles with TGF{alpha} would allow the growth factor to provide additional proliferative signals to increase the rate of tumor development driven by MYC and TGF{alpha}.

Liver progenitor (oval) cells are thought to be precursors of HCCs in rodents and humans (20–25). These cells can differentiate into hepatocytes (26,27), and produce well-differentiated HCCs when transfected with the c-Ha-ras (EJ) oncogene and injected subcutaneously into nude mice (28,29). We used bi-cistronic retroviral vectors to express oncogenes in liver progenitor cells. We describe growth interactions between MYC and TGF{alpha} in these cells, and report that while the T58A and S71F mutations of MYC both have diminished apoptotic activity and intact proliferative function, they alter these growth interactions in different ways. Only disruption of apoptosis by the T58A mutation allowed TGF{alpha} to enhance cell growth and tumorigenicity. Surprisingly, the S71F allele had a negative interaction with TGF{alpha}, and the absence of this allele from naturally occurring tumors suggests that the ability of MYC to cooperate with growth factor may be essential for tumor development.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 Funding
 References
 
Cell culture
LE6 cells are a non-tumorigenic oval cell line isolated from the livers of male rats fed a choline-deficient diet supplemented with ethionine for 6 weeks (26,30). The cells are pseudodiploid and capable of generating hepatocytes. They were cultured in a 1:1 mixture of Dulbecco's modified Eagle's medium high glucose and Ham's F10 nutrient medium supplemented with 10% fetal bovine serum, 1 mg/ml insulin, 0.5 mg/ml hydrocortisone, gentamicin and ciprofloxacin as described previously (26).

Phoenix ecotropic retroviral packaging cells (gift from G.Nolan) were cultured in high glucose Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, L-glutamine and penicillin/streptomycin.

Generation of bi-cistronic retroviral vectors and production of ecotropic retrovirus
The cDNA encoding human MYC (gift from R.Eisenman) was subcloned into the pBMN-i-GFP retroviral vector (gift from G.Nolan) to generate the MYC-i-gfp vector. The full-length cDNA for human pro-TGF{alpha} was subcloned into the CD2-expressing pM-i-2 retroviral vector (gift from M.Bevan) to generate the TGF{alpha}-i-2 vector. Plasmid DNA was prepared from bacterial cultures by cesium chloride ultracentrifugation.

T58A and S71F alleles of MYC were created by polymerase chain reaction (PCR) site-directed mutagenesis, using the wild-type MYC cDNA sequence cloned into the pBSII vector (Stratagene, La Jolla, CA) as a template. For the S71F allele, the primers 5' CGCTCCGGGCTCTGCTTCCCCTCCTACGTTGCG 3' and 5' CGCAACGTAGGAGGGGAAGCAG AGCCCGGAGCG 3' were used. For the T58A allele, the primers 5' TTCGAGCTGCT GCCCGCCCCGCCCCTGTCCCCT 3' and 5' AGGGGACAGGGGCGGGGCGGGCAGCAGCTCGAA 3' were used. The mutagenized inserts were verified by sequencing, released from the vector with BamHI and subcloned into the pBMN-i-GFP retroviral vector.

For ecotropic retrovirus production, 5 x 106 Phoenix cells were seeded into 10 cm dishes. Twenty-four hours after seeding, cells were transfected with 24 µg of vector DNA by calcium phosphate precipitation in the presence of chloroquine. Media were replaced with fresh media 12 h after transfection, and replaced again 24 h after transfection. Virus was harvested 24–48 h after transfection by collecting the media from the transfected dishes and filtering through a 0.45 µm low protein-binding HV filter.

Oncogene expression in LE6 cells
To generate LE6 cells expressing Green Fluorescent Protein (GFP) or MYC alleles, 6 cm dishes of LE6 cells at 40–50% confluence were incubated in viral supernatants for 5–6 h in the presence of polybrene. Infected cells were then expanded in normal culture media. GFP+ cells were isolated by fluorescence activated cell sorting (FACS) on a Becton Dickinson FACS Vantage SE cell sorter.

Cells expressing TGF{alpha} were generated by retroviral infection and expanded as described above. CD2+ cells were then isolated by staining the cells with a phycoerythrin-labeled anti-CD2 antibody (PharMingen, San Diego, CA) and FACS sorting for phycoerythrin-positive cells on a Becton Dickinson FACS Vantage SE cell sorter.

To generate LE6 cells expressing both oncogenes in combination, cells expressing TGF{alpha} that had been previously FACS sorted for CD2 positivity were super infected with MYC-i-gfp retrovirus. GFP+ cells were then FACS sorted. Cells expressing both oncogenes and those expressing TGF{alpha} alone therefore originated from the same TGF{alpha}-expressing population.

After infection and sorting for oncogene-positive cells, cells expressing GFP, MYC, TGF{alpha} and MYC + TGF{alpha} were expanded before switching culture conditions from 10% serum to 1% serum. Polyclonal cell populations were used for all subsequent experiments.

Immunoblot analysis
Protein lysates from cells and tumors were isolated as described previously (31). For immunoblot analysis of Myc and cyclin E, 30 µg of protein lysates were run on polyacrylamide gels, followed by western transfer overnight to polyvinylidene difluoride membrane. Probing with primary antibody, secondary antibody and development was performed as described previously (31). Primary antibodies and dilutions used were as follows: Myc:9E10 hybridoma supernatant (gift from R.Monnat) at 1:15 dilution, cyclin E antibody (Upstate, Lake Placid, NY) at 1:2000 dilution.

For immunoblot analysis of pro-TGF{alpha} expression, 40 µg of protein lysate was run on 10–20% Tris–tricine gradient gels and transferred to polyvinylidene difluoride. Blots were washed and blocked as above. Blots were then incubated in a 1:500 dilution of TGF{alpha} Ab-1 (Oncogene Science, Cambridge, MA) in 0.2% bovine serum albumin at 4°C overnight. Blots were washed, probed with secondary antibody and developed as above.

Analysis of cell growth and DNA replication in culture
Cells (2 x 104) were seeded in triplicate into 12-well plates on day 0. On days 1–6, plates were washed with phosphate-buffered saline, fixed in phosphate-buffered formalin and stained with 1.0% crystal violet. Plates were then washed extensively. Cell-bound crystal violet was extracted with glacial acetic acid and diluted 1:4 in water. Relative cell density was measured at 600 nM. For analysis of DNA replication, cells were treated with [3H] thymidine for 4 h at a final concentration of 1 µCi/ml. After treatment, media were aspirated off and plates were washed with phosphate-buffered saline. The trichloroacetic acid non-precipitatable fraction was removed and the precipitate was solubilized in NaOH and quantitated in a scintillation counter.

Measurement of soluble TGF{alpha} production
Cells (5 x 105) were seeded into duplicate 6 cm dishes. Cells were allowed to attach overnight, washed with Hanks' balanced salt solution, and media were replaced with 2 ml of fresh media, with or without TAPI-1 or matrix metalloproteinase (MMP)-9/13 inhibitor. Media were collected 24 h after media replacement. Levels of soluble TGF{alpha} in the media were determined by an enzyme-linked immunosorbent assay for human TGF{alpha} (Oncogene Science). As different cell types had varying growth rates over the 24 h production period, soluble TGF{alpha} levels were normalized to relative cell densities at the time of media collection, as determined by crystal violet method.

Analysis of apoptotic function of mutant MYC alleles
For each allele/time point, 7 x 105 cells were seeded in triplicate into 6 cm dishes and allowed to attach overnight. Cells were then washed and media was replaced with low serum (0.1%) media to induce apoptosis in cells expressing MYC. Cell protein lysates were harvested as described previously (31) at 18, 24, 30 and 36 h after media replacement. Caspase-3 activities were then measured as described previously (32).

Assessment of tumorigenicity in nude mice
Cells at subconfluence were released with trypsin and injected into 6- to 8-week old Nu/J male nude mice. For each site of injection, 5 x 106 cells were re-suspended in 200 µl of a 1:1 mixture of ice cold sterile phosphate-buffered saline and matrigel (BD Biosciences, San Jose, CA) and injected subcutaneously. Mice were monitored every 3 days for tumor development. Tumor volume was obtained by measuring the average diameter of the tumor with calipers and using the formula volume = 4/3 {pi}r3. Tumors were excised and fixed in phosphate-buffered formalin. Slides of tumor tissue were hematoxylin and eosin stain stained for histological analysis.

Statistical analysis
Statistical analysis was done by non-parametric analysis (Mann–Whitney or an unpaired t-test with Welch's correction). Data are presented as the average ± standard deviation or standard error of the mean as indicated in the figure legends. Statistical analysis was performed using GraphPad Prism software.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 Funding
 References
 
Growth interactions between MYC and TGF{alpha} in oval cells
Interactions between MYC and TGF{alpha} were analyzed by retroviral transfection of liver oval cells, precursors of HCC (23). Retroviral vectors MYC-i-gfp and TGF{alpha}-i-2 were generated and used to transduce rat LE6 oval cells. The MYC-i-gfp vector expresses human full-length Myc and GFP, whereas the TGF{alpha}-i-2 vector expresses the human, unprocessed precursor form of human TGF{alpha} (pro-TGF{alpha}) and the human CD2 cell surface marker. Polyclonal populations of oncogene-expressing oval cells were isolated by flow cytometry on the basis of GFP and/or CD2 expression (data not shown). Cell lines that express gfp control vector, MYC-i-gfp, TGF{alpha}-i-2 or a combination of both oncogenes were generated.

The growth of each of the oncogene-expressing cell lines and controls were determined in 1% serum, a condition which maximizes the effects of different oncogenes. The number of cells in each culture was determined after passage each day by measuring absorbance after staining with crystal violet (Figure 1A). Expression of MYC increases oval cell proliferation in conditions of exponential growth (days 1–4), but as MYC-expressing cells reach high confluence by day 4, the cell density begins to decrease. Co-expression of TGF{alpha} in oval cells expressing MYC permits these cells to overcome the growth limitation seen in cells that express MYC alone. The proliferative effects of each of the oncogenes is confirmed in labeling experiments, in which [3H] thymidine is added 4 h prior to harvesting cells on each day (Figure 1B). TGF{alpha} by itself has a small effect on DNA replication under these conditions, and incorporation of thymidine is maximum on day 4 in cells expressing MYC alone. However, cells expressing both MYC and TGF{alpha} maintain a high rate of cell proliferation for at least 6 days (Figure 1B).


Figure 1
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. Interactive growth effects of MYC and TGF{alpha} in liver progenitor cells. (A) Cell growth analysis of oncogene-expressing oval cells maintained in 1% serum. Cells (2 x 104) were seeded in triplicate into 12-well dishes on day 0. Cell densities were measured by crystal violet assay. (B) [3H] thymidine incorporation analysis performed in parallel with cell growth analysis. (C) [3H] thymidine incorporation analysis of oncogene-expressing oval cells maintained in 0.1% serum for 24 h. Data shown are representative of three replicate experiments. Error bars represent standard deviation.

 
The interaction between MYC and TGF{alpha} in oval cell proliferation is even more evident in cells maintained at very low serum conditions (0.1%, Figure 1C). Under these conditions, [3H] thymidine incorporation is not significantly elevated in cells expressing MYC alone, and incorporation is only slightly increased in cells expressing TGF{alpha} alone. In cells expressing both MYC and TGF{alpha}, DNA replication is ~10-fold greater than that of cells expressing TGF{alpha} only.

MYC expression increases the release of soluble TGF{alpha} through a TNF-alpha Converting Enzyme-dependent mechanism
Immunoblot analyses revealed that cells expressing both MYC and TGF{alpha} have lower levels of cell-associated pro-TGF{alpha} than cells expressing TGF{alpha} alone (Figure 2A). We hypothesized that the reduced pro-TGF{alpha} observed in the cells expressing both genes was the result of increased conversion of pro-TGF{alpha} into soluble TGF{alpha}. To test this hypothesis, a human-specific TGF{alpha} enzyme-linked immunosorbent assay was used to measure the release of soluble TGF{alpha} into the media from oncogene-expressing LE6 cells >24 h (Figure 2B). As expected, cells expressing GFP or MYC alone do not produce detectable levels of soluble TGF{alpha}. In contrast, oval cells expressing both MYC and TGF{alpha} produce greater amounts of soluble TGF{alpha} than cells expressing TGF{alpha} alone. The increase in soluble TGF{alpha} production in the cells expressing both oncogenes is not due to an increase in TGF{alpha}-i-2 transcript levels, as measured by reverse transcriptase–PCR (Figure 2C).


Figure 2
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. MYC expression mediates the conversion of pro-TGF{alpha} to soluble TGF{alpha} through a TACE-dependent mechanism. (A) Immunoblot analysis for Myc (upper panel) and pro-TGF{alpha} (middle panel) expression in oval cells infected with retroviruses expressing a gfp control (GFP), MYC-i-gfp (Myc), TGF{alpha}-i-2 (TGF{alpha}) or a combination of both oncogenes (Myc + TGF{alpha}). β-Actin levels are shown in the bottom panel. (B) Soluble TGF{alpha} production from cells, with or without metalloproteinase inhibitors (TAPI-1 and MMP-9/13), was measured by enzyme-linked immunosorbent assay and normalized to cell density as determined by crystal violet staining. Data shown are representative of three replicate experiments. Error bars represent standard deviation. (C) Reverse transcriptase–PCR analysis of TGF{alpha}-i-2 transcript levels in cells infected with a gfp control (GFP), TGF{alpha}-i-2 (TGF{alpha}) or a combination of both MYC-i-gfp and TGF{alpha}-i-2 (Myc + TGF). Primers to both human TGF{alpha} (hTGF{alpha}) and human CD2 (hCD2) sequences were used.

 
The surface metalloproteinase TNF-alpha Converting Enzyme (TACE) mediates the cleavage of pro-TGF{alpha} between amino acids 89 and 90, which is the rate-limiting step for the conversion of this precursor to the soluble growth factor (33). We have shown that in hepatocyte cell lines, TACE mediates TGF{alpha} release from the plasma membrane leading to epidermal growth factor receptor transactivation (31). So far, MMP-9 is the only metalloproteinase known to be modulated by Myc (34), and no information is available on potential effects of Myc on TACE activity. Thus, TACE and MMP-9 are two potential candidate metalloproteinases that might be associated with the increased release of TGF{alpha} by cells in association with the expression of MYC. Therefore, we assessed the effects of a TACE inhibitor (TAPI-1) and an MMP-9 inhibitor (MMP-9/13 inhibitor) on the production of soluble TGF{alpha} in oval cells expressing both MYC and TGF{alpha} (Figure 2B). Treatment with the MMP-9/13 inhibitor has relatively little effect on soluble TGF{alpha} production, even at high concentrations. In contrast, treatment with 10 or 50 mM TAPI-1 reduces the levels of soluble TGF{alpha} produced by these cells to the levels detected in the culture medium of cells that express only TGF{alpha}. To assess the means by which MYC modulates TACE activity, we performed reverse transcriptase–PCR and immunoblot analyses to assess TACE messenger RNA and protein levels, respectively, in cells expressing MYC. TACE messenger RNA levels in MYC-expressing cells was comparable with cells expressing GFP. TACE protein levels were also similar between MYC and GFP cells (data not shown). These results suggest that the expression of the MYC oncogene mediates enhanced TGF{alpha}-induced proliferation by a mechanism that includes the conversion of pro-TGF{alpha} to soluble TGF{alpha} by proteolytic cleavage by TACE.

Expression of MYC and TGF{alpha} in oval cells leads to the development of poorly differentiated tumors in vivo
Enhancement in cell proliferation by oncogenes provides a mechanism for mutation fixation and the development of tumors in a variety of model systems. We investigated the ability of MYC and TGF{alpha} expression to drive the development of liver tumors from oval cells. LE6 cells expressing either GFP, MYC, TGF{alpha} or both MYC and TGF{alpha} were injected subcutaneously into nude mice. Mice injected with cells expressing GFP or TGF{alpha} do not develop tumors, but tumors developed from MYC-expressing cells 25% of the time. After 6 weeks, 50% of the sites injected with cells expressing both MYC and TGF{alpha} developed tumors at least 1 cm in diameter. Histological analyses of these tumors reveal that they were poorly differentiated (Figure 3A), with a high frequency of mitotic figures. Most tumors consist of sheets, compact nests and cords of poorly differentiated large cells with vesicular nuclei and 1–3 prominent nucleoli. Some tumors contain regions of moderate differentiation containing glandular structures (Figure 3B). In other areas, tumor cells appear to invade the adjacent stromal tissue (Figure 3C).


Figure 3
View larger version (74K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3. Expression of MYC and TGF{alpha} in oval cells results in the development of poorly differentiated tumors in vivo. Histology from three representative tumors generated by subcutaneous injection of oval cells expressing MYC and TGF{alpha}. (A) Tumors tend to be poorly differentiated, with cells arranged in sheets. (B) Occasionally, clusters of cells form glandular structures. (C) In other areas, regions of stromal cell invasion by tumor cells were observed.

 
T58A and S71F mutant MYC alleles are diminished in apoptotic function, but retain proliferative activity
To study the effect of the disruption of the apoptotic activity of MYC on its interactions with TGF{alpha}, we first created the T58A and S71F alleles of MYC and inserted them into bi-cistronic retroviral vectors, in which they were co-expressed with GFP. LE6 cells were then infected and sorted by FACS (see Materials and methods) to generate three distinct populations of oval cells, expressing the wild-type, T58A and S71F alleles of MYC. Cell growth rate analysis reveals enhanced proliferation of each of the MYC-transfected cell lines (Figure 4A). Relative to wild-type MYC, cells expressing either the T58A or S71F alleles continue to proliferate at higher cell densities, in accord with reported studies that these mutations disrupt the apoptotic activity of MYC (16), thus allowing greater proliferation as cells approach confluence.


Figure 4
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4. Apoptotic and proliferative function of MYC alleles in oval cells. (A) Cell growth analysis of oval cells expressing GFP (control), wild-type, T58A and S71F MYC alleles. Relative cell densities were determined by crystal violet staining. Cells (2 x 104) were seeded in triplicate into 12-well dishes on day 0. Data shown are representative of three replicate experiments. Error bars represent standard deviation. (B) Caspase-3 activity at various time points in oval cells expressing GFP (control), wild-type, T58A and S71F MYC alleles maintained in 0.1% serum. Error bars represent standard error of the mean. (C) Immunoblot analysis for Myc (upper panel) and cyclin E (middle panel) expression in oval cells expressing GFP (control) and the three MYC alleles. β-Actin levels are shown in the bottom panel.

 
We measured the apoptotic activity of cells expressing the wild-type, T58A and S71F MYC alleles by placing them in low serum medium (0.1%) and analyzing caspase-3 activity at various times thereafter (Figure 4B). Control cells expressing GFP alone have minimal caspase-3 activity, but cells expressing wild-type MYC exhibit a peak in caspase-3 activity 30 h after serum withdrawal. Compared with cells expressing wild-type MYC, caspase-3 activity in T58A and S71F-expressing cells is 3.25- and 5.5-fold lower, respectively.

To further confirm that the proliferative functions of the T58A and S71F alleles are intact, we assessed their ability to increase the expression of cyclin E, a Myc target gene that is up-regulated in cells with enhanced replication (35,36). Immunoblot analysis for cyclin E in oval cells expressing wild-type, T58A and S71F MYC alleles revealed that in addition to resulting in equivalent production of Myc protein, all three alleles have a similar ability to up-regulate cyclin E expression (Figure 4C).

Interactions of T58A and S71F MYC alleles with TGF{alpha} on oval cell growth and tumorigenesis
To determine whether the enhanced proliferation by MYC and its effects on TGF{alpha} are associated with the production of tumors, we investigated the effects of expressing the apoptosis-deficient T58A and S71F MYC alleles with TGF on liver progenitor cell growth. We initially predicted that disruption of MYC apoptotic function through these mutations would allow TGF{alpha} to make additional contributions to tumorigenic growth. LE6 cells co-expressing T58A and TGF{alpha} exhibit markedly increased cell growth compared with those expressing T58A alone (Figure 5A). This interaction results in proliferation that is greater than that seen with the combined expression of wild-type MYC and TGF{alpha} (Figure 5C), particularly during subconfluent growth. The enhancing effect of T58A on cell growth is not due to an increase in T58A protein expression in T58A + TGF{alpha} cells, as determined by immunoblot analysis (Figure 5D).


Figure 5
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5. Contrasting interactions of T58A and S71F MYC alleles with TGF{alpha} on oval cell growth and tumorigenesis. Cell growth of oval cells expressing (A) T58A, TGF{alpha} and T58A + TGF{alpha}, (B) S71F, TGF{alpha} and S71F + TGF{alpha} and (C) wild-type MYC, TGF{alpha} and MYC + TGF{alpha}. Cells (2 x 104) were seeded in triplicate into 12-well dishes on day 0. Cell densities were measured by crystal violet staining. Data shown are representative of three replicate experiments. Error bars represent standard deviation. (D) Immunoblot analysis for Myc expression (upper panel) in oval cells expressing S71F, S71F + TGF{alpha}, T58A and T58A + TGF{alpha}. β-Actin levels are shown in the bottom panel. (E) Oval cells expressing wild-type, T58A and S71F alleles of MYC in combination with TGF{alpha} were injected subcutaneously into nude mice (three sites per mouse). For each oncogenic combination, 5 x 106 cells were injected into each of 12 sites. Tumors were measured every 3 days after injection. Overall tumor frequencies (tumors/sites injected) are listed to the right of each slope. Error bars represent standard error of the mean.

 
In contrast to the effects of the T58A allele, cells expressing both S71F and TGF{alpha} exhibit reduced cell growth compared with cells expressing S71F alone (Figure 5B). This phenomenon is particularly evident in low cell density culture (days 1–3), in which S71F + TGF{alpha} expressing cells exhibit a 5.7-fold reduction in growth rate compared with cells expressing S71F only. The difference in growth rate between cells expressing S71F alone and those that expressing S71F in combination with TGF{alpha} is not due to differences in expression of S71F protein (Figure 5D).

Cells expressing the T58A allele in combination with TGF{alpha} generate subcutaneous tumors that grew faster than those produced by cells expressing wild-type MYC and TGF{alpha} (2.5-fold higher growth curve slopes, Figure 5E). These cells also led to tumor development in a higher proportion of injection sites (9/12 sites injected) than did cells expressing the wild-type (5/12) or S71F (6/12) alleles. In contrast, S71F + TGF{alpha} expressing cells produce tumors more slowly than those generated by cells expressing wild-type MYC + TGF{alpha} (3-fold reduced slope, Figure 5E); these tumors are also of smaller size. The effects of disruption of MYC apoptotic activity on tumorigenic growth interactions with TGF{alpha} are therefore dependent on allelic context.

The surprising behavior of the S71F allele prompted us to further investigate its interactions with TGF{alpha}. Cells expressing S71F + TGF{alpha} release lower amounts of soluble TGF{alpha} into the medium and accumulate higher levels of pro-TGF{alpha} than cells co-expressing wild-type MYC + TGF{alpha} (Figure 6A). Therefore, expression of the S71F allele is associated with a diminished ability to convert pro-TGF{alpha} to soluble TGF{alpha}. Again, reverse transcriptase–PCR analysis confirmed that this finding was not the result of differing levels of TGF{alpha}-i-2 transcript (data not shown).


Figure 6
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 6. The S71F allele of MYC differs from wild-type MYC in its interactions with TGF{alpha}. (A) Relative levels of soluble TGF{alpha} produced by cells expressing wild-type and S71F MYC alleles with TGF{alpha}. For each oncogene combination, immunoblot analysis for cell-associated pro-TGF{alpha} is also shown. Data shown are representative of three replicate experiments. Error bars represent standard deviation. (B) Immunoblot analysis for Myc and pro-TGF{alpha} in tumors generated by expression of wild-type and S71F MYC alleles in combination with TGF{alpha}. For each oncogene combination, four tumors were analyzed.

 
The inability of the S71F allele to tolerate TGF{alpha} co-expression in driving cell growth suggested that reduction in tumor development driven by expression of S71F + TGF{alpha} might be due to selection for loss of TGF{alpha} expression. This was confirmed by immunoblot analysis, where loss of TGF{alpha} expression was noted in tumors generated from S71F + TGF{alpha}-expressing cells (Figure 6B). This is in contrast to tumors generated by cells that express wild-type MYC in conjunction with TGF{alpha}, in which continued expression of TGF{alpha} is maintained.


   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
Funding
 References
 
MYC and other oncogenes such as E2F1 have both proliferative and apoptotic functions (37,38). Given the proposed role of apoptosis in inhibiting carcinogenesis, the blockage of Myc-induced apoptosis may be expected to enhance tumorigenesis. Indeed, the strong oncogenic cooperativity between Myc and Bcl-2 (39), and between Myc and loss of p53 (8) in mouse lymphoma models, has provided experimental evidence that the disruption of the apoptotic effect of MYC promotes cancer development. This concept is further demonstrated by observations made in a mouse model of liver carcinogenesis, where the rapid development of HCCs by the combined expression of Myc with Tgf{alpha} is associated with reduced apoptosis and high levels of TGF{alpha} (10,40,41).

Oval cells are presumed to give origin to HCCs in rodents and humans (21,23,24,42). Using an oval cell line, we studied the interactions between MYC and TGF{alpha} in cell growth and tumorigenesis, and investigated the effects of disabling the apoptotic activity of MYC on these interactions. Our initial characterization of oncogene expression, and in particular, that of cell-associated pro-TGF{alpha}, led us to pursue the novel hypothesis that co-expression of MYC increases the conversion of ectopically expressed pro-TGF{alpha} to soluble TGF{alpha}. Enzyme-linked immunosorbent assay subsequently revealed that MYC expression does indeed increase production of soluble TGF{alpha}, and that this effect is dependent on TACE activity. However, we were unable to establish TACE as a gene that is transcriptionally or post-transcriptionally regulated by Myc (43). It is conceivable that Myc may modulate the transcription of another target gene that in turn modulates TACE function.

We hypothesized that co-expression of MYC and TGF{alpha} in situations in which the growth factor presumable has a reduced anti-apoptotic role would accelerate tumor growth. We used the apoptosis-deficient mutants T58A and S71F and show that these alleles retain their proliferative activity when expressed in oval cells, which is in agreement with data from other cell systems (17,18). Surprisingly, we found that only the T58A allele had a tumorigenic growth interaction with TGF{alpha} that was consistent with our hypothesis. In contrast, expression of the S71F allele with TGF{alpha} resulted in inhibition of cell replication and a consequent reduction in the rate of tumor growth.

The T58A and S71F of MYC alleles contain mutations in phosphorylation sites in the Myc homology box I region. The T58A allele has been isolated from thymic lymphomas. The selection for this mutation during tumorigenesis has been attributed to its ability to bypass p53 surveillance mechanisms, and to the increased stability of the T58A protein caused by lower sensitivity to ubiquitination (44–46). We report here that the T58A allele also has an increased ability to interact with TGF{alpha} in promoting cell proliferation in culture and tumorigenesis upon inoculation into mice. Interactions with TGF{alpha} and the S71F allele have opposite effects from that of TGF{alpha} and the T58A allele on oval cell proliferation and tumorigenicity. Cells expressing both S71F and TGF{alpha} show reduced proliferative activity and a slower development of tumors that are of smaller size. Cells that express the S71F allele alone do not show decreased cell proliferation, suggesting that the inhibitory effects found in cells co-expressing S71F + TGF{alpha} are the result of an interaction between S71F and the growth factor.

The precise mechanism by which the S71F mutation alters the interaction of MYC with TGF{alpha} is unclear at this time. Previous studies have shown that the S71 residue is a phosphorylation site (18,47). For example, the shedding of another ligand, Vascular Endothelial Growth Factor, is controlled by phosphorylation of this residue (48). It is conceivable that disruption of this phosphorylation site alters TGF{alpha} shedding as well, through the de-regulation of an intermediate gene. However, we have not observed any changes in TACE levels in cells expressing the S71F allele (data not shown).

It would be interesting to assess the interaction of the T58A and S71F alleles with oncogenes other than TGF{alpha} in liver progenitor cells. In in vitro fibroblast transformation assays, the T58A allele had increased transforming activity with V12-ras, whereas the S71F allele had decreased transforming activity (18). We therefore speculate that the differing ability of the T58A and S71F alleles of MYC to cooperate with growth factor might be applicable to other oncogenes as well.

The S71F allele has the greatest reduction in apoptotic function of any known MYC allele (18). While one would predict that this would dramatically increase the tumorigenic potential of MYC, mutations at S71 are not associated with tumor development. This is particularly intriguing considering that expression of the S71F allele by itself results in more rapid tumor growth than wild-type MYC by itself (data not shown). The lack of selection for the S71F mutation during tumorigenesis (49–52) suggests that maintenance of the ability of MYC to cooperate with other mitogenic signals such as TGF{alpha} is important for tumor development.


   Funding
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
References
 
National Institutes of Health (CA-074131, CA-023226) to N.F.; American College of Surgeons Resident Research Scholarship to K.J.R.


   Acknowledgments
 
We thank R.Eisenman, C.Grandori, R.Monnat, M.Bevan, G.Nolan, W.Tang, R.Prehn and L.Loeb for helpful discussions and materials, C.Lazaro for technical assistance and T.Parks and M.Yeh for histological analysis.

Conflict of Interest Statement: None declared.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 

  1. Dang CV. c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol. Cell. Biol. (1999) 19:1–11.[Free Full Text]
  2. Grandori C, et al. The Myc/Max/Mad network and the transcriptional control of cell behavior. Annu. Rev. Cell Dev. Biol. (2000) 16:653–699.[CrossRef][Web of Science][Medline]
  3. Fabregat I, et al. Survival and apoptosis: a dysregulated balance in liver cancer. Liver Int. (2007) 27:155–162.[CrossRef][Web of Science][Medline]
  4. Hoffman B, et al. The proto-oncogene c-myc and apoptosis. Oncogene (1998) 17:3351–3357.[CrossRef][Web of Science][Medline]
  5. Obaya AJ, et al. Mysterious liaisons: the relationship between c-Myc and the cell cycle. Oncogene (1999) 18:2934–2941.[CrossRef][Web of Science][Medline]
  6. Evan G, et al. A matter of life and cell death. Science (1998) 281:1317–1322.[Abstract/Free Full Text]
  7. Eischen CM, et al. Disruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced lymphomagenesis. Genes Dev. (1999) 13:2658–2669.[Abstract/Free Full Text]
  8. Eischen CM, et al. Apoptosis triggered by Myc-induced suppression of Bcl-X(L) or Bcl-2 is bypassed during lymphomagenesis. Mol. Cell. Biol. (2001) 21:5063–5070.[Abstract/Free Full Text]
  9. Ikeguchi M, et al. Expression of c-myc mRNA in hepatocellular carcinomas, noncancerous livers, and normal livers. Pathobiology (2004) 71:281–286.[CrossRef][Web of Science][Medline]
  10. Murakami H, et al. Transgenic mouse model for synergistic effects of nuclear oncogenes and growth factors in tumorigenesis: interaction of c-myc and transforming growth factor alpha in hepatic oncogenesis. Cancer Res. (1993) 53:1719–1723.[Abstract/Free Full Text]
  11. Calvisi DF, et al. Molecular mechanisms of hepatocarcinogenesis in transgenic mouse models of liver cancer. Toxicol. Pathol. (2005) 33:181–184.[Abstract/Free Full Text]
  12. Cavin LG, et al. Transforming growth factor-alpha inhibits the intrinsic pathway of c-Myc-induced apoptosis through activation of nuclear factor-kappaB in murine hepatocellular carcinomas. Mol. Cancer Res. (2005) 3:403–412.[Abstract/Free Full Text]
  13. Santoni-Rugiu E, et al. Disruption of the pRb/E2F pathway and inhibition of apoptosis are major oncogenic events in liver constitutively expressing c-myc and transforming growth factor alpha. Cancer Res. (1998) 58:123–134.[Abstract/Free Full Text]
  14. DuHadaway JB, et al. Bin1 mediates apoptosis by c-Myc in transformed primary cells. Cancer Res. (2001) 61:3151–3156.[Abstract/Free Full Text]
  15. Morrish F, et al. c-MYC apoptotic function is mediated by NRF-1 target genes. Genes Dev. (2003) 17:240–255.[Abstract/Free Full Text]
  16. Hoang AT, et al. A link between increased transforming activity of lymphoma-derived MYC mutant alleles, their defective regulation by p107, and altered phosphorylation of the c-Myc transactivation domain. Mol. Cell. Biol. (1995) 15:4031–4042.[Abstract]
  17. Conzen SD, et al. Induction of cell cycle progression and acceleration of apoptosis are two separable functions of c-Myc: transrepression correlates with acceleration of apoptosis. Mol. Cell. Biol. (2000) 20:6008–6018.[Abstract/Free Full Text]
  18. Chang DW, et al. The c-Myc transactivation domain is a direct modulator of apoptotic versus proliferative signals. Mol. Cell. Biol. (2000) 20:4309–4319.[Abstract/Free Full Text]
  19. Herbst A, et al. A conserved element in Myc that negatively regulates its proapoptotic activity. EMBO Rep. (2005) 6:177–183.[CrossRef][Web of Science][Medline]
  20. Fausto N. Oval cells and liver carcinogenesis: an analysis of cell lineages in hepatic tumors using oncogene transfection techniques. Prog. Clin. Biol. Res. (1990) 331:325–334.[Medline]
  21. Fausto N. Liver regeneration and repair: hepatocytes, progenitor cells, and stem cells. Hepatology (2004) 39:1477–1487.[CrossRef][Web of Science][Medline]
  22. Hooth MJ, et al. Spontaneous neoplastic transformation of WB-F344 rat liver epithelial cells. Am. J. Pathol. (1998) 153:1913–1921.[Abstract/Free Full Text]
  23. Roskams TA, et al. Progenitor cells in diseased human liver. Semin. Liver Dis. (2003) 23:385–396.[CrossRef][Web of Science][Medline]
  24. Roskams T. Progenitor cell involvement in cirrhotic human liver diseases: from controversy to consensus. J. Hepatol. (2003) 39:431–434.[CrossRef][Web of Science][Medline]
  25. Sell S. Cellular origin of hepatocellular carcinomas. Semin. Cell Dev. Biol. (2002) 13:419–424.[CrossRef][Web of Science][Medline]
  26. Lazaro CA, et al. Generation of hepatocytes from oval cell precursors in culture. Cancer Res. (1998) 58:5514–5522.[Abstract/Free Full Text]
  27. Evarts RP, et al. In vivo differentiation of rat liver oval cells into hepatocytes. Cancer Res. (1989) 49:1541–1547.[Abstract/Free Full Text]
  28. Goyette M, et al. Expression of hepatocyte and oval cell antigens in hepatocellular carcinomas produced by oncogene-transfected liver epithelial cells. Cancer Res. (1990) 50:4809–4817.[Abstract/Free Full Text]
  29. Braun L, et al. Production of hepatocellular carcinoma by oval cells: cell cycle expression of c-myc and p53 at different stages of oval cell transformation. Cancer Res. (1989) 49:1554–1561.[Abstract/Free Full Text]
  30. Yaswen P, et al. Isolation of oval cells by centrifugal elutriation and comparison with other cell types purified from normal and preneoplastic livers. Cancer Res. (1984) 44:324–331.[Abstract/Free Full Text]
  31. Argast GM, et al. Epidermal growth factor receptor transactivation mediates tumor necrosis factor-induced hepatocyte replication. J. Biol. Chem. (2004) 279:34530–34536.[Abstract/Free Full Text]
  32. Brooling JT, et al. Differential regulation of rodent hepatocyte and oval cell proliferation by interferon gamma. Hepatology (2005) 41:906–915.[CrossRef][Web of Science][Medline]
  33. Borrell-Pages M, et al. TACE is required for the activation of the EGFR by TGF-alpha in tumors. EMBO J. (2003) 22:1114–1124.[CrossRef][Web of Science][Medline]
  34. Magid R, et al. Expression of matrix metalloproteinase-9 in endothelial cells is differentially regulated by shear stress. Role of c-Myc. J. Biol. Chem. (2003) 278:32994–32999.[Abstract/Free Full Text]
  35. Leone G, et al. Myc and Ras collaborate in inducing accumulation of active cyclin E/Cdk2 and E2F. Nature (1997) 387:422–426.[CrossRef][Medline]
  36. Perez-Roger I, et al. Myc activation of cyclin E/Cdk2 kinase involves induction of cyclin E gene transcription and inhibition of p27(Kip1) binding to newly formed complexes. Oncogene (1997) 14:2373–2381.[CrossRef][Web of Science][Medline]
  37. Evan GI, et al. Induction of apoptosis in fibroblasts by c-myc protein. Cell (1992) 69:119–128.[CrossRef][Web of Science][Medline]
  38. Nilsson JA, et al. Myc pathways provoking cell suicide and cancer. Oncogene (2003) 22:9007–9021.[CrossRef][Web of Science][Medline]
  39. Strasser A, et al. Novel primitive lymphoid tumours induced in transgenic mice by cooperation between myc and bcl-2. Nature (1990) 348:331–333.[CrossRef][Medline]
  40. Factor VM, et al. Disruption of redox homeostasis in the transforming growth factor-alpha/c-myc transgenic mouse model of accelerated hepatocarcinogenesis. J. Biol. Chem. (1998) 273:15846–15853.[Abstract/Free Full Text]
  41. Factor V, et al. Roles of Akt/PKB and IKK complex in constitutive induction of NF-kappaB in hepatocellular carcinomas of transforming growth factor alpha/c-myc transgenic mice. Hepatology (2001) 34:32–41.[CrossRef][Web of Science][Medline]
  42. Alison MR, et al. Liver cancer: the role of stem cells. Cell Prolif. (2005) 38:407–421.[CrossRef][Web of Science][Medline]
  43. Santiago-Josefat B, et al. Post-transcriptional up-regulation of ADAM17 upon epidermal growth factor receptor activation and in breast tumors. J. Biol. Chem. (2007) 282:8325–8331.[Abstract/Free Full Text]
  44. Hemann MT, et al. Evasion of the p53 tumour surveillance network by tumour-derived MYC mutants. Nature (2005) 436:807–811.[CrossRef][Medline]
  45. Salghetti SE, et al. Destruction of Myc by ubiquitin-mediated proteolysis: cancer-associated and transforming mutations stabilize Myc. EMBO J. (1999) 18:717–726.[CrossRef][Web of Science][Medline]
  46. Welcker M, et al. The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylation-dependent c-Myc protein degradation. Proc. Natl Acad. Sci. USA (2004) 101:9085–9090.[Abstract/Free Full Text]
  47. Noguchi K, et al. Regulation of c-Myc through phosphorylation at Ser-62 and Ser-71 by c-Jun N-terminal kinase. J. Biol. Chem. (1999) 274:32580–32587.[Abstract/Free Full Text]
  48. Watnick RS, et al. Ras modulates Myc activity to repress thrombospondin-1 expression and increase tumor angiogenesis. Cancer Cell (2003) 3:219–231.[CrossRef][Web of Science][Medline]
  49. Bhatia K, et al. Point mutations in the c-Myc transactivation domain are common in Burkitt's lymphoma and mouse plasmacytomas. Nat. Genet. (1993) 5:56–61.[CrossRef][Web of Science][Medline]
  50. Bhatia K, et al. Mutations in the coding region of c-myc occur frequently in acquired immunodeficiency syndrome-associated lymphomas. Blood (1994) 84:883–888.[Abstract/Free Full Text]
  51. Clark HM, et al. Mutations in the coding region of c-MYC in AIDS-associated and other aggressive lymphomas. Cancer Res. (1994) 54:3383–3386.[Abstract/Free Full Text]
  52. Yano T, et al. Clustered mutations in the second exon of the MYC gene in sporadic Burkitt's lymphoma. Oncogene (1993) 8:2741–2748.[Web of Science][Medline]
Received June 4, 2007; revised July 29, 2007; accepted August 1, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/12/2624    most recent
bgm184v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cheung, R. S.Y.
Right arrow Articles by Fausto, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheung, R. S.Y.
Right arrow Articles by Fausto, N.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?