Skip Navigation


Carcinogenesis Advance Access originally published online on September 4, 2006
Carcinogenesis 2007 28(2):404-413; doi:10.1093/carcin/bgl162
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/2/404    most recent
bgl162v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Dell'Eva, R.
Right arrow Articles by Ferrari, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dell'Eva, R.
Right arrow Articles by Ferrari, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

The Akt inhibitor deguelin, is an angiopreventive agent also acting on the NF-{kappa}B pathway

Raffaella Dell'Eva1,{dagger}, Claudia Ambrosini1,{dagger}, Simona Minghelli2, Douglas M. Noonan3, Adriana Albini1,* and Nicoletta Ferrari1

1 Molecular Oncology Laboratory, National Institute for Cancer Research Largo R. Benzi 10
2 Centro di Biotecnologie Avanzate, Genova 16132 Italy
3 Department of Clinical and Biological Sciences, University of Insubria Varese 21100, Italy

*To whom correspondence should be addressed. Tel: +39 010 5737 406; Fax: +39 010 5737 231; Email: adriana.albini{at}istge.it


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Several natural compounds, especially plant products and dietary constituents, are able to exhibit ‘angiopreventive’ (anti-angiogenic chemoprevention) activities both in vitro and in vivo. Deguelin is a rotenoid of the flavonoid family with chemopreventive activities able to decrease tumor incidence in animal models for lung, colon, mammary and skin carcinogenesis through Akt inhibition. Here we show that deguelin belongs to the ‘angiopreventive’ molecules and provide evidence for molecular events associated with its anti-angiogenic properties. The data show that deguelin inhibits HUVE cells growth by inducing cell-cycle arrest in the G0/G1 phase and in the absence of apoptosis. Growth arrest is associated with induction of p21 and p53 and decreased survivin levels. Deguelin also interferes with several points in the angiogenic process, including inhibition of endothelial cell migration, invasion and metalloprotease production, and potently inhibits in vivo angiogenesis and vascular tumor growth. In addition to Akt, the nuclear factor-kappaB (NF-{kappa}B) kinase pathway, which plays a critical role in the regulation of inflammation, vascular homeostasis and angiogenesis, was also repressed by deguelin even in the presence of inflammatory stimuli such as tumor necrosis factor-{alpha} (TNF-{alpha}). These findings reveal a new therapeutic potential for deguelin in angioprevention and anti-angiogenic therapy.

Abbreviations: COX-2, cyclooxygenase-2; IL-8, interleukin-8; MMP, matrix metalloproteinases; NF-{kappa}B, nuclear factor-kappaB; PI3K, phosphatidylinositol 3-kinase; TNF-{alpha}, tumor necrosis factor-{alpha}


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Several natural compounds, particularly plant products and dietary constituents, have been found to exhibit chemopreventive activities both in vitro and in vivo (1,2). They show different mechanisms of action including cell growth suppression, modulation of cell differentiation and induction of apoptosis. Some rotenoids, which constitute a class of compounds from the plant-derived flavonoid family, have been shown to exert chemopreventive activity (3). Deguelin, a rotenoid isolated from several plant species including Mondulea sericea (Leguminosae), has been shown to be effective in reducing the incidence of tobacco-induced lung tumorigenesis (4) and chemically induced skin tumors in mice (5), mammary tumors in rats (5), colonic aberrant crypt foci in mice (6) and preneoplastic lesion formation in mouse mammary gland in organotypic culture (3,7). The mechanisms through which deguelin inhibits carcinogenesis are not fully elucidated; various activities have been described including suppression of ornithine decarboxylase (ODC) (3), induction of apoptosis by dysregulation of the cell-cycle checkpoint protein retinoblastoma (8), inhibition of mitochondrial bioenergetics (9), down-regulation of cyclooxygenase-2 (COX-2) expression (10) and decreased activity of the phosphatidylinositol 3-kinase (PI3K)/Akt pathway (4,11). We observed that several agents shown to have chemopreventive activity in experimental test systems and/or clinical trials all show significant anti-angiogenic activities as a key common target, a concept we termed ‘angioprevention’ (12). We propose that among the diverse mechanisms of carcinogenesis inhibitors, the anti-angiogenic activity of chemopreventive compounds is a common and critical effect repressing cancer by blocking or retarding tumor vasculature development. Several different overlapping categories of mechanisms leading to angiogenesis inhibition can be discerned; these include inhibition of COX-2 as is the case for non-steroidal anti-inflammatory drugs (NSAIDs) and N-acetyl-L-cysteine (NAC) (13). Inhibition of matrix metalloproteinases (MMPs), required for endothelial cell invasion, also appears to be a common target of active chemopreventive agents (14,15). One crucial point in common with many of these substances is the PI3K–Akt signaling axis (16). This pathway is activated by a variety of stimuli in endothelial cells and regulates multiple steps in angiogenesis, including endothelial cell survival, migration and invasion (17). Gene targeting of Akt1 modifies angiogenesis in murine models (18,19), further emphasizing the crucial role of Akt in angiogenesis. Since deguelin inhibits Akt and Akt is critical for angiogenesis, we investigated whether deguelin shows angiopreventive properties.

Here we demonstrate that deguelin inhibits endothelial cell growth, migration and Matrigel invasion. In vivo analyses confirm that deguelin potently inhibits angiogenesis. The basal levels of Akt were repressed by deguelin in endothelial cells, similar to that seen for tumor cells (4,11). We have previously observed that inhibition of nuclear factor-kappaB (NF-{kappa}B), a pro-inflammatory transcription factor associated with angiogenesis, is also a target of angiopreventive compounds (20). NF-{kappa}B appears to be the final target of the anti-angiogenic activity of deguelin, as tumor necrosis factor-{alpha} (TNF-{alpha})-induced I{kappa}B kinase activities were down-regulated by deguelin. NF-{kappa}B is known to regulate transcription of genes responsible for growth and survival as well as apoptosis inhibition: the regulation of Akt and NF-{kappa}B activity by deguelin led to increased expression of the mitosis inhibitor p21 and the p53 tumor suppressor gene while repressing the anti-apoptotic survivin. Together, these findings identify pleiotropic mechanisms for anti-angiogenic efficacy of deguelin, and suggest potential application in angioprevention and anti-angiogenic therapy.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell culture and chemicals
Endothelial HUVE cells were obtained from the ATCC (Rockville, MD) and cultivated on gelatin coated plates (1% in phosphate-buffered saline; PBS) in M199 containing 10% heat-inactivated fetal calf serum (FCS), 100 µg/ml heparin, 10 ng/ml aFGF, 10 ng/ml bFGF, 10 ng/ml EGF and 10 µg/ml hydrocortisone. HMVECad and HAEC were from Cascade (Portland, Oregon) and cultivated in MVGS supplemented Medium 131 (HMVECad) or LSGS supplemented Medium 200 (HAEC; Cascade). K562 and U937 were from ATCC and cultivated in RPMI containing 10% heat-inactivated FCS. The previously described KS-IMM cell line, isolated in our laboratory from a kidney transplanted immuno-suppressed patient (21) was grown in RPMI containing 10% FCS. Deguelin (Sigma, Milano, Italy) was dissolved in dimethyl sulfoxide (DMSO) at a stock concentration of 2 mM and stored in aliquots at –20°C.

Cell proliferation, apoptosis and FACS analysis for cell cycle distribution
To study cell growth, 2000 HUVE cells per well were seeded in 96-well plates and grown in complete medium or treated with various concentrations of deguelin. Media were changed every 48 h. The number of viable cells was measured with the crystal violet assay. Briefly, after fixation and staining in a solution of 0.75% crystal violet, 0.35% sodium chloride, 32% ethanol and 3.2% formaldehyde, the cells were dissolved in 50% ethanol, 0.1% acetic acid and read at 595 nm. To measure any enrichment of cytoplasmic histone-associated-DNA-fragments after deguelin treatment, a commercially available kit was employed (Cell Death Detection ELISA, Roche, Mannheim, Germany) using 24-well plates seeded with 30 000 HUVE cells per well and grown in complete medium containing various concentrations of deguelin. FACS analysis for cell-cycle distribution was carried out on HUVE cells grown in regular medium for 24 h in the absence or presence of deguelin at different concentrations. At the end of treatments, 500 000 cells were washed in PBS and suspended in 0.5 ml of hypotonic propidium iodide (PI) solution (50 µg/ml PI, 0.1% Triton X-100, in 4 mM sodium citrate buffer) and incubated for >1 h at 4°C in the dark. Cell-cycle distribution was then analyzed by flow cytometry (FACSORT, Becton Dickinson) and percentage of cells in different phases of cell cycle was determined by ModFit LT cell cycle analysis software.

Matrigel morphogenesis assay
A 24-microwell plate, prechilled at –20°C, was carefully filled with 300 µl/well of liquid Matrigel (10 mg/ml) at 4°C with a prechilled pipette, avoiding bubbles. The Matrigel was polymerized for 1 h at 37°C, and HUVE cells (70 000 cells/well) were suspended in regular medium in the absence or presence of different concentrations of deguelin and carefully layered on the top of polymerized Matrigel. The effects on the growth and morphogenesis of endothelial cells were recorded after 6 and 24 h with an inverted microscope (Leitz DM-IRB) equipped with CCD optics and a digital analysis system.

Chemotaxis and invasion assays
Chemotaxis and chemoinvasion assays on HUVE cells were carried out in Boyden chambers as described previously (22). The cells (5 x 104), were extensively washed with PBS, re-suspended in serum-free media (SFM) and placed in the upper compartment with or without deguelin. The two compartments of the Boyden chamber were separated by a 12 µm pore-size polycarbonate filters coated with 5 µg/ml of collagen IV for the chemotaxis assay or with Matrigel (15 µg/ml), a reconstituted basement membrane, for the invasion assay. Supernatants from NIH3T3 cells (NIH3T3-CM) were used as chemoattractants in the lower chamber. After 6 h of incubation at 37°C in 5% CO2, the filters were recovered, the cells on the upper surface were mechanically removed and those on the lower surface were fixed and stained. The migrated cells were counted in 5–10 fields for each filter under a microscope. The experiments were performed in triplicate and repeated three times.

Gelatin zymography
Supernatants of cells from the invasion assay were centrifuged to remove particulates and the protein content was measured by the Bradford method (Bio-Rad, Hercules, CA). Gelatin zymography was performed as previously described (23). Briefly, SDS–PAGE gels were prepared containing copolymerized gelatin at a final concentration of 1.6 mg/ml. After electrophoresis, the gels were washed in 2.5% Triton X-100 for 30 min to remove SDS and incubated for 18 h at 37°C in collagenase buffer (40 mM Tris, 200 mM NaCl, and 10 mM CaCl2, pH 7.5). Gels were then stained in 0.1% Coomassie brilliant blue followed by destaining. The enzyme-digested regions were observed as white bands against a blue background.

In vivo angiogenesis
We utilized the Matrigel sponge model of angiogenesis described previously (24). VTH [100 ng/ml vascular epithelial growth factor (VEGF), 2 ng/ml TNF-{alpha} and heparin] in combination with deguelin at different concentrations was added to unpolymerized liquid Matrigel at 4°C to a final volume of 600 µl. The control group was treated with vehicle alone. The Matrigel suspension was slowly injected subcutaneously (s.c.) into the flanks of C57/bl6 male mice (Charles River, Lecco, Italy) with a cold syringe. The gel quickly polymerizes in vivo to form a solid gel. After 4 days, gels from all animals were collected and weighed. Samples were minced and diluted in water to measure the hemoglobin content with a Drabkin reagent kit (Sigma, Milano, Italy). Some samples were formalin-fixed, paraffin-embedded sectioned at 2–4 µm thickness, and then stained with hematoxylin and eosin for histological analysis or with anti-myeloperoxidase (DAKO, Glostrup, Denmark) or anti-p65 NF-{kappa}B subunit (ZYMED, San Francisco, CA) antibodies for immunochemistry.

Tumor growth in vivo
Kaposi's sarcoma tumors were obtained by s.c. injection of 5 x 106 KS-IMM cells mixed with liquid Matrigel (final volume 250 µl) in the flanks of 7-week-old nude nu/nu (CD1) mice (Charles River). Animals (10 in each group) were treated by intraperitoneally (i.p.) injection of either deguelin (4 mg/kg of body wt) or vehicle, three times per week, starting 6 days prior to KS-IMM cell injection. The animals were weighed and tumor growth was monitored at regular intervals by measuring two tumor diameters with calipers and calculating the tumor volumes with the following formula: (length x width)2/2. On Day 29, the animals were sacrificed and the tumors were removed, weighed, fixed in paraformaldehyde and stained with hematoxylin and eosin for histological examination.

Real-time PCR
Total RNAs were isolated from controls and cells treated 6 and 24 h with 100 nM deguelin and reverse transcribed with oligo(dT) primers. mRNA expression was analyzed by quantitative real-time RT–PCR by using the following primers: p21 sense 5'-GGACAGCAGAGGAAGAC and antisense 5'-GGCGTTTGGAGTGGTAGAAA; p53 sense 5'-CCAGCCAAAGAAGAAACCAC and antisense 5'-CTCATTCAGCTCTCGGAAC; survivin sense 5'-ACTGAGAACGAGCCAGACTT and antisense 5'CGGACGAATGCTTTTTATGT TC. The relative expression of each gene was assessed in comparison with the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase amplified with the following primers: sense 5'-GAAGGTGAAGGTCGGAGT and antisense 5'-CATGGGTGGAATCATATTGGAA. cDNAs were amplified for 50 cycles using iQ Supermix (Bio-Rad, Richmond, CA) containing the intercalating agent SYBR Green in a two-step amplification scheme (95°C, 15 s and 60°C, 30 s). Fluorescence was measured during the annealing step on a Bio-Rad iCycler iQ instrument. Blank controls that did not contain cDNA were run in parallel. All samples were run in triplicate. Following amplification, melting curves with 80 steps of 15 s and a 0.5°C temperature increase per step were done to control for amplicon identity. Relative expression values with SEMs and statistical comparison (unpaired two-tailed t-test) were obtained using Qgene software (25).

Nuclear and cell extracts and western blot analysis
To test for activation of the NF-{kappa}B pathway, HUVE cells were serum starved for 16 h and then treated with 100 nM deguelin for 6 h in SFM. At 5 and 15 min, before the end of incubation, cells were stimulated with TNF-{alpha} (10 ng/ml). Serum starved control cells and cells exposed to 100 nM deguelin for different lengths of time were also utilized to analyze Akt activation. For nuclear and cytoplasmic protein extracts, the pellets of control and treated cells were re-suspended in cytoplasmic lysis buffer and incubated on ice for 10 min, vortexed and centrifuged at 12 000 r.p.m. for 2 min at 4°C. Supernatants containing the cytoplasmic proteins were kept separately and the nuclei in the pellets were re-suspended in nuclear lysis buffer for 20 min on ice and centrifuged at 12 000 r.p.m. for 2 min at 4°C. Protein concentration was determined by using the DC Protein Assay kit (Bio-Rad). Equal amounts of samples were resolved by SDS–PAGE, transferred to nitrocellulose and probed at 4°C overnight with the following anti-human antibodies (Cell Signaling Technology, Beverly, MA): rabbit polyclonal anti-phospho-Akt (Ser473), anti-phospho-I{kappa}B (Ser32) and anti-phospho p65(Ser539). p21, p53 and survivin analyses were carried out on extracts obtained from cells grown in complete medium and filters were probed with the following anti-human antibodies (Santa Cruz Biotechnology, Santa Cruz, CA): rabbit polyclonal anti-p21 and anti-p53 antibodies and a mouse monoclonal anti-survivin antibody. After washing, the blots were incubated for 1 h at room temperature with horseradish peroxidase (HRP)-conjugated secondary antibodies (Amersham, Cologno Monzese, Italy) and specific complexes were revealed by enhanced chemiluminescence solution (Amersham). An anti-GAPDH antibody conjugated to HRP (Novus Biologicals, Littleton, CO) or a mouse monoclonal anti-ß-tubulin antibody (Sigma, Milano, Italy) were utilized as loading controls for all samples.

Nuclear protein extraction, NF-{kappa}B and IL-8 ELISA
HUVE cells (1.5 x 106) grown in regular medium were treated 6 h with or without 100 nM deguelin. In some experiments the cells were stimulated, at the end of the experiment, with 10 ng/ml TNF-{alpha} for 5–15 min and then harvested. Nuclear protein extracts were prepared using the Nuclear Protein extract kit (Active Motif, Carlsbad, CA) according to the manufacturer's instructions. Enzyme-linked immunosorbent assay (ELISA) assays for NF-{kappa}B activity were performed using a commercially available kit (TransAM, Active Motif) following the manufacturer's instructions. Briefly, the oligonucleotide containing the NF-{kappa}B consensus site (5'-GGGACTTTCC- 3') was immobilized on 96-well plates and 10 µg of HUVEC nuclear protein extract were added to triplicate wells. Plates were washed to remove unbound protein and anti-NF-{kappa}B detection antibody was added and labeled with HRP-conjugated antibody. Plates were read at 450 nm.

To quantify interleukin-8 (IL-8) protein, viable cells (4 x 104) were seeded in 24-well plates and treated with deguelin as indicated. Conditioned media were removed after 16 and 24 h and IL-8 protein content was determined using the commercial human IL-8 ELISA kit (Bender MedSystems, Vienna, Austria).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The effects of deguelin on endothelial cells in vitro
We first assessed the action of deguelin on endothelial cell proliferation by treating HUVE cells with a range of concentrations of the rotenoid. All the concentrations tested inhibited HUVE cell growth, with statistically significant differences after 72-h exposure (Figure 1A, two-tailed t-test, **P < 0.01, ***P < 0.001), with a maximal inhibition achieved at 50 nM. Deguelin induction of apoptosis was examined by determination of cytoplasmic histone-associated-DNA-fragments. After 24 h at all tested concentrations deguelin significantly reduced cellular apoptosis (Figure 1B, two-tailed t-test, ***P < 0.001), thus was clearly anti-apoptotic for endothelial cells. To study whether the growth inhibitory effects of deguelin were accompanied by cell-cycle arrest, HUVE cells were grown as described above, harvested, stained with Triton X-100/PI and analyzed by flow cytometry for cell-cycle distribution. Deguelin treatment resulted in an evident increase in G0–G1 arrest together with a concomitant decrease in G2–M phases population (Figure 1C). HUVE cells treated with 50 and 100 nM deguelin for 24 h had 84 and 94% cells in G0–G1, as compared with only 73% in the controls. Conversely, G2–M phase population was decreased to 4 and 0.4% as compared with 11% in the controls. The percentage of apoptotic cells strongly decreases in deguelin treated cells, confirming its anti-apoptotic effect and lack of toxicity on endothelial cells. Consistent with the absence of toxicity, deguelin did not alter the ability of endothelial cells to differentiate into capillary-like networks in the morphogenesis assay on Matrigel (Figure 1D).


Figure 1
View larger version (47K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 (A) The cytostatic effects of 72-h exposure to deguelin on growth of HUVE cells in vitro. (B) HUVE cell apoptosis in the presence of deguelin; after 24 h of treatment, all concentrations significantly reduced apoptosis as compared with controls. (C) Flow cytometry distribution of Triton X-100/PI stained HUVE cells after 24 h of deguelin treatment at different doses. Both concentrations induced G1 arrest and protected cells from apoptosis relative to untreated cells. (D) Effect of deguelin on organization of HUVE cells in the Matrigel morphogenesis assay. HUVE cells organized into capillary-like networks even at the highest concentration used, consistent with an absence of toxicity.

 
The effects of deguelin on endothelial cell migration and invasion were then tested at various concentrations. Fibroblast conditioned medium (NIH3T3-CM), which contains a mixture of molecules able to stimulate the migration of invasive cells, was used as chemoattractant in these experiments. HUVE cells migrated (Figure 2A) and invaded through Matrigel (Figure 2B) in response to NIH3T3-CM, while migration in the absence of a chemoattractanct (SFM) was limited. The addition of deguelin in the upper chambers had prominent effects on the migration and invasion of endothelial cells, with significant inhibition even at the lowest concentration (10 nM, ***P < 0.001, two tailed t-test).


Figure 2
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 (A) Inhibition of HUVE cell migration and (B) inhibition of invasion by deguelin. Means ± SEM are shown; ***P < 0.001 with respect to controls (two-tailed t-test). (C) Zymographic detection of secreted gelatinase activity, deguelin dose-dependently inhibited MMP-2 release.

 
The HUVE cells stimulated to invade produce a characteristic gelatinase activity corresponding to the 72 kDa activated form of gelatinase A (MMP-2), a molecule whose synthesis is regulated by NF-{kappa}B. Deguelin did not have direct effects on the enzymatic activity of MMP-2 as determined by its addition to the buffer of the gelatin zymography (data not shown). However, zymographic evaluation performed on supernatants of cells obtained from the invasion assays performed above, showed a marked decrease in the MMP-2 activity produced by HUVE cells with increasing concentrations of deguelin (Figure 2C). These data suggest that deguelin inhibits metalloprotease synthesis, which would be consistent with NF-{kappa}B repression, or secretion.

Inhibition of angiogenesis and vascular tumor growth in vivo
The effects of deguelin on angiogenesis-associated endothelial cell functions observed in vitro were then confirmed in vivo in the matrigel pellet angiogenesis assay. Matrigel suspensions containing a cocktail (VTH) of VEGF (100 ng/ml) and TNF-{alpha} (2 ng/ml) as angiogenic stimuli were injected subcutaneously in mice. The presence of VTH in the Matrigel sponges promoted a hemorrhagic vascularization of the gels within 4 days. Quantification of the extent of angiogenesis by hemoglobin content measurement showed a dose-dependent inhibition by deguelin, with significant reduction at 50 nM (final concentration, ***P < 0.001, Mann–Whitney) (Figure 3A). The angiogenic response was essentially abolished in the presence of 100 nM deguelin (Figure 3A). Histological analyses of the recovered gels showed a strong infiltration with vessel formation in control samples (Figure 3B), while deguelin-treated animals showed only a minor cellular infiltrate in the intact largely acellular Matrigel (Figure 3C). Immunohistochemical staining showed an intense myeloperoxidase positive cell population [macrophages and polymorphonuclear leukocytes (PMN)] (Figure 3D) as well as cells positive for the p65 NF-{kappa}B subunit in the control samples (Figure 3F). In contrast, only few myeloperoxidase or p65 positive cells were among those infiltrating into deguelin treated samples (Figure 3E and G).


Figure 3
View larger version (138K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Inhibition of angiogenesis in vivo by deguelin. Subcutaneously injected Matrigel sponges containing angiogenic factors rapidly become vascularized as estimated by measurement of the hemoglobin content of the gels. (A) Addition of deguelin to the gels significantly (***P < 0.001, Mann–Whitney) prevented vascularization. Means ± SEM are shown. (B and C) Hematoxylin and eosin staining of recovered gels from control (B) and deguelin treated (C) animals. Intense cellular infiltration and vessel formation is apparent in control samples while the Matrigel is largely intact and acellular in the treated samples. (D–G) Immunohistochemical staining for myeloperoxidase (D and E) and NF-{kappa}B p65 subunit (F and G) in control (D and F) and deguelin treated animals (E and G).

 
Since these data indicated potential angioprevention properties of deguelin, we investigated whether deguelin was able to prevent vascular tumor growth in vivo in an angioprevention setting. The immortalized KS-IMM Kaposi's sarcoma cell line forms highly angiogenic tumors when injected s.c. in male nude mice; in those animals treated with 4 mg/kg body wt of deguelin the growth of tumors was strongly and significantly (***P < 0.001, two-way ANOVA) reduced as compared with the controls (Figure 4A) from Day 24 on. Further deguelin-treated animals showed significantly lower tumor weights at the end of the experiment (Figure 4A inset, P = 0.0071, Mann–Whitney t-test). Histological analysis indicated rapidly growing, vascularized tumors in the controls, while tumors from the deguelin treated animals showed fewer, smaller vessels and extensive necrotic tissue (Figure 4B and C), consistent with repressed angiogenesis. No differences were noted in the body weight or general health parameters in the treated animals as compared with controls, indicating limited or no toxicity of deguelin treatment, again consistent with the in vitro observations.


Figure 4
View larger version (78K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Inhibition of tumor growth in vivo by deguelin. (A) Growth of highly vascularized KS-IMM tumors in vivo was significantly reduced by treatment with deguelin (*P < 0.05, **P < 0.01, ***P < 0.001, two-way ANOVA). Inset: recovered tumor weights were significantly smaller in the animals treated with deguelin (P = 0.0071, Mann–Whitney t-test). (B) Histological analysis of tumors from control vehicle treated animals showed vascularized areas. (C) Tumors from deguelin treated animals showed more extensive necrotic areas and fewer, smaller vessels than the controls.

 
The Akt pathway in vascular homeostasis and angiogenesis
Deguelin inhibits Akt activation with an up-regulation of p21 and p53 and a decreased expression of survivin
The Akt signaling axis is activated by a variety of stimuli in endothelial cells and regulates multiple critical steps in angiogenesis, including endothelial cell survival, migration and invasion. The ability of deguelin to inhibit the Akt signaling pathway in tumor cells has been previously reported. On the basis of our results on endothelial cell growth, migration and invasion, we examined whether deguelin also inhibits Akt phosphorylation in endothelial cells. Western blot analysis showed high basal levels of phosphorylated Akt in HUVE cells. As expected, a 1-h exposure to 100 nM deguelin reduced Akt phosphorylation by >70% (Figure 5A).


Figure 5
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Effects of deguelin on Akt activation and p21, p53 and survivin mRNAs and protein expression. (A) Western blot analysis demonstrating deguelin repression of basal levels of phosphorylated Akt (Ser473) in HUVE cells. (B, D and E) Real-time reverse transcription–PCR for p21, p53 and survivin expression in HUVEC (B), HMVECad and HAEC (D) and K562 and U937 leukemia cells (E). Deguelin modulates in a time-dependent manner all the three regulators of cell-cycle progression. Amplification products were measured during the reaction, and mean normalized expression values were calculated by comparison with the housekeeping gene glyceraldehyde-3-phosphate-dehydrogenase amplified in parallel. All amplifications were done in triplicate (*P < 0.05, **P < 0.01, ***P < 0.001 , two-tailed t-test). (C) p21, p53 and survivin immunoblotting analyses of cytoplasmic and nuclear lysates from deguelin-treated HUVE cells. Results strongly confirm real-time PCR data, and show different distribution of p21 upon deguelin exposure.

 
Akt phosphorylates specific targets to promote cell survival and proliferation and has been shown to influence the cellular localization and functions of p21 (26). The Akt pathway can also influence p53 expression and apoptosis (27) and survivin expression in endothelial cells (28). We examined if the growth inhibitory effect of deguelin was accompanied by similar events. HUVE cells were exposed to 100 nM deguelin for 6 and 24 h, followed by RNA extraction and real-time PCR validation of the expression of p53, p21 and survivin. These analyses showed that at 6-h exposure to deguelin significantly induced p21 and p53 expression while survivin mRNA was suppressed (Figure 5B). The modulation of the expression of these genes became even more evident after 24-h treatment (Figure 5B). We then investigated whether modulated mRNA species corresponded to modulation of proteins expression. Western blotting analysis of nuclear extracts from HUVE cells treated with 100 nM deguelin for 24 h showed a strong increase in p53 protein levels while p21 up-regulation was already evident after 16 h (Figure 5C). Interestingly, the nuclear p21 increase corresponded to a complete disappearance of the cytoplasmic protein, consistent with changes in cellular localization of p21 upon its activation. Deguelin also strongly decreased the amount of survivin, causing an almost complete disappearance of the product from both nuclear and cytosolic fractions as detected by western blotting (Figure 5C). Real-time PCR validation showed that endothelial cells of different origin, such as microvascular endothelial cells from adult dermis (HMVEDad) and human aortic endothelial cells (HAEC), showed the same pattern of gene modulation after exposure to deguelin (Figure 5D), except that HAEC did not express p21. Conversely, rapidly growing cells such as the leukemia cell lines K562 and U937 responded to deguelin with a strong growth inhibition associated with apoptosis (data not shown), while expression patterns of survivin, p21 and p53 varied widely in these cells (Figure 5E). As previously noted the U937 cells did not express p53.

Deguelin inhibits NF-{kappa}B translocation, activation and expression of Interleukin 8
Activated Akt regulates NF-{kappa}B activation (29,30) and cell survival. Blockade of NF-{kappa}B is associated with suppression of metalloproteinase production, angiogenesis, invasion and metastasis (31). As deguelin was able to inhibit invasion and angiogenesis induced by a cocktail containing VEGF and TNF-{alpha} (an angiogenic cytokine known to induce activation and translocation of NF-{kappa}B to the nucleus), and repressed MMP-2 production, we examined whether deguelin could affect NF-{kappa}B activation. Inactive NF-{kappa}B consists of a heterotrimer composed by the p50 and p65 subunits together with the protein I{kappa}B{alpha}. The phosphorylation, ubiquitination and degradation of I{kappa}B{alpha} releases the p50–p65 heterodimer which translocates to the nucleus to induce specific gene expression. ELISA for activated NF-{kappa}B showed constitutively active levels in HUVE cells, similar to the positive control Jurkat nuclear extracts. A 6-h exposure to 100 nM deguelin significantly decreased the basal NF-{kappa}B activity (Figure 6A, *P = 0.019, two-tailed t-test). As expected, treatment of HUVE cells for 5 and 15 min with 10 ng/ml TNF-{alpha} produced a strong NF-{kappa}B activation. Preincubation for 6 h in the presence of 100 nM deguelin significantly inhibited this TNF-{alpha} induced NF-{kappa}B activation (Figure 6A, **P < 0.01, two-tailed t-test). Western blot analysis confirmed that deguelin significantly repressed the levels of nuclear phosphorylated p65 (Figure 6B), as well as the levels of cytosolic phosphorylated I{kappa}B{alpha} (Figure 6B) present in HUVE cells after stimulation with TNF-{alpha}. These data indicate an inhibitory activity at or up-stream of the protein kinase IKK, which phosphorylates I{kappa}B{alpha}, suggesting that deguelin is able to interfere with the signaling pathways leading to NF-{kappa}B activation.


Figure 6
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 The effects of deguelin on NF-{kappa}B activation. (A) ELISA analysis demonstrated that treatment with deguelin reduced the amount of active NF-{kappa}B both in control and TNF-{alpha} (10 ng/ml) stimulated cells. Means ± SEM are shown (*P < 0.05, **P < 0.01 with respect to control, two-tailed t-test). (B) Western blot analysis shows that deguelin repressed nuclear phosphorylated p65 and cytosolic I{kappa}B{alpha} levels in HUVE cells after stimulation with TNF-{alpha}. The inhibition was evident soon after stimulation. (C) IL-8 protein in the culture supernatants determined by ELISA was expressed as ng/ml/16 h. Deguelin suppressed IL-8 protein production; means ± SEM are shown (**P < 0.01, ***P < 0.001, two-tailed t-test).

 
IL-8 is a chemoattractant cytokine that can directly enhance endothelial cell survival, proliferation and MMP production (32) and possesses a promoter region containing binding sites for NF-{kappa}B. We therefore tested whether deguelin, by modulating NF-{kappa}B activity, could also regulate IL-8 production. Conditioned media were collected from HUVE cells treated 16 and 24 h with 25–100 nM deguelin and analyzed by for IL-8 content ELISA. Deguelin, after 16 h of treatment, significantly decreased IL-8 secretion (Figure 6C; ***P < 0.001, two-tailed, t-test).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Recent gains in the knowledge of endothelial cell physiology and tumor angiogenesis are providing the necessary background to develop ever more effective anti-angiogenic strategies for cancer therapy. Identification of new pharmacologically active compounds of natural origin and identification of their molecular mechanisms are opening new perspectives in preventive oncology. The chemopreventive rotenoid, deguelin, has been observed to inhibit tumor cell growth in vitro through inhibition of Akt (11), as well as repressing tumor growth in vivo (4,5). The serine-threonine kinase Akt is a down-stream target of PI3K and both have been implicated in a number of cellular functions including cell adhesion, protein synthesis and cell survival (33). Constitutively active PI3K and Akt signaling also induce angiogenesis (34). The central finding of the present study is that deguelin exhibits pleiotropic anti-angiogenic effects: in addition to inhibiting Akt in endothelial cells, it negatively regulates endothelial cell NF-{kappa}B activity both at the basal level and in the presence of specific stimuli such as TNF-{alpha}. Similar to the repression of Akt-ser473 phosphorylation, deguelin inhibition of NF-{kappa}B DNA binding activity was accompanied by decreased phosphorylation of both p65 and I{kappa}B{alpha}. Down-stream effects of these activities appear to be a G1 arrest involving up-regulation of p21 and p53 and down-regulation of survivin, but protection from apotosis. Consistent with these biochemical observations, deguelin inhibited multiple properties associated with angiogenesis, including endothelial cell migration, invasion, MMP-2 activity and IL-8 secretion in vitro. While any one individual effect of deguelin might not be sufficient for inhibition of angiogenesis, summed together they appear to produce the potent anti-angiogenic effect observed on angiogenesis and vascular tumor growth in vivo.

NF-{kappa}B is a target of Akt in anti-apoptotic signaling (35), as NF-{kappa}B activation by TNF-{alpha} requires the Akt serine-theonine kinase (29). Targeting PI3K–Akt as well as NF-{kappa}B may be potential mechanisms to control endothelial cell growth and inhibit angiogenesis, as demonstrated by effects similar to that observed with deguelin obtained with silibinin (36) or xanthohumol (20). On stimulation by growth factors, Akt detaches from the inner surface of the plasma membrane and re-localizes to the nucleus, suggesting that Akt targets may be also located in the nucleus. In this context, Akt has been shown to influence the cellular localization and functions of p21, which induces cell growth arrest by inhibiting the functions of cyclin-dependent kinases in the nucleus (26). p21 can also localize to the cell cytoplasm where it was associated with anti-apoptotic activity (37). The underlying mechanisms of Akt regulation of p21 activity includes Akt association with and phosphorylation of p21 on a consensus threonine residue (Thr145) in the nuclear localization signal, leading to cytoplasmic localization (38). Conversely, inhibition of Akt suppresses cell growth in a manner that correlates with the nuclear localization of p21. These observations well correlate with our results: under basal conditions, where HUVE cells show constitutively active Akt, p21 is distributed both in the cytoplasm and the nucleus. Upon exposure to deguelin there was almost no basal Akt activity, p21 disappeared from the cytoplasm and was detected only at the nuclear level. Previous studies suggest that the PI3K/Akt pathway can influence cell growth by delaying the onset of p53-induced apoptosis (27) as Akt, via IKK, induces nuclear translocation of the survival protein NF-{kappa}B and targets the tumor suppressor gene p53 for degradation by the proteasome (39). Moreover PI3K/Akt inhibitors up-regulate p53 and block tumor-induced angiogenesis by acting on the tumor and endothelial compartment as well (40). In this context, the tumor suppressor protein p53 can induce either growth arrest or apoptosis and the blockade of the Akt pathway, through enhanced expression of p53, can increase the cytotoxic effect of DNA-damaging drugs in tumor cells (41). In normal cells, such as endothelial cells, the p53-induced G1 cell-cycle arrest is also mediated by its down-stream target p21 (42,43) as p53 binding in vivo to consensus sites in the p21 promoter was described previously (44). The strong increase in nuclear p53 protein we observed after deguelin treatment, likely due to Akt inactivation, could also contribute to up-regulation of the p21 protein.

A productive angiogenic response must couple to the survival machinery of endothelial cells to preserve the integrity of newly formed vessels. Activation of the survival serine-threonine kinase Akt and NF-{kappa}B are associated with up-regulation of the apoptosis inhibitor survivin as seen in many tumors (45). Survivin plays an important role in cell-cycle control (45), protects endothelial cells from the death-inducing stimuli (28) and its up-regulation, by preserving the microtubule network, has been proposed as a mechanism for endothelial cell drug ‘resistance’ (46). Tumor cell survivin expression has been correlated with angiogenic potential, here we extend this observation to endothelial cells, as previously suggested (36). Survivin is up-regulated in endothelial cells in response to VEGF (46,47) and survivin vaccination has been found to inhibit angiogenesis (48), suggesting a direct role for survivin in angiogenesis. As the human SURVIVIN gene is negatively regulated by wild-type p53 (49) at both mRNA and protein levels, the decreased NF-{kappa}B and Akt activities associated with p53 induction we observed in deguelin-treated endothelial cells may explain the almost complete disappearance of survivin mRNA and protein. The down-regulation of survivin by deguelin was not associated with increased endothelial cell death, but actually seemed to protect endothelial cells from apoptosis. This is similar to that observed for other angioprevention agents that also act on NF-{kappa}B (50), such as NAC (51) and epigallocatechingallate (EGCG) (52). Similarly, EGCG is known to induce tumor cell apoptosis, but to spare normal cells, the mechanism of this phenomenon appears to be related to the ‘oncogene addiction’ paradigm, where transformed cells show increased sensitivity to agents interrupting signal transduction as compared with normal cells (53).

While NF-{kappa}B activity correlates with angiogenesis (54), its blockade is associated with suppression of angiogenesis (31). The NF-{kappa}B family of transcription factors, besides participating in the regulation of numerous genes required for cell growth, survival and invasion, is also a pro-inflammatory transcription factor that could promote tumorigenesis (55). Inflammation-dependent angiogenesis appears to be a central force in tumor growth and expansion (56) a concept reinforced by evidence that inflammation inhibition prevents angiogenesis (56). In our model system, endothelial cells exposed to deguelin showed decreased levels of activated NF-{kappa}B as compared with control cells, but, even more interestingly deguelin was able to counteract the effects of the pro-inflammatory cytokine TNF-{alpha} by inhibiting I{kappa}B{alpha} and p65 phosphorylation and therefore NF-{kappa}B nuclear translocation. These data indicate that deguelin interferes with signaling events at or up-stream of I{kappa}B{alpha} and that it may also harbor anti-inflammatory activities. These observations are further strengthened by the inhibition of in vivo angiogenesis generated by TNF-{alpha}. Together with the histological analyses these data suggest deguelin has anti-inflammatory properties as well. Interestingly, it has also been associated with inhibition of COX-2 expression (10), further suggesting repression of angiogenesis (57) and inflammation.

Angiogenesis is also associated with expression of IL-8 (58,59). Since IL-8 is transcriptionally regulated by NF-{kappa}B and inhibited by deguelin, one mechanism whereby deguelin may function as an anti-angiogenic factor is through the suppression of NF-{kappa}B regulated expression of IL-8 and potentially other angiogenic factors. Besides being a pro-angiogenic agent, IL-8 has been identified as a modulator of collagenase secretion (60) and IL-8 decreased secretion could also explain the decreased MMP-2 production that may contribute to reduced invasion upon deguelin treatment.

In summary, the pleiotropic anti-angiogenic effects of deguelin observed in vivo involve growth inhibition associated with cell-cycle arrest and reduced cell migration and invasion of endothelial cells. The associated molecular events are down-regulation of the Akt and NF-{kappa}B survival signaling pathways, as shown in Figure 7, resulting in modulation of key regulators including p21, p53 and survivin. Deguelin has been proposed as a chemopreventive agent in skin (5) and lung (4) carcinogenesis. Its anti-angiogenic properties documented here suggest that this rotenoid could be a broad spectrum chemopreventive compound since angiogenesis is necessary for progression in the majority of tumors, and provide a rationale for possible use of deguelin as an angiopreventive/anti-angiogenic molecule.


Figure 7
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7 Model of deguelin activities. Cell proliferation, angiogenesis/inflammation, invasion and migration are mediated by Akt/NF-{kappa}B signaling in endothelial cells. The constitutive activation of AKT (left side), along with other signals, induces the constitutive activation of NF-{kappa}B. Deguelin (right side), by repressing the AKT and NF-{kappa}B pathways, showed pleiotropic anti-angiogenic effects. Activation of each of the components is indicated in boldface.

 

    Footnotes
 
{dagger}These authors contributed equally to this work. Back


    Acknowledgments
 
We thank Dr U. Pfeffer for helpful discussion, A. Rapetti for administrative assistance and T. Baffi for data management. This work was supported by grants from the Associazione Italiana per la Ricerca sul Cancro, Istituto Superiore di Sanità Progetto AIDS, Ministero della Salute Progetto Finalizzato, Ministero dell'Istruzione, dell'Università e della Ricerca Progetto Strategico and Progetto Fondo per gli Investimenti della Ricerca di Base and the Compagnia di San Paolo. C. Ambrosini is a FIRC fellowship recipient.

Conflict of Interest Statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Kelloff G.J., Crowell J.A., Steele V.E., et al. (2000) Progress in cancer chemoprevention: development of diet-derived chemopreventive agents. J. Nutr. 130:467S–471S.
  2. Pezzuto J.M. (1997) Plant-derived anticancer agents. Biochem. Pharmacol. 53:121–133.[CrossRef][Web of Science][Medline]
  3. Gerhauser C., Mar W., Lee S.K., Suh N., Luo Y., Kosmeder J., Luyengi L., Fong H.H., Kinghorn A.D., Moriarty R.M., et al. (1995) Rotenoids mediate potent cancer chemopreventive activity through transcriptional regulation of ornithine decarboxylase. Nat. Med. 1:260–266.[CrossRef][Web of Science][Medline]
  4. Lee H.Y., Oh S.H., Woo J.K., et al. (2005) Chemopreventive effects of deguelin, a novel Akt inhibitor, on tobacco-induced lung tumorigenesis. J. Natl Cancer Inst. 97:1695–1699.[Abstract/Free Full Text]
  5. Udeani G.O., Gerhauser C., Thomas C.F., Moon R.C., Kosmeder J.W., Kinghorn A.D., Moriarty R.M., Pezzuto J.M. (1997) Cancer chemopreventive activity mediated by deguelin, a naturally occurring rotenoid. Cancer Res. 57:3424–3428.[Abstract/Free Full Text]
  6. Murillo G., Kosmeder J.W. II, Pezzuto J.M., Mehta R.G. (2003) Deguelin suppresses the formation of carcinogen-induced aberrant crypt foci in the colon of CF-1 mice. Int. J. Cancer 104:7–11.[CrossRef][Web of Science][Medline]
  7. Gerhauser C., Lee S.K., Kosmeder J.W., Moriarty R.M., Hamel E., Mehta R.G., Moon R.C., Pezzuto J.M. (1997) Regulation of ornithine decarboxylase induction by deguelin, a natural product cancer chemopreventive agent. Cancer Res. 57:3429–3435.[Abstract/Free Full Text]
  8. Murillo G., Salti G.I., Kosmeder J.W. II, Pezzuto J.M., Mehta R.G. (2002) Deguelin inhibits the growth of colon cancer cells through the induction of apoptosis and cell cycle arrest. Eur. J. Cancer 38:2446–2454.[CrossRef][Web of Science][Medline]
  9. Hail N. Jr and Lotan R. (2004) Apoptosis induction by the natural product cancer chemopreventive agent deguelin is mediated through the inhibition of mitochondrial bioenergetics. Apoptosis 9:437–447.[CrossRef][Web of Science][Medline]
  10. Lee H.Y., Suh Y.A., Kosmeder J.W., Pezzuto J.M., Hong W.K., Kurie J.M. (2004) Deguelin-induced inhibition of cyclooxygenase-2 expression in human bronchial epithelial cells. Clin. Cancer Res. 10:1074–1079.[Abstract/Free Full Text]
  11. Chun K.H., Kosmeder J.W. II, Sun S., Pezzuto J.M., Lotan R., Hong W.K., Lee H.Y. (2003) Effects of deguelin on the phosphatidylinositol 3-kinase/Akt pathway and apoptosis in premalignant human bronchial epithelial cells. J. Natl Cancer Inst. 95:291–302.[Abstract/Free Full Text]
  12. Tosetti F., Ferrari N., De Flora S., Albini A. (2002) ‘Angioprevention’: angiogenesis is a common and key target for cancer chemopreventive agents. FASEB J. 16:2–14.[Abstract/Free Full Text]
  13. Jones M.K., Wang H., Peskar B.M., Levin E., Itani R.M., Sarfeh I.J., Tarnawski A.S. (1999) Inhibition of angiogenesis by nonsteroidal anti-inflammatory drugs: insight into mechanisms and implications for cancer growth and ulcer healing. Nat. Med. 5:1418–1423.[CrossRef][Web of Science][Medline]
  14. Cai T., Fassina G., Morini M., Aluigi M., Masiello L., Fontanini G., D'Agostini F., DeFlora S., Noonan D., Albini A. (1999) N-acetylcysteine inhibits endothelial cell invasion and angiogenesis. Lab. Invest. 79:1151–1159.[Web of Science][Medline]
  15. Garbisa S., Biggin S., Cavallarin N., Sartor L., Benelli R., Albini A. (1999) Tumor invasion: molecular shears blunted by green tea. Nat. Med. 5:1216.[CrossRef][Web of Science][Medline]
  16. Pages G., Milanini J., Richard D.E., Berra E., Gothie E., Vinals F., Pouyssegur J. (2000) Signaling angiogenesis via p42/p44 MAP kinase cascade. Ann. NY Acad. Sci. 902:187–200.[CrossRef][Web of Science][Medline]
  17. Shiojima I. and Walsh K. (2002) Role of Akt signaling in vascular homeostasis and angiogenesis. Circ. Res. 90:1243–1250.[Abstract/Free Full Text]
  18. Ackah E., Yu J., Zoellner S., et al. (2005) Akt1/protein kinase Balpha is critical for ischemic and VEGF-mediated angiogenesis. J. Clin. Invest. 115:2119–2127.[CrossRef][Web of Science][Medline]
  19. Chen J., Somanath P.R., Razorenova O., Chen W.S., Hay N., Bornstein P., Byzova T.V. (2005) Akt1 regulates pathological angiogenesis, vascular maturation and permeability in vivo. Nat. Med. 11:1188–1196.[CrossRef][Web of Science][Medline]
  20. Albini A., Dell'eva R., Vene R., Ferrari N., Buhler D.R., Noonan D.M., Fassina G. (2005) Mechanisms of the antiangiogenic activity by the hop flavonoid xanthohumol: NF-{kappa}B and Akt as targets. FASEB J. 20:527–529.
  21. Albini A., Paglieri I., Orengo G., et al. (1997) The beta-core fragment of human Chorionic Gonadotrophin (hCG) inhibits growth of Kaposi's sarcoma-derived cells and a new immortalized Kaposi's sarcoma cell line. AIDS 11:713–721.[CrossRef][Web of Science][Medline]
  22. Albini A., Iwamoto Y., Kleinman H.K., Martin G.R., Aaronson S.A., Kozlowski J.M., McEwan R.N. (1987) A rapid in vitro assay for quantitating the invasive potential of tumor cells. Cancer Res. 47:3239–3245.[Abstract/Free Full Text]
  23. Albini A., D'Agostini F., Giunciuglio D., Paglieri I., Balansky R.M., De Flora S. (1995) Inhibition of invasion, gelatinase activity, tumor take and metastasis of malignant cells by N-acetylcysteine. Int. J. Cancer 61:121–129.[Web of Science][Medline]
  24. Albini A., Fontanini G., Masiello L., Tacchetti C., Bigini D., Luzzi P., Noonan D.M., Stetler-Stevenson W.G. (1994) Angiogenic potential in vivo by Kaposi sarcoma cell-free supernatants and HIV1-tat product: inhibition of KS-like lesions by TIMP-2. AIDS 8:1237–1244.[Web of Science][Medline]
  25. Muller P.Y., Janovjak H., Miserez A.R., Dobbie Z. (2002) Processing of gene expression data generated by quantitative real-time RT–PCR. Biotechniques 32:1372–1374 1376, 1378–1379.[Web of Science][Medline]
  26. Harper J.W., Adami G.R., Wei N., Keyomarsi K., Elledge S.J. (1993) The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805–816.[CrossRef][Web of Science][Medline]
  27. Kumar R. and Hung M.C. (2005) Signaling intricacies take center stage in cancer cells. Cancer Res. 65:2511–2515.[Abstract/Free Full Text]
  28. Papapetropoulos A., Fulton D., Mahboubi K., Kalb R.G., O'Connor D.S., Li F., Altieri D.C., Sessa W.C. (2000) Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway. J. Biol. Chem. 275:9102–9105.[Abstract/Free Full Text]
  29. Ozes O.N., Mayo L.D., Gustin J.A., Pfeffer S.R., Pfeffer L.M., Donner D.B. (1999) NF-kappaB activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature 401:82–85.[CrossRef][Medline]
  30. Jeong S.J., Pise-Masison C.A., Radonovich M.F., Park H.U., Brady J.N. (2005) Activated AKT regulates NF-kappaB activation, p53 inhibition and cell survival in HTLV-1-transformed cells. Oncogene 24:6719–6728.[CrossRef][Web of Science][Medline]
  31. Huang S., Pettaway C.A., Uehara H., Bucana C.D., Fidler I.J. (2001) Blockade of NF-kappaB activity in human prostate cancer cells is associated with suppression of angiogenesis, invasion, and metastasis. Oncogene 20:4188–4197.[CrossRef][Web of Science][Medline]
  32. Li A., Dubey S., Varney M.L., Dave B.J., Singh R.K. (2003) IL-8 directly enhanced endothelial cell survival, proliferation, and matrix metalloproteinases production and regulated angiogenesis. J. Immunol. 170:3369–3376.[Abstract/Free Full Text]
  33. Toker A. and Cantley L.C. (1997) Signalling through the lipid products of phosphoinositide-3-OH kinase. Nature 387:673–676.[CrossRef][Medline]
  34. Jiang B.H., Zheng J.Z., Aoki M., Vogt P.K. (2000) Phosphatidylinositol 3-kinase signaling mediates angiogenesis and expression of vascular endothelial growth factor in endothelial cells. Proc. Natl Acad. Sci. USA 97:1749–1753.[Abstract/Free Full Text]
  35. Romashkova J.A. and Makarov S.S. (1999) NF-kappaB is a target of AKT in anti-apoptotic PDGF signalling. Nature 401:86–90.[CrossRef][Medline]
  36. Singh R.P., Dhanalakshmi S., Agarwal C., Agarwal R. (2005) Silibinin strongly inhibits growth and survival of human endothelial cells via cell cycle arrest and downregulation of survivin, Akt and NF-kappaB: implications for angioprevention and antiangiogenic therapy. Oncogene 24:1188–1202.[CrossRef][Web of Science][Medline]
  37. Vivanco I. and Sawyers C.L. (2002) The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat. Rev. Cancer 2:489–501.[CrossRef][Web of Science][Medline]
  38. Zhou B.P., Liao Y., Xia W., Spohn B., Lee M.H., Hung M.C. (2001) Cytoplasmic localization of p21Cip1/WAF1 by Akt-induced phosphorylation in HER-2/neu-overexpressing cells. Nat. Cell Biol. 3:245–252.[CrossRef][Web of Science][Medline]
  39. Mayo L.D. and Donner D.B. (2001) A phosphatidylinositol 3-kinase/Akt pathway promotes translocation of Mdm2 from the cytoplasm to the nucleus. Proc. Natl Acad. Sci. USA 98:11598–11603.[Abstract/Free Full Text]
  40. Su J.D., Mayo L.D., Donner D.B., Durden D.L. (2003) PTEN and phosphatidylinositol 3'-kinase inhibitors up-regulate p53 and block tumor-induced angiogenesis: evidence for an effect on the tumor and endothelial compartment. Cancer Res. 63:3585–3592.[Abstract/Free Full Text]
  41. Zhou B.P., Liao Y., Xia W., Zou Y., Spohn B., Hung M.C. (2001) HER-2/neu induces p53 ubiquitination via Akt-mediated MDM2 phosphorylation. Nat. Cell Biol 3:973–982.[CrossRef][Web of Science][Medline]
  42. el-Deiry W.S., Harper J.W., O'Connor P.M., et al. (1994) WAF1/CIP1 is induced in p53-mediated G1 arrest and apoptosis. Cancer Res. 54:1169–1174.[Abstract/Free Full Text]
  43. el-Deiry W.S., Tokino T., Velculescu V.E., Levy D.B., Parsons R., Trent J.M., Lin D., Mercer W.E., Kinzler K.W., Vogelstein B. (1993) WAF1, a potential mediator of p53 tumor suppression. Cell 75:817–825.[CrossRef][Web of Science][Medline]
  44. Szak S.T., Mays D., Pietenpol J.A. (2001) Kinetics of p53 binding to promoter sites in vivo. Mol. Cell. Biol. 21:3375–3386.[Abstract/Free Full Text]
  45. Reed J.C. (2001) The Survivin saga goes in vivo. J. Clin. Invest. 108:965–969.[Web of Science][Medline]
  46. Tran J., Master Z., Yu J.L., Rak J., Dumont D.J., Kerbel R.S. (2002) A role for survivin in chemoresistance of endothelial cells mediated by VEGF. Proc. Natl Acad. Sci. USA 99:4349–4354.[Abstract/Free Full Text]
  47. O'Connor D.S., Schechner J.S., Adida C., Mesri M., Rothermel A.L., Li F., Nath A.K., Pober J.S., Altieri D.C. (2000) Control of apoptosis during angiogenesis by survivin expression in endothelial cells. Am. J. Pathol. 156:393–398.[Abstract/Free Full Text]
  48. Xiang R., Mizutani N., Luo Y., Chiodoni C., Zhou H., Mizutani M., Ba Y., Becker J.C., Reisfeld R.A. (2005) A DNA vaccine targeting survivin combines apoptosis with suppression of angiogenesis in lung tumor eradication. Cancer Res. 65:553–561.[Abstract/Free Full Text]
  49. Mirza A., McGuirk M., Hockenberry T.N., et al. (2002) Human survivin is negatively regulated by wild-type p53 and participates in p53-dependent apoptotic pathway. Oncogene 21:2613–2622.[CrossRef][Web of Science][Medline]
  50. Pfeffer U., Ferrari N., Dell'eva R., Indraccolo S., Morini M., Noonan D.M., Albini A. (2005) Molecular mechanisms of action of angiopreventive anti-oxidants on endothelial cells: microarray gene expression analyses. Mutat. Res. 591:198–211.[Web of Science][Medline]
  51. Aluigi M.G., De Flora S., D'Agostini F., Albini A., Fassina G. (2000) Antiapoptotic and antigenotoxic effects of N-acetylcysteine in human cells of endothelial origin. Anticancer Res 20:3183–3187.[Web of Science][Medline]
  52. Fassina G., Vene R., Morini M., Minghelli S., Benelli R., Noonan D.M., Albini A. (2004) Mechanisms of inhibition of tumor angiogenesis and vascular tumor growth by epigallocatechin-3-gallate. Clin. Cancer Res. 10:4865–4873.[Abstract/Free Full Text]
  53. Troussard A.A., McDonald P.C., Wederell E.D., et al. (2006) Preferential dependence of breast cancer cells versus normal cells on integrin-linked kinase for protein kinase B/Akt activation and cell survival. Cancer Res. 66:393–403.[Abstract/Free Full Text]
  54. Huang S., DeGuzman A., Bucana C.D., Fidler I.J. (2000) Nuclear factor-kappaB activity correlates with growth, angiogenesis, and metastasis of human melanoma cells in nude mice. Clin. Cancer Res. 6:2573–2581.[Abstract/Free Full Text]
  55. Aggarwal B.B. (2004) Nuclear factor-kappaB: the enemy within. Cancer Cell 6:203–208.[CrossRef][Web of Science][Medline]
  56. Albini A., Tosetti F., Benelli R., Noonan D.M. (2005) Tumor inflammatory angiogenesis and its chemoprevention. Cancer Res. 65:10637–10641.[Abstract/Free Full Text]
  57. Albini A. and Noonan D.M. (2005) Rescuing COX-2 inhibitors from the waste bin. J. Natl. Cancer Inst. 97:859–860.[Free Full Text]
  58. Yoshida S., Ono M., Shono T., Izumi H., Ishibashi T., Suzuki H., Kuwano M. (1997) Involvement of interleukin-8, vascular endothelial growth factor, and basic fibroblast growth factor in tumor necrosis factor alpha-dependent angiogenesis. Mol. Cell. Biol. 17:4015–4023.[Abstract]
  59. Koch A.E., Polverini P.J., Kunkel S.L., Harlow L.A., DiPietro L.A., Elner V.M., Elner S.G., Strieter R.M. (1992) Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science 258:1798–1801.[Abstract/Free Full Text]
  60. Luca M., Huang S., Gershenwald J.E., Singh R.K., Reich R., Bar-Eli M. (1997) Expression of interleukin-8 by human melanoma cells up-regulates MMP-2 activity and increases tumor growth and metastasis. Am. J. Pathol. 151:1105–1113.[Abstract]
Received February 1, 2006; revised July 25, 2006; accepted August 13, 2006.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
J. A. Crowell, V. E. Steele, and J. R. Fay
Targeting the AKT protein kinase for cancer chemoprevention
Mol. Cancer Ther., August 1, 2007; 6(8): 2139 - 2148.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Albini, D. M. Noonan, and N. Ferrari
Molecular Pathways for Cancer Angioprevention
Clin. Cancer Res., August 1, 2007; 13(15): 4320 - 4325.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/2/404    most recent
bgl162v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Dell'Eva, R.
Right arrow Articles by Ferrari, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dell'Eva, R.
Right arrow Articles by Ferrari, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?