Skip Navigation


Carcinogenesis Advance Access originally published online on October 19, 2006
Carcinogenesis 2007 28(2):497-505; doi:10.1093/carcin/bgl179
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/2/497    most recent
bgl179v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Fritz, W. A.
Right arrow Articles by Peterson, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fritz, W. A.
Right arrow Articles by Peterson, R. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

The aryl hydrocarbon receptor inhibits prostate carcinogenesis in TRAMP mice

Wayne A. Fritz1, Tien-Min Lin1, Robert D. Cardiff3 and Richard E. Peterson1,2,*

1 School of Pharmacy, Molecular and Environmental Toxicology Center, University of Wisconsin Madison, WI, USA
2 Molecular and Environmental Toxicology Center, University of Wisconsin Madison, WI, USA
3 Center for Comparative Medicine, University of California Davis Davis, CA, USA

*To whom correspondence should be addressed at: The School of Pharmacy, University of Wisconsin, 777 Highland Avenue, Madison, WI 53705, USA. Tel: +1 608 263 5453; Fax: +1 608 265 3316; Email: repeterson{at}pharmacy.wisc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The aryl hydrocarbon receptor (AhR) is a transcription factor that mediates the inhibitory effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on prostate growth and also modulates normal prostate development. This is evidenced by AhR null mice (Ahr–/–) having smaller dorsolateral and anterior prostates, even though all prostate lobes remain histologically normal. To test the hypothesis that loss of the AhR increases the rate of prostate carcinogenesis, the incidence of macroscopic prostate tumors was determined in Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J transgenic adenocarcinoma of the mouse prostate (TRAMP) mice at 35, 70, 105, 140, 175 and 210 days of age. From 140 days, prostate tumor incidence was greater in Ahr–/– (60%) and Ahr+/– (43%) mice than in Ahr+/+ mice (16%). Allele quantification did not indicate a loss of the wild-type Ahr allele in heterozygous TRAMP tumors, suggesting that tumor formation in these mice was not due to a loss of Ahr heterozygosity. Prostatic SV40 large T antigen mRNA expression and protein localization were comparable in TRAMP mice of each Ahr genotype. Prostates from all mice of each Ahr genotype were histologically indistinguishable, exhibiting diffuse epithelial hyperplasia by 105 days of age. mRNA expression and protein localization for molecular markers of neuroendocrine differentiation, including chromogranin A and neuropilin-1, were elevated in prostate tumors compared to tumor-free ventral prostates, regardless of Ahr genotype or age. Taken together, these results demonstrate that the Ahr inhibits prostate carcinogenesis in C57BL/6J TRAMP mice by interfering with neuroendocrine differentiation.

Abbreviations: AhR, aryl hydrocarbon receptor; AR, androgen receptor; ARNT, AhR nuclear translocator; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Male reproductive tract development is disrupted by in utero and lactational exposure to the aryl hydrocarbon receptor (AhR) agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD; 1,2). Ventral, dorsolateral and anterior prostate development in the mouse is inhibited in a lobe-dependent manner by in utero and lactational TCDD exposure (38). This response results from lobe-specific inhibition of both prenatal epithelial bud formation from the prostate anlage, the urogenital sinus (9) and postnatal ductal branching morphogenesis (8).

TCDD binds to the AhR, a basic helix–loop–helix/Per–Arnt–Sim ligand-activated transcription factor that is bound in the cytoplasm to two 90 kDa heat-shock proteins (HSP) and one AhR interacting protein (10,11). The ligand/AhR complex translocates to the nucleus where the chaperone proteins dissociate and the ligand-bound AhR dimerizes with the AhR nuclear translocator (ARNT) to enhance transcription of genes containing dioxin response elements. AhR and ARNT proteins have been identified in ventral and dorsolateral lobes of the rat prostate, and cytochrome P4501A1 is induced in both lobes in response to TCDD exposure (12).

The availability of mice lacking the AhR (Ahr–/–) has permitted AhR-mediated effects of TCDD to be identified and the role of the AhR in normal development to be determined (1315). In AhR null mice, reduction in ventral, dorsolateral and anterior prostate weights caused by in utero and lactational TCDD exposure were AhR-dependent (6). Dorsolateral and anterior prostate weights in untreated AhR null mice were reduced compared with their wild-type littermates at various ages, suggesting that the AhR, in the absence of TCDD, is involved in normal development of these two prostate lobes. Serum testosterone concentrations were not altered in AhR null mice, and slight reductions in serum 5{alpha}-androstane-3{alpha},17ß-diol concentrations were unlikely responsible for the reduced dorsolateral and anterior prostate weights (6). Furthermore, prostate histology, androgen receptor (AR) mRNA levels, and androgen-dependent gene expression were not altered in AhR null mice, suggesting adequate androgen action (6). Impaired growth of the developing prostate by TCDD activation of AhR, or by absence of AhR from AhR null mice, raised the possibility that the AhR may regulate prostate carcinogenesis later, particularly if ‘reawakening’ of early prostate growth regulatory signals is involved (16).

There have been a limited number of investigations on the potential role of AhR signaling in prostate cancer. Western blot analysis identified the AhR in epithelial and stromal cells of human fetal, benign hyperplastic and malignant prostate (17), suggesting that this organ could be a target of a TCDD response in men. Recent studies have demonstrated that Vietnam veterans exposed to TCDD-contaminated Agent Orange had a greater risk of developing prostate cancer (18), although some earlier studies failed to identify an association between TCDD exposure and prostate cancer risk (19). Recently, we found that in utero and lactational TCDD exposure increases the incidence of pre-cancerous prostatic lesions in senescent C57BL/6J mice, a mouse strain not naturally susceptible to prostate cancer (20). Such results raise the possibility that AhR activation by TCDD may increase prostate cancer risk, particularly in humans and animal models susceptible to prostate carcinogenesis. However, the role of AhR in prostate carcinogenesis in the absence of exogenous ligand remains to be determined.

Development of prostate cancer in the TRAMP model provides an opportunity to investigate effects of Ahr genotype on distinct stages of mouse prostate carcinogenesis (2125). The TRAMP model utilizes the rat probasin gene promoter to drive expression of simian virus 40 (SV40) large T and small t antigens. Transgene expression under control of the androgen-dependent probasin promoter is specific to prostatic epithelium and is hormonally and developmentally regulated. TRAMP mice express the T antigen oncoprotein by 8 weeks of age and develop distinct pathology in the prostate epithelium by 10 weeks of age. Advanced stages of tumor development are characteristically AR-negative and have greater localization for markers of neuroendocrine tumors (24).

In the present study, we investigate the effect of Ahr genotype on prostate carcinogenesis in TRAMP mice. We report that prostate tumors develop with greater frequency in TRAMP mice lacking both (Ahr–/–) or one (Ahr+/–) Ahr allele compared with wild-type mice (Ahr+/+). Furthermore, we demonstrate that the tumors present in TRAMP mice of each Ahr genotype have evidence of a neuroendocrine phenotype, regardless of the age they first appear. These findings suggest that the Ahr inhibits onset of neuroendocrine prostate tumors in a gene–dosage-dependent manner in the TRAMP model.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Transgenic mice
Animal care and use were in accordance with University of Wisconsin-Madison Research Animal Care and Use Committee guidelines and the NIH Guide for the Care and Use of Laboratory Animals. C57BL/6-Tg(TRAMP)8247Ng/J mice (Stock number 003135) obtained from Dr. George Wilding (Department of Medicine, University of Wisconsin, Madison, WI) were backcrossed to C57BL/6J mice at Jackson Labs (Bar Harbor, ME) for more than 20 generations. AhR null mice (Ahr–/–), obtained from Dr Christopher Bradfield (Department of Oncology, University of Wisconsin, Madison, WI), were backcrossed to C57BL/6J mice for more than 15 generations. Mice were housed in rooms maintained at 24 ± 1°C with a 12 h light–dark cycle. Feed (5015 Mouse Diet, PMI Nutrition International, Brentwood, MO) and tap water were available ad libitum.

Female TRAMP mice heterozygous for the probasin-driven SV40 T antigen were bred with C57BL/6J Ahr–/– males to prepare breeders necessary to generate experimental animals. Adult heterozygous F1 offspring (Ahr+/– TRAMP+/–) were interbred to obtain Ahr+/– TRAMP+/+ mice. Experimental males that were TRAMP+/– and either Ahr+/+, Ahr+/–, or Ahr–/– were generated by mating Ahr+/– TRAMP+/+ males with Ahr+/– TRAMP–/– females.

Ahr genotype was determined by PCR analysis of ear punch DNA from (26). TRAMP genotyping measured transgene DNA by quantitative real-time LightCycler (Roche Molecular Biochemicals, Indianapolis, IN) PCR using primers described previously (21) and cytokeratin 8 primers as the loading control (6).

Tissue preparation and histology
TRAMP mice of each Ahr genotype were necropsied at 35, 70, 105, 140, 175 and 210 days of age to determine the incidence of macroscopic prostate tumors. Where tumor burden required euthanasia prior to scheduled termination, mice were included in the predetermined age group for analysis. A macroscopic tumor was characterized as any mass visible at the time of necropsy, and confirmed using a dissecting microscope, if necessary. To minimize genetic diversity, littermates of each Ahr genotype were necropsied at different ages. All prostate lobes and prostate tumors were removed and weighed. One lobe of the dorsolateral and ventral prostate or one-half of a bisected prostate tumor was frozen in liquid nitrogen for RT–PCR evaluation of gene expression. The other dorsolateral and ventral lobe or the other half of the bisected prostate tumor was fixed overnight in Bouin's, paraffin-embedded, sectioned (5 µm), and processed for histological analysis by light microscopy according to criteria previously described (27).

Quantification of wild-type Ahr allele in heterozygous TRAMP prostate tumors
To determine if tumors in heterozygous TRAMP mice were due to loss of heterozygosity, specifically resulting from loss of the wild-type Ahr allele, prostate tumors from Ahr+/+, Ahr+/– and Ahr–/– mice were processed as previously described for ear punch samples (26). Quantitative analysis of wild-type and knockout alleles was determined by real-time LightCycler PCR. PCR reactions (6) using Ahr (AGTAAAGCCCATCCCCGCTG and ATCAAAGAAGCTCTTGGCCC, respectively) and neomycin for Ahr null (TTGGGTGGAGAGGCTATTCG and AGGTGAGATGACAGGAGATC, respectively), primers were denatured at 94°C for 30 s, then amplified for 40 three-step cycles (94°C for 0 s hold melting, 65°C annealing for 5 s, and 72°C for 10 s extension). Double-stranded fluorescent product was detected at the end of each cycle and abundance of each allele was derived from the respective crossing point using LightCycler software. Product specificity was determined by comparison of melting curves, and the ratio of wild-type Ahr allele relative to Ahr null allele was calculated for each sample.

Immunohistochemistry
Large T antigen immunohistochemistry was carried out on deparaffinized and rehydrated tissue sections (5 µm). Boiling citric acid antigen retrieval preceded peroxide quenching of endogenous peroxidase activity. Mouse monoclonal SV40 large T antigen (Santa Cruz Biotechnology, Santa Cruz, CA) staining utilized the M.O.M. kit (Vector Laboratories, Burlingame, CA). Chromogranin A (Zymed, San Francisco, CA) non-specific binding was blocked with non-immunized goat serum. Horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (Vector Laboratories, Burlingame, CA) preceded streptavidin-peroxidase incubation (Dako). Primary antibodies were incubated overnight at 4°C in a humidity chamber, and color developed using NOVA-Red chromagen (Vector Laboratories). Slides were photographed using a Nikon D50 digital camera mounted on a Nikon Eclipse TE300 Microscope.

Real-time reverse transcription PCR mRNA quantification
mRNA expression was determined for dorsolateral prostates, ventral prostates, and prostate tumors collected during the time-course study. Chromogranin A and neuropilin-1 mRNA identified neuroendocrine differentiation and SV40 T antigen mRNA was determined to quantify transgene expression. PCR reagents and conditions were carried out as described for Ahr allele quantification, utilizing cDNA (6) and the following primer pairs: cyclophilin: ATCACGGCCGATGACGAGCC, TCTCTCCGTAGATGGACCTGC; SV40 T antigen: AGAGCAGAATTGTGCAGTGG, TGGGACTGTGAATCAATGCC; chromogranin A: TTCAAGGCCAGACTGCTGC, AATAGTCAGGAGTTCTCGGC; neuropilin-1: TGCTTTCACTGTAAGCTGGG, TGAAGTCAGTCACACTTGGTC, AR: AATCTGGATGTGGAGAGAGC, AGAGAACAGAACACTAGCGC. Serially-diluted standards of known concentrations (6) and unknown cDNA samples were amplified simultaneously using the same reaction mixture. mRNA abundance for each gene of interest was expressed relative to that of cyclophilin.

Western blot analysis
Frozen prostate or prostate tumors were homogenized in lysis buffer containing 0.1% Triton X-100 and protease inhibitors using a Tissumizer homogenizer (Tekmar, Cincinnati, OH). Protein concentrations were determined using the Pierce BCA kit (South San Francisco, CA). The extracts were boiled in sample buffer containing 10% ß-mercaptoethanol and 10% SDS and 40 µg of protein from each sample was separated on SDS polyacrylamide gels. Proteins were transferred to a hybond membrane (Amersham Biosciences, Piscataway, NJ) on a semi-dry blotting unit (Fisher Scientific, Pittsburgh, PA). Non-specific antibody binding was blocked by 5% non-fat dry milk in TBST. Antibodies for AR (Santa Cruz Biotechnology, Inc, Santa Cruz, CA diluted 1:5000) and ß-actin (Cell Signaling Technology, Beverly, MA) in TBST containing 3% non-fat dry milk were incubated overnight at 4°C. Membranes were washed with TBST prior to incubation with HRP-conjugated secondary antibody (Zymed, 1:1500) in blocking buffer. Membranes were washed with TBST, and bands detected using hyperfilm exposed to chemiluminescent substrate (Pierce). Band intensity was determined using ImageQuant TL software (Amersham Biosciences). AR protein levels were expressed relative to ß-actin protein levels for each sample.

Statistical Analysis
Statistical analysis was conducted with the litter as the experimental unit. Analysis of variance (ANOVA) was conducted on parametric data that passed Levene's test for homogeneity of variance and were normally distributed. If a significant effect was found, the least significant difference test was used to determine which group(s) differed from the appropriate control group. Incidence data were analyzed by the row x column Chi-squared test, followed by Fisher's exact test. Significance was set at P < 0.05 for all tests.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Body weights in Ahr+/+, Ahr+/– and Ahr–/– TRAMP mice
TRAMP mice of each Ahr genotype gained weight throughout the 210-day study (results not shown). There were no AhR-dependent alterations in body weights at any age.

Macroscopic prostate tumor incidence in Ahr+/+, Ahr+/– and Ahr–/– TRAMP mice
TRAMP mice were examined at 35-day intervals from 35 to 210 days of age to determine the effect of Ahr genotype on the incidence of macroscopic prostate tumors (Figure 1). A prostate tumor was characterized as a malignant mass visually observed in the prostate using a dissecting microscope at the time of necropsy. One small prostate tumor was detected at 70 days of age in an Ahr+/– mouse. By 105 days of age, prostate tumors were detected in at least one mouse of each Ahr genotype. Approximately 10% of Ahr+/+ and Ahr+/– mice had prostate tumors, while tumor incidence was 20% in Ahr–/– mice. By day 140, prostate tumor incidence was significantly greater in Ahr+/– and Ahr–/– mice than in Ahr+/+ mice. Greater tumor incidence was observed for Ahr+/– and Ahr–/– mice up to 210 days of age, the latest time investigated. Ahr+/+ mice never developed greater than a 16% tumor incidence at any age investigated. However, prostate tumor incidence in Ahr+/– mice approached 50% by 175 days, while 60% of Ahr–/– mice developed prostate tumors at this age. Tumor burden did not necessitate premature euthanasia of any Ahr+/+ mice, while three (8%) of Ahr+/– mice in the 210-day group were euthanized early. For Ahr–/– mice, however, early euthanasia was necessary for 4 (19%) mice at 140 days, 3 (17%) mice at 175 days and 10 (77%) mice at 210 days. When present, prostate tumor weights were not significantly different in mice of any Ahr genotype at any of the ages investigated (results not shown), despite the greater tumor incidence observed in Ahr+/– and Ahr–/– mice.


Figure 1
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 AhR protection against prostate tumor development in TRAMP mice. The percentage of Ahr+/+, Ahr+/–, and Ahr–/– C57BL/6J TRAMP mice with macroscopic prostate tumors was determined at 35 day intervals from 35–210 days of age. Chi-square analysis demonstrated a significant increase in prostate tumor incidence in TRAMP mice of certain Ahr genotypes at 140, 175 and 210 days of age as follows: *significantly different from Ahr+/+ TRAMP mice and **significantly different from Ahr+/+ and Ahr+/– TRAMP mice (P < 0.05). The number of Ahr+/+, Ahr+/–, and Ahr–/– mice, respectively, at each age were: 35 days (20, 32 and 22), 70 days (20, 49 and 22), 105 days (14, 45 and 20), 140 days (19, 55 and 21), 175 days (19, 46 and 18) and 210 days (24, 43 and 18).

 
Ahr+/+, Ahr+/– and Ahr–/– TRAMP mouse prostate histology
Microscopic analysis of tissue sections was utilized to more precisely characterize prostate histology at 105, 140 and 175 days of age in Ahr+/+, Ahr+/– and Ahr–/– TRAMP mice. No regions of prostatic intraepithelial neoplasia were observed in TRAMP prostates at any age. However, at 105, 140 and 175 days of age, prostates from mice of all Ahr genotypes had diffuse epithelial hyperplasia characteristic of the TRAMP model, even Ahr+/+ mice that did not typically develop macroscopic tumors. There were no differences in severity of the hyperplasia in the prostate among the three Ahr genotypes when no macroscopic tumors were present.

Analysis of Ahr levels in Ahr+/– TRAMP tumors
To determine if greater protection against prostate carcinogenesis in Ahr+/+ than in Ahr+/– TRAMP mice was due to either a gene–dosage effect or due to loss of Ahr heterozygosity, specifically loss of the remaining wild-type allele, we assessed wild-type Ahr allele levels relative to null allele levels in TRAMP prostates and prostate tumors. The relative level of the Ahr wild-type allele in Ahr+/– TRAMP tumors was 50% of Ahr+/+ mouse prostates, indicating that they had not lost the Ahr allele (results not shown). This suggests that prostate tumors forming at a higher frequency in Ahr+/– TRAMP mice compared with Ahr+/+ TRAMP mice were not due to loss of Ahr heterozygosity. Thus, inhibition of prostate carcinogenesis reflected a gene–dosage effect of the Ahr.

Large T antigen expression in Ahr+/+, Ahr+/– and Ahr–/– TRAMP mice
Although a similar degree of diffuse hyperplasia was present in all TRAMP mice irrespective of Ahr genotype, it was necessary to exclude the possibility that greater tumor formation in Ahr+/– and Ahr–/– TRAMP mice was caused by greater transgene expression. Large T antigen protein, detected by immunohistochemistry, was identified in nuclei of prostate epithelial cells lining glands with and without tumors (Figure 2A). Abundant large T antigen localization was also observed in small nodules, large tumors, and lymph node metastases (results not shown). Localization was similar in prostates of all Ahr genotypes at all stages of tumor development. Also, quantitative analysis of SV40 large T antigen mRNA abundance by RT–PCR did not indicate greater expression in dorsolateral prostates of Ahr+/– and Ahr–/– TRAMP mice compared with Ahr+/+ TRAMP mice at any age (Figure 2B). Taken together, these findings demonstrate that loss of AhR in Ahr+/– and Ahr–/– TRAMP mice did not exacerbate prostatic SV40 large T antigen expression, or subsequent development of epithelial hyperplasia. Rather, it appears that greater prostate tumor incidence in mice lacking one or more Ahr allele is independent of these processes.


Figure 2
View larger version (57K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Epithelial SV40 large T antigen expression in Ahr+/+, Ahr+/– and Ahr–/– TRAMP mouse dorsolateral prostates. Immunohistochemical staining (A) and mRNA expression (B) was determined for dorsolateral prostates from C57BL/6J TRAMP mice at 35 day intervals from 35–210 days of age. SV40 large T antigen localization (dark brown) was confirmed in duplicate slides taken from at least three mice of each Ahr genotype at each age. Slides were counterstained with methyl green (blue color). Representative photomicrographs of dorsolateral prostates are shown for 140 day old C57BL/6J TRAMP mice of Ahr+/+, Ahr+/– and Ahr–/– genotype. Magnification = 20x. For RT-PCR, SV40 T antigen was expressed relative to cyclophilin. Values represent means ±SEM; n = 6.

 
Chromogranin A and neuropilin-1 mRNA expression: markers of neuroendocrine differentiation in prostate tumors
To further characterize the prostate tumors in Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP mice, we utilized real-time RT–PCR to quantitatively analyze mRNA expression of two genes indicative of neuroendocrine differentiation, chromogranin A and neuropilin-1, at 35-day intervals. Tumor-free ventral prostates had low chromogranin A mRNA expression at all ages investigated (Figure 3A). Chromogranin A expression was not altered over time in Ahr+/+ or Ahr+/– C57BL/6J TRAMP mice when no tumors were present, but expression was greater in Ahr–/– C57BL/6J TRAMP mice at 105 than 35 days of age. Chromogranin A expression was not significantly different in Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP ventral prostates without tumors at 35, 70 or 140 days of age. However, expression was significantly greater in Ahr–/– than in Ahr+/– C57BL/6J TRAMP mice at 105 days of age. For each Ahr genotype, chromogranin A expression was significantly greater in prostate tumors than in ventral prostates without tumors at both 105 and 140 days of age. Gene expression in prostate tumors did not differ between 105 and 140 days of age, and was not altered as a function of Ahr genotype. Thus, chromogranin A mRNA expression was elevated in prostate tumors compared with ventral prostates without tumors, regardless of Ahr genotype or age.


Figure 3
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Effects of Ahr genotype and age on chromogranin A (A) and neuropilin-1 (B) mRNA expression in C57BL/6J TRAMP mouse ventral prostates with and without prostate tumors. Gene expression (relative to cyclophilin) was determined in Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP mice at 35, 70, 105 and 140 days of age by quantitative RT-PCR. Values represent means ±SEM; n = 5 for ventral prostates without tumors, and n = 3 for ventral prostate tumors. *Significantly different than ventral prostates without tumors; {dagger}significantly different than 35 day Ahr–/– and 105 day Ahr+/– C57BL/6J TRAMP ventral prostates without tumors; {ddagger}significantly different than 140 day Ahr–/– C57BL/6J TRAMP ventral prostates without tumors; #significantly different than 70 day Ahr+/+ C57BL/6J TRAMP ventral prostates without tumors; §significantly different than age-matched Ahr+/+ C57BL/6J TRAMP ventral prostates without tumors. Significant differences are P < 0.05.

 
Changes in neuropilin-1 mRNA expression were similar to those observed for chromogranin A. Ventral prostates without tumors had low neuropilin-1 expression at all ages investigated (Figure 3B). When no tumors were present, neuropilin-1 expression was not altered between 35 and 140 days of age in Ahr+/– or Ahr–/– C57BL/6J TRAMP mice, but was greater in Ahr+/+ C57BL/6J TRAMP mice at 105 than 70 days of age. Neuropilin-1 expression was not significantly different between Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP ventral prostates without tumors at 35, 70, 105 or 140 days of age. Compared with ventral prostates without tumors, neuropilin-1 expression was significantly greater in prostate tumors from Ahr+/+ and Ahr+/– mice at 105 days of age, and in all Ahr genotypes at 140 days of age. Thus, neuropilin-1 mRNA expression was elevated in prostate tumors compared with tumor-free ventral prostates, with the only exception being Ahr–/– TRAMP mice at 105 days of age which were not significantly altered.

Immunohistochemical localization of the neuroendocrine differentiation marker, chromogranin A, in Ahr+/+, Ahr+/– and Ahr–/– TRAMP mice
Chromogranin A localization was investigated in paraffin-embedded prostate sections taken from 105, 140 and 175-day-old Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP mice using standard immunohistochemical techniques. Figure 4A shows hematoxylin and eosin staining of a representative prostate section with diffuse hyperplasia. In the same tissue, chromogranin A immunostaining was not detected (Figure 4B). Chromogranin A positive cells were only rarely detected in prostates without tumors, regardless of Ahr genotype.


Figure 4
View larger version (126K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Representative immunohistochemical localization of chromogranin A in C57/BL/6J TRAMP mouse prostate tumors. Localization of the neuroendocrine differentiation marker, chromogranin A, was assessed in paraffin-embedded sections of the prostate taken from 105, 140 and 175 day old Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP mice using standard immunohistochemical techniques. Histology of a representative C57BL/6J TRAMP mouse dorsolateral prostate (140 day old Ahr+/–) with diffuse hyperplasia is shown after hematoxylin and eosin staining (A). In an adjacent section of the same tissue, chromogranin A staining is absent, with only methyl green counterstain visible (B). A paraffin-embedded section of a representative prostate (140 day old Ahr+/–) tumor is shown after hematoxylin and eosin staining (C). Abundant chromogranin A immunolocalization (red staining) is shown in an adjacent section of the same prostate tumor (D). Note intense staining in tumor regions (D, arrow heads) and negative staining in epithelial cells of regions retaining glandular architecture (D, arrows). Magnification = 10x.

 
Figure 4C shows a representative macroscopic prostate tumor with predominant absence of glandular structure and only a few glands maintaining glandular structure (arrows). Abundant chromogranin A staining was observed throughout the prostate tumor (Figure 4D, arrow heads). However, no staining was observed in tumor-free regions retaining glandular architecture (arrows). Chromogranin A staining was reflective of tumor morphology and independent of both mouse age and Ahr genotype, as abundant staining was present in all Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP mouse prostate tumors.

As observed for chromogranin A, immunohistochemical localization of neuropilin-1 was also detected in prostate tumors but not tumor-free prostates (results not shown). Thus, increased expression of neuroendocrine markers is confined to prostate tumors. This suggests that the Ahr regulates onset of neuroendocrine tumors in C57BL/6J TRAMP mice.

Quantitation of AR mRNA and protein expression
To further characterize the prostate tumors in Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP mice, we compared AR status in prostates with and without tumors. AR mRNA levels were not significantly different in Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP dorsolateral prostates at 35, 70, 105 or 140 days of age (Figure 5A). At 35 days, AR expression was significantly lower in Ahr–/– C57BL/6J TRAMP mouse ventral prostates than Ahr+/+ TRAMP prostates (Figure 5A). At 105 days, AR mRNA expression was lower in Ahr+/– and Ahr–/– TRAMP mice compared with Ahr+/+ mice. AR mRNA expression did not differ in Ahr+/+, Ahr+/– and Ahr–/– TRAMP mouse ventral prostates without tumors at 70 or 140 days of age. AR expression was significantly reduced in 105 and 140 day prostate tumors from mice of all Ahr genotypes compared with tumor-free dorsolateral and ventral prostates.


Figure 5
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Effects of Ahr genotype and age on AR mRNA (A) and protein (B) expression in C57BL/6J TRAMP mouse dorsolateral and ventral prostates, and prostate tumors. Gene expression (relative to cyclophilin) was determined in Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP mice at 35, 70, 105 and 140 days of age by quantitative RT-PCR. AR protein levels were determined relative to ß-actin by western blot analysis. Panel B depicts representative bands detected at 140 days of age. Values represent means ± SEM; n = 6 for prostates without tumors, and n = 3 for ventral prostate tumors for RT-PCR analysis, and a minimum of 4 tumors for western blot analysis. *Significantly different than dorsolateral and ventral prostates without tumors; §significantly different than age-matched Ahr+/+ C57BL/6J TRAMP ventral prostates. All differences are at P < 0.05. N.D. not determined.

 
At 105 and 140 days, AR protein levels were not significantly different in Ahr+/+, Ahr+/– and Ahr–/– C57BL/6J TRAMP mouse prostates without prostate tumors (Figure 5B). However, similar to effects seen at the mRNA level, AR protein levels were significantly reduced in prostate tumors compared with tumor-free dorsolateral prostates in mice of each Ahr genotype.

Lymph node metastasis in Ahr+/+, Ahr+/– and Ahr–/– TRAMP mice
Lymph node metastases were not detected in any Ahr+/+, Ahr+/– or Ahr–/– TRAMP mice at 35, 70 or 105 days of age (Table I). On the other hand, at least one Ahr+/+, Ahr+/– and Ahr–/– TRAMP mouse had lymph node metastasis by 140 days, with differences in incidence between Ahr–/– and Ahr+/+ TRAMP mice approaching statistical significance (P = 0.0527). By 175 days, a greater percentage of Ahr+/– TRAMP mice had lymph node metastasis compared with Ahr+/+ TRAMP mice, while the slightly greater incidence in Ahr–/– TRAMP mice approached statistical significance (P = 0.07). The incidence of lymph node metastasis at 210 days was significantly greater in Ahr–/–, but not Ahr+/– TRAMP mice compared with Ahr+/+ TRAMP mice. The percentage of lymph node metastasis in only tumor-bearing mice did not differ as a function of Ahr genotype. Immunohistochemical localization of chromogranin A confirmed that all lymph node metastases were neuroendocrine in nature (results not shown).


View this table:
[in this window]
[in a new window]

 
Table I Effect of Ahr genotype on the percentage of male C57BL/6J TRAMP mice with pelvic lymph node metastasis as a function of agea

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The major finding of the present study was that malignant prostate tumors rarely develop in Ahr+/+ TRAMP on a C57BL/6J background, but the incidence is greatly increased in Ahr+/– and Ahr–/– TRAMP mice. As mice age, all prostates developed diffuse hyperplasia characteristic of the TRAMP model, but Ahr+/– and Ahr–/– TRAMP mice develop malignant prostate tumors more frequently than Ahr+/+ mice (Ahr–/– > Ahr+/– > Ahr+/+). Evidence suggests that tumors have undergone neuroendocrine differentiation, a key aspect regulated by the Ahr.

The relatively low incidence of prostate tumors in wild-type (Ahr+/+) control mice at all ages investigated was below the incidence previously reported in TRAMP studies (2123). TRAMP mice for chemoprevention studies typically cross C57BL/6J with FVB mice, greatly increasing tumor incidence. This raised the question of whether the Ahr would also inhibit prostate carcinogenesis in TRAMP mice of this genetic background. In C57BL/6J x FVB TRAMP mice, greater tumor incidence was observed in Ahr+/– (67%) mice compared with Ahr+/+ (42%) mice (W.A. Fritz, T.-M. Lin, S. Safe, R.W. Moore and R.E. Peterson, unpublished results). Unfortunately, Ahr–/– mice expected to have the greatest tumor incidence were not investigated as they were only available on a C57BL/6J background. Regardless, these results demonstrate that the Ahr also protects against prostate carcinogenesis in TRAMP mice on the more traditional genetic background (FVB x C57BL/6J) and is not a unique phenomenon in C57BL/6J TRAMP mice.

In the TRAMP model, prostate-specific transgene expression abrogates p53 and retinoblastoma protein (pRb) function, resulting in greater epithelial cell proliferation leading to prostate carcinogenesis. Despite the lower incidence of prostate tumors in Ahr+/+ C57BL/6J TRAMP mice, SV40 large T antigen mRNA abundance was not altered at any time investigated, and all mice expressed SV40 large T antigen protein in the prostate epithelium regardless of Ahr genotype. The mechanism through which the AhR inhibits the process of prostate carcinogenesis remains to be determined. Previous studies suggest that interaction between the AhR and pRb could inhibit SV40 T antigen-mediated reversal of cell cycle arrest (28). Thus, one plausible mechanism by which the AhR could inhibit prostate carcinogenesis in TRAMP mice is through direct interaction with pRb, thereby inhibiting transgene-induced circumvention of cell cycle arrest. However, interaction with pRb occurs preferentially when the AhR is ligand-bound (29). Thus, ligand exposure and subsequent nuclear translocation would be required for the AhR to inhibit cell cycle arrest through this mechanism. Furthermore, the AhR also reduced p53 transcriptional activity in human keratinocytes (30). If the AhR were to alter pRb or p53 regulation of cell cycle progression resulting in greater cell cycle arrest in Ahr+/+ than in Ahr–/– TRAMP mice, then large T antigen expression would have been incapable of producing hyperplasia observed in TRAMP mice of each Ahr genotype by 105 days of age. Thus, it appears that the AhR did not inhibit prostate tumor formation through interference with transgene expression or by inducing cell cycle arrest through direct interaction with pRb.

It has previously been demonstrated that the AhR is present in the stroma and epithelium of benign and malignant prostates (17). This suggests that the AhR could conceivably alter tumorigenesis in the TRAMP model through direct signaling regulation within the epithelium, or by indirect regulation of epithelial growth mediated by the stroma. However, it remains to be demonstrated if stromal or epithelial AhR are required for inhibition of prostate tumorigenesis, or if localization to both cell populations is essential.

Inactivation of AhR signaling in Ahr–/– mouse prostates was confirmed by demonstrating that they were no longer susceptible to ventral prostate agenesis and reduced dorsolateral prostate weights following TCDD exposure (6). However, there is limited evidence that could account for morphological alterations observed in untreated Ahr–/– mouse prostates (6). It was noted that macroscopic tumors in our TRAMP mice developed a neuroendocrine phenotype, and it is likely that this process was what was regulated by the AhR. Neuroendocrine differentiation has been previously identified in TRAMP mice (24) and other transgenic mouse models of prostate cancer (31), and it is believed that rapid onset of neuroendocrine tumors occurs in an androgen-insensitive stem cell population (32). This possibility is consistent with our observation that AR mRNA and protein expression were significantly reduced in the prostate tumors from each Ahr genotype. Although tumors develop from stem cells following androgen deprivation, it is uncertain how this process would selectively occur in Ahr–/– TRAMP mice that have not been castrated. Future studies will be carried out to identify the mechanisms responsible for AhR-mediated regulation of neuroendocrine differentiation in the prostate as a whole, or selectively in specific stem cell populations in TRAMP mice.

The rapid growth of prostate tumors that have undergone neuroendocrine differentiation is believed to result from loss of androgen sensitivity coupled with production of growth factors that facilitate angiogenesis (33,34). An early angiogenic switch has been described in TRAMP mouse prostates as HIF-1{alpha} levels are elevated in hyperplastic lesions prior to tumor growth (25). Sufficient elevation of HIF-1{alpha} would presumably allow greater interaction with the dimerization partner, HIF-1ß, otherwise known as ARNT, leading to greater VEGF production. Interestingly, ARNT is also a dimerization partner for the AhR (35), suggesting that competition for the same dimerization partner in mice expressing the AhR would reduce HIF-1{alpha} signaling. In this case, a greater proportion of ARNT would interact with the AhR, and would be less likely to dimerize with accumulating HIF-1{alpha}, thereby reducing VEGF production and subsequent angiogenesis necessary to support prostate tumor growth. A similar phenomenon mediates cardiac hypertrophy in AhR null mice (36), where greater HIF-1{alpha} levels were associated with a subsequent increase in VEGF mRNA abundance. However, total HIF-1{alpha} protein levels did not differ in 105 or 140-day-old Ahr+/+, Ahr+/–, or Ahr–/– TRAMP prostates without tumors, even though HIF-1{alpha} activity, characterized by VEGF production, increased between these ages (W.A. Fritz, T.-M. Lin and R.E. Peterson, unpublished results). Despite similar HIF-1{alpha} protein levels at an age when tumors are becoming more frequent, it is possible that Ahr–/– TRAMP mouse prostates are more susceptible to increasing HIF-1{alpha} activity than Ahr+/+ TRAMP prostates, resulting in greater VEGF production that facilitates progression from proliferative lesions to larger tumors. However, this possible mechanism remains to be demonstrated.

In addition to cardiac hypertrophy, AhR null mice exhibit reduced liver weights (13) associated with altered vascular development due to a patent ductus venosus (37), whereby closure of the portocaval shunt during early postnatal life fails to occur. AhR null mice also exhibit impaired immune development, evidenced by reduced lymphocyte accumulation in the spleen and lymph nodes (13). While it is uncertain how smaller livers could be causally associated with greater propensity for prostate carcinogenesis, heightened immune responses may be associated with prostate carcinogenesis (38). Because inflammatory cells commonly identified in the prostate produce oxidants capable of initiating cellular and genomic damage (39), it is unlikely that greater prostate tumor development would occur through this mechanism in AhR null mice, which would presumably have diminished immunity, rather than a heightened immune response. However, prostate-specific effects on immune responses remain to be investigated in AhR null TRAMP mice.

Alternatively, the AhR may affect prostate carcinogenesis through cross-talk with other signaling pathways, including the androgen signaling cascade (40). While castration (41) and anti-androgen (42) administration effectively reduce prostate carcinogenesis in TRAMP mice, it is unlikely that the AhR protects in this manner as circulating androgens are unaltered and androgen-dependent gene expression is maintained in AhR null mice (6). However, it remains possible that subtle perturbation of androgen signaling could have pronounced effects on prostate cancer given sufficient time to exert an effect. The AhR also can interact with estrogen receptors through cross-talk mechanisms (43,44). Although estrogenic/antiestrogenic compounds effectively inhibit prostate carcinogenesis in TRAMP mice (45,46), regulation of estrogen signaling by the AhR that would confer protection have yet to be identified in the TRAMP prostate.

In conclusion, using C57BL/6J TRAMP mice not treated with TCDD, we demonstrate that absence of AhR signaling in Ahr–/– mice results in greater prostate tumor incidence and that Ahr+/+ mice rarely develop prostate tumors. We have shown that tumors forming in our TRAMP mice from all Ahr genotypes are neuroendocrine in nature. This inhibition of prostate tumor formation by the AhR would seem to contradict the association between AhR activation by TCDD and greater risk of prostate cancer in humans and induction of pre-cancerous lesions in mice exposed to TCDD (18,20). Yet, this reflects the seemingly contradictory effects observed in developing prostates, whereby both activation of AhR signaling by TCDD and absence of the AhR in Ahr–/– mice resulted in reduced dorsolateral and anterior prostate weights (6). Thus, the physiological role of the AhR appears to reflect an intricate balance where baseline signaling is required for normal prostate development, but greater activation of the AhR by potent ligands, particularly TCDD, disrupts normal prostate development and may increase prostate cancer risk. Future studies will investigate the mechanisms through which the AhR regulates prostatic carcinogenesis, and how the AhR inhibits onset of neuroendocrine prostate tumors.


    Acknowledgments
 
Portions of this work were supported by National Cancer Institute grant CA095751 and National Institutes of Health grants ES01332 and ES12352.

Conflict of Interest Statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Roman B.L. and Peterson R.E. (1998) Developmental male reproductive toxicology of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and PCBs. In Korach K.S. (Ed.). Reproductive and Developmental Toxicology(Marcel Dekker, Inc., New York) pp. 593–624.
  2. Theobald H.M., Kimmel G.L., Peterson R.E. (2003) Developmental and reproductive toxicity of dioxins and related chemicals. In Schecter A. and Gasiewicz T.A. (Eds.). Dioxins and Health(John Wiley and Sons, Inc., New Jersey) pp. 329–431.
  3. Theobald H.M. and Peterson R.E. (1997) In utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin: effects on development of the male and female reproductive system of the mouse. Toxicol. Appl. Pharmacol. 145:124–135.[CrossRef][Web of Science][Medline]
  4. Sommer R.J. and Peterson R.E. (1997) In utero and lactational exposure of the mouse to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Effects on male reproductive tract development. Organohalogen Compd. 34:360–363.
  5. Lin T-M., Simanainen U., Rasmussen N.T., Ko K., Peterson R.E. (2001) In utero and lactational TCDD exposure in the mouse: impaired prostate development and function. Organohalogen Compd. 53:291–294.
  6. Lin T.-M., Ko K., Moore R.W., Simanainen U., Oberley T.D., Peterson R.E. (2002) Effects of aryl hydrocarbon receptor null mutation and in utero and lactational 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure on prostate and seminal vesicle development in C57BL/6 mice. Toxicol. Sci. 68:479–487.[Abstract/Free Full Text]
  7. Lin T.-M., Simanainen U., Moore R.W., Peterson R.E. (2002) Critical windows of vulnerability for effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on prostate and seminal vesicle development in C57BL/6 mice. Toxicol. Sci. 69:202–209.[Abstract/Free Full Text]
  8. Ko K., Theobald H.M., Peterson R.E. (2002) In utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin in the C57BL/6J mouse prostate: lobe-specific effects on branching morphogenesis. Toxicol. Sci. 70:227–237.[Abstract/Free Full Text]
  9. Lin T.-M., Rasmussen N.T., Moore R.W., Albrecht R.M., Peterson R.E. (2003) Region-specific inhibition of prostatic epithelial bud formation in the urogenital sinus of C57BL/6 mice exposed in utero to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol. Sci. 76:171–181.[Abstract/Free Full Text]
  10. Carlson D.B. and Perdew G.H. (2002) A dynamic role for the Ah receptor in cell signaling? Insights from a diverse group of Ah receptor interacting proteins. J. Biochem. Mol. Toxicol. 16:317–325.[CrossRef][Web of Science][Medline]
  11. Gasiewicz T.A. and Park S.-K. (2003) Ah receptor: involvement in toxic responses. In Schecter A. and Gasiewicz T.A. (Eds.). Dioxins and Health(John Wiley and Sons, Inc., New Jersey) pp. 491–532.
  12. Roman B.L., Pollenz R.S., Peterson R.E. (1998) Responsiveness of the adult male rat reproductive tract to 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure: Ah receptor and ARNT expression, CYP1A1 induction, and Ah receptor down-regulation. Toxicol. Appl. Pharmacol. 150:228–239.[CrossRef][Web of Science][Medline]
  13. Fernandez-Salguero P., Pineau T., Hilbert D.M., McPhail T., Lee S.S., Kimura S., Nebert D.W., Rudikoff S., Ward J.M., Gonzalez F.J. (1995) Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding Ah receptor. Science 268:722–726.[Abstract/Free Full Text]
  14. Schmidt J.V., Su G.H., Reddy J.K., Simon M.C., Bradfield C.A. (1996) Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc. Natl Acad. Sci. USA 93:6731–6736.[Abstract/Free Full Text]
  15. Mimura J., Yamashita K., Nakamura K., et al. (1997) Loss of teratogenic response to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice lacking the Ah (dioxin) receptor. Genes Cells 2:645–654.[Abstract]
  16. McNeal J.E. (1978) Origin and evolution of benign prostatic enlargement. Invest. Urol. 15:340–345.[Web of Science][Medline]
  17. Kashani M., Steiner G., Haitel A., Schaufler K., Thalhammer T., Amann G., Kramer G., Marberger M., Scholler A. (1998) Expression of the aryl hydrocarbon receptor (AhR) and the aryl hydrocarbon receptor nuclear translocator (ARNT) in fetal, benign hyperplastic, and malignant prostate. Prostate 37:98–108.[CrossRef][Web of Science][Medline]
  18. Akhtar F.Z., Garabrant D.H., Ketchum N.S., Michalek J.E. (2004) Cancer in US Air Force veterans of the Vietnam war. J. Occup.Environ. Med. 46:123–136.
  19. Institute of Medicine. (2003) Veterans and Agent Orange: Update 2002(National Academy Press, Washington, DC).
  20. Fritz W.A., Lin T.-M., Peterson R.E. (2005) Effects of in utero and lactational 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) exposure on the prostate and its response to castration in senescent C57BL/6J mice. Toxicol. Sci. 86:387–395.[Abstract/Free Full Text]
  21. Greenberg N.M., DeMayo F., Finegold M.J., Medina D., Tilley W.D., Aspinall J.O., Cunha G.R., Donjacour A.A., Matusik R.J., Rosen J.M. (1995) Prostate cancer in a transgenic mouse. Proc. Natl Acad. Sci. USA 92:3439–3443.[Abstract/Free Full Text]
  22. Gingrich J.R., Barrios R.J., Morton R.A., Boyce B.F., DeMayo F.J., Finegold M.J., Angelopoulou R., Rosen J.M., Greenberg N.M. (1996) Metastatic prostate cancer in a transgenic mouse. Cancer Res. 56:4096–4102.[Abstract/Free Full Text]
  23. Gingrich J.R., Barrios R.J., Kattan M.W., Nahm H.S., Finegold M.J., Greenberg N.M. (1997) Androgen-independent prostate cancer progression in the TRAMP model. Cancer Res. 57:4687–4691.[Abstract/Free Full Text]
  24. Kaplan-Lefko P.J., Chen T.M., Ittmann M.M., Barrios R.J., Ayala G.E., Huss W.J., Maddison L.A., Foster B.A., Greenberg N.M. (2003) Pathobiology of autochthonous prostate cancer in a pre-clinical transgenic mouse model. Prostate 55:219–237.[CrossRef][Web of Science][Medline]
  25. Huss W.J., Hanrahan C.F., Barrios R.J., Simons J.W., Greenberg N.M. (2001) Angiogenesis and prostate cancer: identification of a molecular progression switch. Cancer Res. 61:2736–2743.[Abstract/Free Full Text]
  26. Benedict J.C., Lin T-M., Loeffler I.K., Peterson R.E., Flaws J.A. (2000) Physiological role of the aryl hydrocarbon receptor in mouse ovary development. Toxicol. Sci. 56:382–388.[Abstract/Free Full Text]
  27. Shappell S.B., Thomas G.V., Roberts R.L., et al. (2004) Prostate pathology of genetically engineered mice: definitions and classification. The consensus report from the Bar Harbor meeting of the Mouse Models of Human Cancer Consortium Prostate Pathology Committee. Cancer Res. 64:2270–2305.[Abstract/Free Full Text]
  28. Puga A., Barnes S.J., Dalton T.P., Chang C., Knudsen E.S., Maier M.A. (2000) Aromatic hydrocarbon receptor interaction with the retinoblastoma protein potentiates repression of E2F-dependent transcription and cell cycle arrest. J. Biol. Chem. 275:2943–2950.[Abstract/Free Full Text]
  29. Ge N.-L. and Elferink C.J. (1998) A direct interaction between the aryl hydrocarbon receptor and retinoblastoma protein. Linking dioxin signaling to the cell cycle. J. Biol. Chem. 273:22708–22713.[Abstract/Free Full Text]
  30. Ray S.S. and Swanson H.I. (2004) Dioxin-induced immortalization of normal human keratinocytes and silencing of p53 and p16INK4a. J. Biol. Chem. 279:27187–27193.[Abstract/Free Full Text]
  31. Hu Y., Ippolito J.E., Garabedian E.M., Humphrey P.A., Gordon J.I. (2002) Molecular characterization of a metastatic neuroendocrine cell cancer arising in the prostates of transgenic mice. J. Biol. Chem. 277:44462–44474.[Abstract/Free Full Text]
  32. Huss W.J., Gray D.R., Greenberg N.M., Mohler J.L., Smith G.J. (2005) Breast cancer resistance protein-mediated efflux of androgen in putative benign and malignant prostate stem cells. Cancer Res. 65:6640–6650.[Abstract/Free Full Text]
  33. Harper M.E., Glynne-Jones E., Goddard L., Thurston V.J., Griffiths K. (1996) Vascular endothelial growth factor (VEGF) expression in prostatic tumors and its relationship to neuroendocrine cells. Br. J. Cancer 74:910–916.[Web of Science][Medline]
  34. Borre M., Nerstrøm M., Overgaard J. (2000) Association between immunohistochemical expression of vascular endothelial growth factor (VEGF), VEGF-expressing neuroendocrine-differentiated tumor cells, and outcome in prostate cancer patients subjected to watchful waiting. Clin. Cancer Res. 6:1882–1890.[Abstract/Free Full Text]
  35. Hankinson O. (1995) The aryl hydrocarbon receptor complex. Annu. Rev. Pharmacol. Toxicol. 35:307–340.
  36. Thackaberry E.A., Gabaldon D.M., Walker M.K., Smith S.M. (2002) Aryl hydrocarbon receptor null mice develop cardiac hypertrophy and increased hypoxia-inducible factor-1alpha in the absence of cardiac hypoxia. Cardiovasc. Toxicol. 2:263–274.[CrossRef][Medline]
  37. Lahvis G.P., Pyzalski R.W., Glover E., Pitot H.C., McElwee M.K., Bradfield C.A. (2005) The aryl hydrocarbon receptor is required for developmental closure of the ductus venosus in the neonatal mouse. Mol. Pharmacol. 67:714–720.[Abstract/Free Full Text]
  38. Eiserich J.P., Hristova M., Cross C.E., Jones A.D., Freeman B.A., Halliwell B., van der Vliet A. (1998) Formation of nitric oxide-derived inflammatory oxidants by myeloperoxidase in neutrophils. Nature 391:393–397.[CrossRef][Medline]
  39. Hughes C., Murphy A., Martin C., Sheils O., O'Leary J. (2005) Molecular pathology of prostate cancer. J. Clin. Pathol. 58:673–684.[Abstract/Free Full Text]
  40. Jana N.R., Sarkar S., Ishizuka M., Yonemoto J., Tohyama C., Sone H. (1999) Cross-talk between 2,3,7,8-tetrachlorodibenzo-p-dioxin and testosterone signal transduction pathways in LNCaP prostate cancer cells. Biochem. Biophys. Res. Comm. 256:462–468.[CrossRef][Web of Science][Medline]
  41. Eng M.H., Charles L.G., Ross B.D., Chrisp C.E., Pienta K.J., Greenberg N.M., Hsu C.X., Sanda M.G. (1999) Early castration reduces prostatic carcinogenesis in transgenic mice. Urology 54:1112–1119.[CrossRef][Web of Science][Medline]
  42. Raghow S., Kuliyev E., Steakley M., Greenberg N., Steiner M.S. (2000) Efficacious chemoprevention of primary prostate cancer by flutamide in an autochthonous transgenic model. Cancer Res. 60:4093–4097.[Abstract/Free Full Text]
  43. Safe S. and McDougal A. (2002) Mechanism of action and development of selective aryl hydrocarbon receptor modulators for treatment of hormone-dependent cancers (review). Int. J. Oncol. 20:1123–1128.[Web of Science][Medline]
  44. Ohtake F., Takeyama K., Matsumoto T., et al. (2003) Modulation of oestrogen receptor signalling by association with the activated dioxin receptor. Nature 423:545–550.[CrossRef][Medline]
  45. Mentor-Marcel R., Lamartiniere C.A., Eltoum I.E., Greenberg N.M., Elgavish A. (2001) Genistein in the diet reduces the incidence of poorly differentiated prostatic adenocarcinoma in transgenic mice (TRAMP). Cancer Res. 61:6777–6782.[Abstract/Free Full Text]
  46. Raghow S., Hooshdaran M.Z., Katiyar S., Steiner M.S. (2002) Toremifene prevents prostate cancer in the transgenic adenocarcinoma of mouse prostate model. Cancer Res. 62:1370–1376.[Abstract/Free Full Text]
Received July 12, 2006; revised September 11, 2006; accepted September 12, 2006.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
K. M. Xiong, R. E. Peterson, and W. Heideman
Aryl Hydrocarbon Receptor-Mediated Down-Regulation of Sox9b Causes Jaw Malformation in Zebrafish Embryos
Mol. Pharmacol., December 1, 2008; 74(6): 1544 - 1553.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Dabir, T. E. Marinic, I. Krukovets, and O. I. Stenina
Aryl Hydrocarbon Receptor Is Activated by Glucose and Regulates the Thrombospondin-1 Gene Promoter in Endothelial Cells
Circ. Res., June 20, 2008; 102(12): 1558 - 1565.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
W. A. Fritz, T.-M. Lin, and R. E. Peterson
The aryl hydrocarbon receptor (AhR) inhibits vanadate-induced vascular endothelial growth factor (VEGF) production in TRAMP prostates
Carcinogenesis, May 1, 2008; 29(5): 1077 - 1082.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/2/497    most recent
bgl179v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Fritz, W. A.
Right arrow Articles by Peterson, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fritz, W. A.
Right arrow Articles by Peterson, R. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?