Skip Navigation


Carcinogenesis Advance Access originally published online on August 31, 2006
Carcinogenesis 2007 28(3):537-544; doi:10.1093/carcin/bgl152
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/3/537    most recent
bgl152v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Bivik, C.
Right arrow Articles by Öllinger, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bivik, C.
Right arrow Articles by Öllinger, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Hsp70 protects against UVB induced apoptosis by preventing release of cathepsins and cytochrome c in human melanocytes

Cecilia Bivik1,*, Inger Rosdahl1 and Karin Öllinger2

1 Division of Dermatology, Department of Biomedicine and Surgery SE-581 85 Linköping, Sweden
2 Division of Experimental Pathology, Department of Neuroscience and Locomotion; Faculty of Health Sciences, Linköping University SE-581 85 Linköping, Sweden

*To whom correspondence should be addressed. Tel: +46 13228739; Fax: +46 13127465; Email: cecbi{at}ibk.liu.se


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stress-induced heat shock protein 70 (Hsp70) effectively protects cells against apoptosis, although the anti-apoptotic mechanism is still undefined. Exposure of human melanocytes to heat and subsequent UVB irradiation increased the level of Hsp70 and pre-heating reduced UVB induced apoptosis. Immunofluorescence staining of Hsp70 in combination with staining of lysosomes (Lamp2) or mitochondria (Mitotracker®) in pre-heated UVB exposed cells showed co-localization of Hsp70 with both lysosomes and mitochondria in the surviving cell population. Furthermore, UVB induced apoptosis was accompanied by lysosomal and mitochondrial membrane permeabilization, detected as release of cathepsin D and cytochrome c, respectively, which were prevented by heat pre-treatment. In purified fractions of lysosomes and mitochondria, recombinant Hsp70 attached to both lysosomal and mitochondrial membranes. Moreover, in apoptotic cells Bax was translocated from a diffuse cytosolic location into punctate mitochondrial-like structures, which was inhibited by Hsp70 induction. Such inhibition of Bax translocation was abolished by transfection with Hsp70 siRNA. Furthermore, Hsp70 siRNA eliminated the apoptosis preventive effect observed after pre-heating. These findings show Hsp70 to rescue melanocytes from UVB induced apoptosis by preventing release of cathepsins from lysosomes, Bax translocation and cytochrome c release from mitochondria.

Abbreviations: AIF, apoptosis-inducing factor; Hsp, heat shock protein; NAG, ß-N-acetylglucosaminidase; tBid, truncated Bid; UV, ultraviolet


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Apoptosis, or programmed cell death, is important for maintenance of tissue homeostasis in multicellular organisms. Dysregulation of apoptosis is associated with pathological conditions, such as cancer, autoimmune disorders and several neurodegenerative diseases (1). The apoptotic process is regulated by several different intracellular and extracellular events. Mitochondria play a crucial role by releasing apoptogenic factors, such as cytochrome c and apoptosis-inducing factor (AIF), from the intermembrane space into the cytosol (2). Cytochrome c, in complex with the cytosolic factor, Apaf-1, activates caspase 9, which in turn leads to caspase 3 activation. The mitochondrial pathway is mainly controlled and regulated by Bcl-2 family proteins, which includes both pro- (e.g. Bax, Bid, Bak) and anti- (e.g. Bcl-2, Bcl-XL) apoptotic protein members (3). Following apoptotic stimuli, Bax is activated and translocates from the cytosol to the mitochondria (4), a process often assisted by the BH3-domain-only proteins Bid and Bim (5). Within the membrane, oligomerized Bax facilitates mitochondrial membrane permeabilization (6). This process is counteracted by anti-apoptotic proteins, such as Bcl-2 and Bcl-XL, which prevent cytochrome c release (3,5). Besides caspases, several other proteases have been suggested to participate in the apoptosis process. Lysosomal membrane permeabilization and release of cathepsins to the cytosol has been demonstrated to be an apoptosis-initiating event, crucial for both the extrinsic (7) and intrinsic pathways of apoptosis (811).

The heat shock protein (Hsp) family is a conserved set of molecular chaperones, involved in folding and transport of newly synthesized proteins (12). Moreover, these proteins function during refolding of misfolded proteins, and assist in degradation of irreversibly damaged proteins. In addition to their chaperoning activities, the Hsps have been shown to play a direct role in the regulation of apoptosis. The Hsp family consists of both constitutively expressed members and of proteins that are induced in response to environmental, chemical and physical stress stimuli. The major stress-induced member of the Hsp family, Hsp70 (also called Hsp72), has been reported to effectively rescue various cell types from apoptosis when exposed to heat shock, tumor necrosis factor-{alpha} (TNF-{alpha}), oxidative stress, irradiation or anti-cancer drugs (12). On the other hand, adenoviral overexpression of Hsp70 in Mc0009 P12 melanocytes did not protect against 4-tertiary butyl phenol induced apoptosis (13).

The most severe malignant tumor of the skin is malignant melanoma, arising from the pigment producing epidermal melanocytes. So far the only identified external risk factor for this disease is ultraviolet (UV) irradiation (14). The skin is daily exposed to UV irradiation, generating damage to biomolecules such as DNA, which later might lead to malignant transformation. Elimination of photodamaged cells by apoptosis is crucial to prevent tumor progression. In order to understand the underlying mechanism of melanoma development, outlining of the regulation of apoptosis and cell survival after UV irradiation is of importance. Previously, we have reported that UV irradiation activates the mitochondrial pathway of apoptosis in primary cultures of human epidermal melanocytes (8). We found translocation of Bax to mitochondrial-like structures in apoptotic cells, whereas the surviving population showed translocation of Bcl-2 to mitochondrial-like structures. In this study, we continue our investigation of the mechanism regulating melanocyte death and survival upon UV irradiation by elucidating the role of Hsp70.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
All experiments were performed according to the ethical principles of the Helsinki declaration and approved by the Ethical Committee at Linköping University, Linköping, Sweden. Melanocytes were obtained from Caucasian donors (0–2 years of age) by means of foreskin circumcisions and cell cultures were established as described previously (15). The melanocytes were cultured in medium 199 (Invitrogen, Paisley, Scotland, UK) with 2% fetal bovine serum (FBS) according to Gilchrest et al. (16) and incubated at 37°C in a humidified atmosphere of 5% CO2 in air. Prior to experiments, cells were seeded at 2.5 x 104 cells/cm2. The experiments were conducted between passage 2–5 and no cells were cultured for >3 weeks in total. Altogether, the experiments included primary cultures of melanocytes from 16 individuals. In all experiments untreated controls from the same individual were analyzed in parallel at the selected time points.

Heat and UVB exposure
The cells were divided into four experimental groups. The first group was exposed to heat. Culture medium, pre-warmed to 42.5°C, was added and the culture dishes were placed in an isolated box to keep the temperature stable during the incubation period of 1 h at 42.5°C. The temperature was controlled by a Testo 100 thermometer (Nordtec Instrument, Gothenburg, Sweden). The second group of cells was exposed to UVB irradiation (280–320 nm) as described below. The third group was first exposed to heat followed by a 6 h recovery period at 37°C, and then the cell cultures were exposed to UVB irradiation. The last group, consisting of the control cells was incubated at 37°C.

The UVB source was two Philips TL20W/12 tubes (Philips, Eindhoven, The Netherlands) emitting in the spectral range 280–370 nm with a main output of 305–320 nm. A Schott WG 305 cut off filter (50% absorption below 305 nm, Mainz, Germany) was used. The output was 1.44 mW/cm2, measured with a PUVA Combi Light dosimeter (Leuven, Belgium), using adequate adjustments for UVB. The cells were irradiated in phosphate-buffered saline (PBS) and no increase in temperature of the PBS was noted during irradiation. Directly after irradiation the PBS was replaced by fresh pre-warmed (37°C) medium. The irradiation dose of 500 mJ/cm2, corresponding to the irradiation time of 5 min 47 s, was selected to achieve a frequency of apoptosis of ~30% with a minimum number of necrotic cells.

Nuclear morphology and caspase activation
After 6 h post-UVB exposure, the cultures were fixed in 4% neutral buffered formaldehyde and mounted in Vectashield® Mounting Media supplemented with 4',6'-iamidino-2-phenylindole (DAPI, 5 µg/ml, Vector Laboratories, Burlingame, CA). The nuclei were evaluated in 200 randomly selected cells, using a fluorescence microscope ({lambda}ex 350 nm, Nikon, Tokyo, Japan). In the control cells, most nuclei were round in shape and glowed homogenously, while apoptotic cells were identified by either fragmented nuclei or by a condensed chromatin pattern gathered at the periphery of the nuclear membrane.

In order to analyze caspase 3 activity, the cells were collected in lysis buffer (10 mM Tris–HCl, pH 7.5, 130 mM NaCl, 1% Triton X-100, 10 mM sodium pyrophosphate, 10 mM NaH2PO4/NaHPO4) at 18 h following UV irradiation, and incubated with the substrate Ac-DEVD-AMC according the manufacturer's recommendation (BD Pharmingen, San Diego, CA). The concentration of proteolytically released AMC substrate (7-amino-4-methylcoumarin) was analyzed in a Shimadzu RF-540 spectrofluorometer ({lambda}ex380/{lambda}em435, Shimadzu Kyoto, Japan). Protein concentrations were analyzed by the Bio-Rad DC Protein Assay System (Bio-Rad Laboratories, Hercules, CA) and caspase activity is expressed as arbitrary units/microgram protein/hour.

Immunocytochemistry
Melanocytes were fixed in 4% paraformaldehyde for 20 min at 4°C and processed for immunocytochemistry (17). After permeabilization with 0.1% saponin, the cultures were incubated overnight at 4°C with one of the monoclonal antibodies anti-Hsp70 (cat no. SPA-810, Stressgen, Victoria, BC, Canada) or anti-Lamp2 (lysosomal associated membrane protein-2; cat no. 9840-01, SouthernBiotech, Birmingham, AL), or the polyclonal antibodies anti-Bax antibody (cat no. 06-499, Upstate Biotechnology, Lake Placid, NY) or anti-Hsp70 (cat no. sc-1060, Santa Cruz Biotechnology, Santa Cruz, CA) followed by incubation with a secondary goat anti-mouse Alexa Fluor® 594 (Molecular Probes, Eugene, OR), donkey anti-mouse Alexa Fluor® 594 (Molecular Probes), goat anti-rabbit Alexa Fluor 488® (Molecular Probes) or donkey anti-goat Alexa Fluor® 546 conjugate (Molecular Probes) for 1 h at room temperature. To study the co-localization, mitochondria were labeled by incubation of cells with 200 nM Mitotracker® Red (Molecular Probes) for 30 min at 37°C before fixation. The samples were mounted onto Vectashield® Hardset Mounting Media and inspected in a Nikon Eclipse E600W fluorescence confocal microscope. In each culture dish, 200 cells were randomly selected and the localization of the proteins was analyzed. Negative controls, incubated without primary antibody, showed no staining.

Subcellular fractionation experiments
By using ProteoExtractTM Subcellular Proteome Extraction Kit (Calbiochem, Darmstadt, Germany) subcellular fractions of cytosols, membranes and nuclei were collected according to the manufacturer's instructions. To verify the purity of each fraction, the following antibodies were used as markers in the western blot analysis; lactate dehydrogenase (LDH, cat no. 20-LG22, Fitzgerald Industries International, Concord, MA) as a marker enzyme of cytosolic fraction, cytochrome c oxidase subunit IV (COX-IV, cat no. ab14744, Abcam, Cambridge, UK) as a marker of the membrane fraction and c-jun (cat no. sc-45, Santa Cruz Biotechnology) as a marker of the nuclear fraction.

Western blot analysis
Gel electrophoresis and western blotting were performed as described previously (18). Primary monoclonal Hsp70 (Stressgen), cathepsin D (cat no. IM03, Oncogene, San Diego, CA), cytochrome c (cat no. 556433, BD Pharmingen) and VDAC1 (cat no. ab14734, Abcam) antibodies or polyclonal Lamp2 (cat no. PA1-655, Affinity BioReagents, Golden, CO) and Bid (cat no. 550365, BD Pharmingen) antibodies were used, followed by horseradish peroxidase (HRP)-conjugated sheep anti-mouse or donkey anti-rabbit secondary antibodies (Amersham Biosciences, Buckinghamshire, UK). The bands were visualized using enhanced ECL-Plus Western blotting detection system (Amersham Biosciences). Protein concentrations were determined with Bio-Rad protein assay. The membranes were reprobed with glyceraldehyde-3-phosphate dehydrogenase (GAPDH, cat no. 4699-9555, Biogenesis, Poole, UK) as internal control. Densitometric quantification of the bands was performed with Gel-Pro Analyzer 3.1 (MediaCybernetics, Silver Spring, MD).

Isolation of rat liver mitochondria and lysosomes
Purification of mitochondria from rat liver was performed as described previously (19). Briefly, after homogenization, the sample was centrifuged at 1000x g for 10 min and the mitochondria were isolated from the supernantant by centrifugation at 48 000x g for 1 h in a sucrose gradient.

Rat liver lysosomes were isolated adopting the method earlier described for purification of mouse liver lysosomes (20). The integrity of lysosomes was verified by measurement of the lysosomal enzyme ß-N-acetylglucosaminidase (NAG) activity (21) in absence or presence of Triton X-100 (1% final concentration). All steps in the purification were carried out on ice and the procedure was only continued if >80% of the lysosomes were found to be intact.

In lysosomal fractions mitochondrial cross-contamination was excluded by analysis of p-iodonitrotetrazolium reductase activity and in mitochondrial fractions NAG activity was used. In addition the purity of the lysosomal fractions was studied by electron microscopy (22).

Insertion of Hsp70 into lysosomal and mitochondrial membranes
50 µg lysosomes or mitochondria were incubated with 0.75 or 2 µM recombinant Hsp70 (Stressgen) or Hsp70 diluents in 50 µl sucrose/PIPES buffer (250 mM sucrose, 20 mM PIPES, pH 7.2) at 30°C for 1 h. The organelles were washed with sucrose/PIPES buffer and pellets were formed by centrifugation at 18 000x g for 10 min. Proteins attached, but not inserted into the membranes, were solubilized by incubation of the pellet in 0.1 M Na2CO3 in sucrose/PIPES buffer on ice for 20 min, as described previously (23). Following centrifugation at 100 000x g for 45 min, the previously attached proteins were found in the supernatant. The pellet, containing membrane fraction with inserted proteins, were incubated in sucrose/PIPES buffer supplemented with 2% CHAPS on ice for 1 h. These samples were subsequently sonicated and centrifuged at 100 000x g for 30 min. The two solubilized protein samples were analyzed by immunoblotting of Hsp70. All steps were carried out on ice unless indicated otherwise. Sucrose/PIPES and Tris–HCl buffer served as negative controls for Hsp70. By incubating organelle fractions with GAPDH, cytochrome c, full-length Bid and caspase 8-cleaved Bid, our research group has previously demonstrated that the organelles are not generally adhesive to proteins (22).

siRNA transfection
Human melanocytes were seeded into 12-well plates at 60–70% confluency one day prior to transfection. The cells were transfected with 1 µg Hsp70 siRNA (TTCAAAGTAAATAAACTTTAA, Qiagen, Germantown, MD) and 6 µl RNAiFect Transfection Reagent (Qiagen) according to the manufacturers recommendations. To minimize the risk of off-target effects, control experiments using an additional Hsp70 siRNA (TCCTGTGTTTGCAATGTTGAA, Qiagen) were performed. After 8 h, the siRNA transfection medium was replaced with fresh medium. Optimal transfection conditions for the melanocytes were determined by titration, using Alexa Fluor® 555 labeled non-silencing siRNA, with a scrambled sequence with no homology to mammalian genes (AATTCTCCGAACGTGTCACGT, Qiagen). This siRNA was used in the experiments as negative control and siRNA targeting Lamin A/C (AACTGGACTTCCAGAAGAACA, Qiagen) served as positive control, as recommended by the manufacturer. After siRNA addition, the cells were incubated at standard culture conditions (37°C, 5% CO2) and after 36 h a significant decrease in protein level was observed. Silencing effects of Hsp70 siRNA was determined by western blot analysis.

Cytosolic extraction
Cytosol was extracted by incubation of melanocytes with digitonin (Sigma Aldrich, St Louis, MO) extraction buffer (250 mM sucrose, 20 mM HEPES, 10 mM KCl, 1.5 mM MgCl2, 1 mM EGTA, 1 mM EDTA, 1 mM Pefabloc, 8 mM dithiotriol, pH 7.5) for 12 min on ice. The digitonin concentration (15–20 µg/ml), which was individually titrated to for each melanocyte donor, permeabilizes the cholesterol-rich plasma membrane, but leaves membranes of intracellular organelles intact. This was determined by activity analysis of lactic acid dehydrogenase (LDH) and NAG as previously described (21,24). The proteins in the cytosols were precipitated by trichloric acid (50%), incubated on ice for 10 min, and subsequently pelleted by centrifugation. To perform the western blot analysis, the pellet was resuspended in urea-lysis buffer (6 M urea, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 50 mM Tris, pH 8.0, 5 mM EDTA), sample buffer (5% ß-mercaptoethanol in Laemmli sample buffer, Bio-Rad Laboratories) and 1 M NaOH.

Statistics
Statistical evaluation was performed by Kruskal–Wallis test as pre-test, followed by Mann–Whitney U-tests. P-values <0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To study the mechanisms of apoptosis in human epidermal melanocytes, the UVB (280–320 nm) irradiation dose was selected to cause apoptosis in ~30% of the cells with a minimum number of necrotic cells, as assessed by nuclear fragmentation and detected by DAPI staining. In total, melanocytes from 16 individuals were studied and UVB irradiation induced apoptosis in 33.8% (median, range 23.7–41.8) of the cells. In order to induce Hsp, cell cultures were incubated at 42.5°C for 1 h followed by a recovery period of 6 h at 37°C. This treatment generated melanocytes significantly more resistant to UVB induced apoptosis (median 19.9% compared with 33.8% in cells UVB exposed only, Figure 1A). Furthermore, cells pre-exposed to heat showed suppressed caspase 3 activation after UVB irradiation (median 42.5 AU/mg/h compared with 61.1 AU/mg/h in cells UVB exposed only, Figure 1B). The Hsp70 expression was raised 3-fold after heat treatment and pre-heated UVB exposed cells showed a 6.5-fold increase in Hsp70 expression, when compared with untreated controls (Figure 1C). However, UVB exposure only, caused no significant increase of Hsp70. These sets of experiments show induction of heat shock protection and suggest the site of effect to be upstream of caspase 3 activation.


Figure 1
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Heat pre-exposure protects human melanocytes from UVB induced apoptosis. Melanocytes were exposed to heat (42.5°C, 1 h) and/or UVB (500 mJ/cm2) 6 h later. (A) Apoptosis quantified by microscopic inspection of nuclear morphology in DAPI stained cells after 6 h (n = 16, ***P < 0.001). (B) Caspase 3 activity was detected as cleavage of the substrate Ac-DEVD-AMC after 18 h (n = 9, *P < 0.05). Data from the same donor is marked with a broken line. (C) Western blot analysis of Hsp70 protein level after 6 h. One representative blot out of six is presented and GAPDH is used as internal control. Densiometric analysis of Hsp70 correlated to GAPDH level is presented as fold increase compared with unexposed control cells (**P < 0.01).

 
To elucidate if the decreased rate of apoptosis was caused by induction of Hsp70, melanocytes were transfected with short interfering RNA (siRNA) to inhibit Hsp70 expression. As presented in Figure 2A, Hsp70 expression was significantly reduced 36 h after transfection. The siRNA transfected cultures were more sensitive to UVB irradiation (P < 0.05) compared with non-transfected cultures, as judged by inspection of nuclear morphology. As presented in Figure 2B, the apoptosis protective effect observed in heat pre-exposed UVB irradiated cells was abolished in melanocytes transfected with Hsp70 siRNA. In all experiments, a negative scrambled control siRNA was run in parallel. In these cultures no decrease in Hsp70 expression was detected and the frequency of apoptosis was unaffected. In cells exposed to heat and UVB, we found fragmented nuclei in 20.3% (median) of the cells compared with 23.1% in cells transfected with a scrambled sequence of siRNA. To verify the results, the siRNA experiments were repeated using an alternative siRNA sequence (see Materials and Methods). The frequency of apoptosis did not differ between this sequence and the one presented in Figure 2 (not shown). Thus, induction of Hsp70 is important for protection against UVB induced apoptosis.


Figure 2
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Inhibition of Hsp70 expression by siRNA transfection eliminates the apoptosis protection of heat pre-exposure. Melanocytes were transfected with siRNA targeting Hsp70 and after 36 h exposed to heat (42.5°C, 1 h) and/or UVB irradiation (500 mJ/cm2) 6 h later. (A) Western blot analysis of Hsp70 after siRNA transfection. One representative blot out of three, from heat and UVB exposed cells is shown and GAPDH is used as internal control. Densiometric analysis of Hsp70 correlated to GAPDH level is presented as fold increase compared with unexposed control cells (*P < 0.05). (B) Frequency of apoptosis in siRNA transfected melanocytes determined by microscopic inspection of nuclear morphology in DAPI stained cells (n = 6, ** P < 0.01).

 
To determine the intracellular localization of Hsp70 after heat and UVB treatments, the melanocytes were fractionated into cytosols, membranes and nuclei and Hsp70 levels were analyzed by western blot. Figure 3A demonstrates a substantial increase in Hsp70 level in all fractions after exposure to heat followed by UVB irradiation. When control melanocytes were immunostained for Hsp70, we observed a diffuse staining pattern in the cytosol as well as in the nucleus (Figure 3B, representative image). When stress stimuli were introduced, as either UVB exposure alone or heat in combination with UVB, the diffuse cellular staining pattern changed to an organelle restricted punctate pattern (Figure 3C, representative image). Quantification of cells with such a Hsp70 distribution pattern, showed that pre-exposure to heat significantly increased UVB induced punctate localization of Hsp70 (median 39.8% compared with 29.5% in cells UVB exposed only, Figure 3D). Parallel investigations of nuclear morphology were performed and revealed that cells with Hsp70 punctate staining contained a normal nucleus, suggesting these cells to belong to the surviving population.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Increased Hsp70 expression and organelle-restricted localization of Hsp70 following heat and UVB irradiation. Human melanocytes were exposed to heat (42.5°C, 1 h) and/or UVB (500 mJ/cm2) 6 h later. (A) Western blot analysis of Hsp70 in subcellular fractions of melanocytes performed after 6 h. LDH, COX-IV and c-jun are used as control markers for the cytosolic, membrane and nuclear fractions, respectively. One representative blot out of three is presented. Representative immunocytochemistry images of Hsp70 in (B) unexposed and (C) pre-heated UVB exposed melanocytes. Note the change in Hsp70 staining pattern from diffuse to punctate following heat and UVB exposure. (D) Quantification of melanocytes with punctate staining of Hsp70 after heat and UVB exposures was performed after 6 h. Data from the same donor is marked with a broken line (n = 10, **P < 0.01).

 
Next, we determined the intracellular membrane structures to which Hsp70 localize. Melanocytes were double stained for Hsp70 and the lysosomal specific protein Lamp2 or exposed to Mitotracker® before Hsp70 immunostaining to ascertain co-localization of Hsp70 with lysosomes and mitochondria, respectively. As presented in Figure 4A and B, Hsp70 co-localized with both organelles. To test in which way Hsp70 interacts with the organelle membranes, recombinant Hsp70 (0.75 or 2 µM) was incubated with mitochondria and lysosomes isolated from rat liver. After incubation, the organelle fractions were treated with Na2CO3, which solubilizes proteins attached to the membrane, while proteins integrated into the membrane remain associated with the membrane fraction (23). As presented in Figure 4C and D Hsp70 was targeted to both lysosomes and mitochondria. In lysosomal membranes, the Hsp70 was found attached, while it was attached, as well as, inserted into mitochondrial membranes. Both concentrations of recombinant Hsp70 showed the same results. To prove that Na2CO3 treatment did not release integrated proteins from the organelles in general, immunoblots of VDAC and Lamp2 were performed, showing these proteins to be stationary in the mitochondrial and lysosomal membranes, respectively (Figure 4C and D).


Figure 4
View larger version (60K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Lysosomes and mitochondria are both targets for Hsp70. Control melanocytes and melanocytes exposed to heat (42.5°C, 1 h) followed by UVB (500 mJ/cm2) 6 h later were immunostained and examined by fluorescence confocal microscopy. (A) Intracellular co-localization of Hsp70 (green) and the lysosomal marker enzyme Lamp2 (red), and (B) Hsp70 (green) and Mitotracker® (red) was shown in yellow color in merged images. Fractions of (C) lysosomes and (D) mitochondria were incubated with 2 µM recombinant Hsp70, Sucrose/PIPES (Su/Pi) or Tris–HCl buffer. The organelle fraction was washed and proteins attached to the membrane were released by incubation in 1 M Na2CO3. Hsp70, VDAC and Lamp2 protein content were analyzed by western blot. One representative blot out of three is presented.

 
We had previously found that UVB induced apoptosis in melanocytes was accompanied by release of apoptogenic substances, such as cathepsins and cytochrome c, from lysosomes and mitochondria, respectively (8). To study the effect of increased Hsp70 expression on organelle stability, we analyzed the release of the mitochondrial and lysosomal marker proteins cytochrome c and cathepsin D to the cytosol to estimate the degree of membrane permeabilization. Cells exposed to UVB irradiation showed release of both cathepsin D and cytochrome c to the cytosol, while melanocytes exposed to heat prior to UVB irradiation exhibited a prominent reduced release of both proteins (Figure 5). These experiments suggest Hsp70 to prevent lysosomal and mitochondrial membrane permeabilization.


Figure 5
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Heat exposure prior to UVB irradiation reduces the release of cytochrome c and cathepsin D to the cytosol. Melanocytes were exposed to heat (42.5°C, 1 h) and/or UVB (500 mJ/cm2) 6 h later and the cytosolic fraction was isolated by digitonin extraction after 6 h. Release of cathepsin D and cytochrome c was analyzed by western blot. One representative blot out of three is presented and GAPDH is used as internal control.

 
Bax is an important pro-apoptotic mediator that needs an activating signal, e.g. by interaction with truncated Bid (tBid), to translocate from cytosol to mitochondria and to facilitate cytochrome c release. Figure 6A demonstrates Bid cleavage following UVB exposure. Heat pre-treatment significantly reduced the UVB induced level of tBid. To further distinguish the intracellular site where Hsp70 exerts its protective effect, the number of cells with translocated Bax was analyzed using immunocytochemistry. The redistribution of the Bax protein, from a cytosolic localization into a punctate organelle restricted pattern (Figure 6B and C) was reduced in pre-heated UVB exposed cells (median 22.8%) compared with cells UVB exposed only (32.5%, Figure 6D). When the Hsp70 expression was reduced, using siRNA technique, no significant decrease in Bax translocation was obtained by heat pre-treatment (Figure 6E). Upon the initial heat treatment a small population of the cells died. A discrete, but not significant, increase in Bax punctuate staining, which probably depict the same heat sensitive population, was also observed. A negative control of scrambled siRNA did not influence the frequency of cells displaying Bax redistribution after heat and UVB exposure (Bax was translocated in 31.0% of the cells with scrambled siRNA and, 30.1% without). These results suggest Hsp70 to exert its anti-apoptotic effect upstream of Bax activation.


Figure 6
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Bid cleavage and Bax translocation are prevented by Hsp70 in heat and UVB exposed melanocytes. Melanocytes were exposed to heat (42.5°C, 1 h) and/or UVB (500 mJ/cm2) after 6 h. (A) Western blot analysis of Bid expression using GAPDH as internal control. Bax localization was analyzed by immunocytochemistry. Representative images of Bax in (B) control and (C) UVB irradiated melanocytes. Note the redistribution of Bax from a diffuse cytosolic to a punctate pattern following UVB exposure. (D) Quantification of melanocytes with punctate staining of Bax after 6 h. Data from the same donor is marked with a broken line (n = 10, ***P < 0.001). (E) The percentage of cells with punctate staining of Bax in Hsp70 siRNA transfected melanocytes exposed to heat and/or UVB exposure (n = 4, *P < 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have studied the response of human epidermal melanocytes to heat and investigated the function of Hsp70 following apoptosis induction with UVB irradiation. Hsp70 expression was markedly induced by heat exposure and these cultures were significantly more resistant to UVB induced apoptosis. This apoptosis protective effect was eliminated when Hsp70 was inhibited with siRNA transfection. Thus, Hsp70 has an important rescue effect on UVB irradiated melanocytes.

Accumulating reports demonstrate Hsp70 to have an anti-apoptotic function, although the mechanism of action is not fully elucidated (12). In tumor cells, the protein has been suggested to operate downstream of caspase 3 activation (25). On the other hand, human melanoma cells, overexpressing Hsp70, were highly resistant to UVB irradiation and Hsp70 inhibited cell death upstream caspase 3 (26). By experiments in lysates, Hsp70 was suggested to bind to Apaf-1 and inhibit apoptosome formation (27). However, the majority of the reports conclude that the protective effect of Hsp70 occurs upstream of mitochondrial membrane permeabilization and cytochrome c release (2831). In accordance with these reports, we found reduced release of cytochrome c in melanocytes pre-exposed to heat before UVB irradiation. By immunocytochemistry, we further demonstrated that Bax translocation from cytosol to punctate mitochondrial-like structures was significantly reduced in cultures expressing high levels of Hsp70. This reduction in Bax translocation was not observed when the Hsp70 expression was decreased by siRNA transfection, indicating Hsp70 to operate upstream of Bax activation. In accordance with this finding, Stankiewicz et al. recently showed that Hsp70 inhibits Bax translocation and prevents oligomerization and membrane insertion of the protein in a lymphoblastic T cell line, although no direct interaction between Hsp70 and Bax was found (30). In contrast, interaction between Bax and Hsp70 was found in mouse macrophage-like RAW 264.7 cells by co-immunoprecipitation (29). The mechanism for Bax activation and translocation is not fully elucidated (3). The tBid form is often suggested as a candidate for Bax activation (5,6). In melanocytes we found that UVB exposure induces Bid cleavage and heat pre-treated cells showed significantly lower level of the truncated Bid form. Recently, we showed that UV irradiation did not cause pro-caspase 8 activation in melanocytes, which exclude caspase 8 as Bid activator (8). However, several alternative proteases have been shown to cleave Bid, such as cathepsin B, D, L (32,33) and granzyme B (34). We have shown cathepsins to be released from the lysosomes to the cytosol during UV induced apoptosis in human melanocytes. By using cathepsin inhibitors, we found that both cystein and aspartic cathepsins are important for Bax translocation and activation of the mitochondrial pathway of apoptosis (8). The Hsp70-prevented Bax translocation found in this study might, therefore, be an effect of Hsp70 attachment to lysosomal membranes, preventing membrane permeabilization and, consequently, cathepsin release. Such a theory was recently suggested by Nylandsted et al. (35). By using immunoelectron microscopy, they found Hsp70 to be localized to endosomal/lysosomal membranes in tumor cells and reported Hsp70 to effectively inhibit permeabilization of the lysosomal membrane after treatment with TNF, oxidative stress, {gamma}-irradiation and etoposide. In our experimental model, immunocytochemistry showed distribution of Hsp70 to mitochondria and lysosomes in the surviving population of melanocytes and experiments using purified fractions of mitochondria and lysosomes showed that recombinant Hsp70 is able to attach to both these organelles. Membrane insertion assay requires a large amount of organelles, which was unattainable from human epidermal melanocyte preparations. Therefore, guiding experiments was performed on rat liver organelles. This might be a weakness, since there could be differences between species and organs. In these experiments alkali extraction of the mitochondrial membranes did not remove all Hsp70, indicating that Hsp70 also was integrated into the lipid bilayer of the mitochondrial membrane. In the present study we have not specifically addressed possible functional differences between attached and inserted Hsp70. The observed reduced cytochrome c release to the cytosol might be a dual effect of Hsp70. First, Hsp70 stabilizes the lysosomal membrane, preventing cathepsin release and Bax activation, which leads to decreased mitochondrial membrane permeabilization. Second, it targets the mitochondrial membrane, preventing cytochrome c and additional apoptogenic factors to enter the cytosol. By operating at several levels in the regulation of apoptosis, Hsp70 may represent a very effective substance, protecting the cells from undergoing apoptosis.

The sunlight consists of UV irradiation that penetrates the skin, and infrared irradiation, which generates heat. It has been reported that both heat and UV irradiation induced Hsp70 expression in organ-cultures of human skin (36), indicating a physiological importance of Hsp70 in sun exposed skin. The anti-apoptotic action of Hsp70 may not solely be positive since reduced apoptosis induction may result in survival of melanocytes containing DNA damage, which constitute potential tumor precursors. Overexpression of Hsp70 is common in several types of tumors (37) and elevated levels of the protein increases the tumorigenicity in mice models (38). Recent studies have suggested Hsp70 as a prognostic marker in cancer, since only tumor cells express the protein on the cell surface (39). By treatment with an Hsp70 neutralizing peptide, ADD70, Schmitt et al. were able to delay tumor growth and reduce the metastatic potential in mouse melanoma and rat colon carcinoma (40). Furthermore, ADD70 could enhance tumor sensitivity to the cytotoxic drug cisplatin in these cells in vivo. Thus, drugs targeting Hsp70 might be a potential strategy for cancer therapy in the future.

We conclude that Hsp70 has important cytoprotective qualities in melanocytes by preventing apoptosis signaling upstream lysosomal membrane permeabilization and activation of Bax.


    Acknowledgments
 
The authors thank Agneta Jansson for helpful technical advices. The study was supported by the Welander-Finsen Foundation, The Cancer and Allergy Foundation, The County Council of Östergötland, Swedish Cancer Foundation (2703-B03-16XAA) and Swedish Research Council (K2005-31X-15318-01A).

Conflict of Interest Statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hetts S.W. (1998) To die or not to die: an overview of apoptosis and its role in disease. JAMA 279:300–307.[Abstract/Free Full Text]
  2. Kim R., Emi M., Tanabe K. (2006) Role of mitochondria as the gardens of cell death. Cancer Chemother. Pharmacol. 57:545–553.[CrossRef][Web of Science][Medline]
  3. Lucken-Ardjomande S. and Martinou J.C. (2005) Regulation of Bcl-2 proteins and of the permeability of the outer mitochondrial membrane. C. R. Biol. 328:616–631.[CrossRef][Web of Science][Medline]
  4. Gross A., Jockel J., Wei M.C., Korsmeyer S.J. (1998) Enforced dimerization of BAX results in its translocation, mitochondrial dysfunction and apoptosis. EMBO J. 17:3878–3885.[CrossRef][Web of Science][Medline]
  5. Willis S.N. and Adams J.M. (2005) Life in the balance: how BH3-only proteins induce apoptosis. Curr. Opin. Cell Biol. 17:617–625.[CrossRef][Web of Science][Medline]
  6. Korsmeyer S.J., Wei M.C., Saito M., Weiler S., Oh K.J., Schlesinger P.H. (2000) Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Differ. 7:1166–1173.[CrossRef][Web of Science][Medline]
  7. Guicciardi M.E., Deussing J., Miyoshi H., Bronk S.F., Svingen P.A., Peters C., Kaufmann S.H., Gores G.J. (2000) Cathepsin B contributes to TNF-alpha-mediated hepatocyte apoptosis by promoting mitochondrial release of cytochrome c. J. Clin. Invest. 106:1127–1137.[Web of Science][Medline]
  8. Bivik C.A., Larsson P.K., Kågedal K.M., Rosdahl I.K., Öllinger K.M. (2006) UVA/B-induced apoptosis in human melanocytes involves translocation of cathepsins and Bcl-2 family members. J. Invest. Dermatol. 126:1119–1127.[CrossRef][Web of Science][Medline]
  9. Ishisaka R., Utsumi T., Kanno T., Arita K., Katunuma N., Akiyama J., Utsumi K. (1999) Participation of a cathepsin L-type protease in the activation of caspase-3. Cell Struct. Funct. 24:465–470.[CrossRef][Web of Science][Medline]
  10. Johansson A.C., Steen H., Öllinger K., Roberg K. (2003) Cathepsin D mediates cytochrome c release and caspase activation in human fibroblast apoptosis induced by staurosporine. Cell Death Differ. 10:1253–1259.[CrossRef][Web of Science][Medline]
  11. Roberg K. and Öllinger K. (1998) Oxidative stress causes relocation of the lysosomal enzyme cathepsin D with ensuing apoptosis in neonatal rat cardiomyocytes. Am. J. Pathol. 152:1151–1156.[Abstract]
  12. Mosser D.D. and Morimoto R.I. (2004) Molecular chaperones and the stress of oncogenesis. Oncogene 23:2907–2918.[CrossRef][Web of Science][Medline]
  13. Kroll T.M., Bommiasamy H., Boissy R.E., Hernandez C., Nickoloff B.J., Mestril R., Caroline Le Poole I. (2005) 4-Tertiary butyl phenol exposure sensitizes human melanocytes to dendritic cell-mediated killing: relevance to vitiligo. J. Invest. Dermatol. 124:798–806.[CrossRef][Web of Science][Medline]
  14. Gilchrest B.A., Eller M.S., Geller A.C., Yaar M. (1999) The pathogenesis of melanoma induced by ultraviolet radiation. N. Engl. J. Med. 340:1341–1348.[Free Full Text]
  15. Andersson E., Vahlquist A., Rosdahl I. (2001) Beta-carotene uptake and bioconversion to retinol differ between human melanocytes and keratinocytes. Nutr. Cancer 39:300–306.[CrossRef][Web of Science][Medline]
  16. Gilchrest B.A., Vrabel M.A., Flynn E., Szabo G. (1984) Selective cultivation of human melanocytes from newborn and adult epidermis. J. Invest. Dermatol. 83:370–376.[CrossRef][Web of Science][Medline]
  17. Brunk U.T., Dalen H., Roberg K., Hellquist H.B. (1997) Photo-oxidative disruption of lysosomal membranes causes apoptosis of cultured human fibroblasts. Free Radic. Biol. Med. 23:616–626.[CrossRef][Web of Science][Medline]
  18. Bivik C.A., Andersson E.B., Rosdahl I.K. (2005) Wavelength-specific effects on UVB-induced apoptosis in melanocytes. A study of Bcl-2/Bax expression and keratinocyte rescue effects. Melanoma Res. 15:7–13.[CrossRef][Web of Science][Medline]
  19. Boutry M. and Briquet M. (1982) Mitochondrial modifications associated with the cytoplasmic male sterility in faba beans. Eur. J. Biochem. 127:129–135.[Web of Science][Medline]
  20. Stoka V., Turk B., Schendel S.L., et al. (2001) Lysosomal protease pathways to apoptosis. Cleavage of bid, not pro-caspases, is the most likely route. J. Biol. Chem. 276:3149–3157.[Abstract/Free Full Text]
  21. Leaback D.H. and Walker P.G. (1961) Studies on glucosaminidase. 4. The fluorimetric assay of N-acetyl-beta-glucosaminidase. Biochem. J. 78:151–156.[Web of Science][Medline]
  22. Kågedal K., Johansson A.C., Johansson U., Heimlich G., Roberg K., Wang N.S., Jürgensmeier J.M., Öllinger K. (2005) Lysosomal membrane permeabilization during apoptosis-involvement of Bax? Int. J. Exp. Pathol. 86:309–321.[CrossRef][Web of Science][Medline]
  23. Antonsson B., Montessuit S., Sanchez B., Martinou J.C. (2001) Bax is present as a high molecular weight oligomer/complex in the mitochondrial membrane of apoptotic cells. J. Biol. Chem. 276:11615–11623.[Abstract/Free Full Text]
  24. Vanderlinde R.E. (1985) Measurement of total lactate dehydrogenase activity. Ann. Clin. Lab. Sci. 15:13–31.[Abstract]
  25. Jäättelä M., Wissing D., Kokholm K., Kallunki T., Egeblad M. (1998) Hsp70 exerts its anti-apoptotic function downstream of caspase-3-like proteases. EMBO J. 17:6124–6134.[CrossRef][Web of Science][Medline]
  26. Park K.C., Kim D.S., Choi H.O., Kim K.H., Chung J.H., Eun H.C., Lee J.S., Seo J.S. (2000) Overexpression of HSP70 prevents ultraviolet B-induced apoptosis of a human melanoma cell line. Arch. Dermatol. Res. 292:482–487.[CrossRef][Web of Science][Medline]
  27. Saleh A., Srinivasula S.M., Balkir L., Robbins P.D., Alnemri E.S. (2000) Negative regulation of the Apaf-1 apoptosome by Hsp70. Nat. Cell Biol. 2:476–483.[CrossRef][Web of Science][Medline]
  28. Creagh E.M., Carmody R.J., Cotter T.G. (2000) Heat shock protein 70 inhibits caspase-dependent and -independent apoptosis in Jurkat T cells. Exp. Cell Res. 257:58–66.[CrossRef][Web of Science][Medline]
  29. Gotoh T., Terada K., Oyadomari S., Mori M. (2004) hsp70-DnaJ chaperone pair prevents nitric oxide- and CHOP-induced apoptosis by inhibiting translocation of Bax to mitochondria. Cell Death Differ. 11:390–402.[CrossRef][Web of Science][Medline]
  30. Stankiewicz A.R., Lachapelle G., Foo C.P., Radicioni S.M., Mosser D.D. (2005) Hsp70 inhibits heat-induced apoptosis upstream of mitochondria by preventing Bax translocation. J. Biol. Chem. 280:38729–38739.[Abstract/Free Full Text]
  31. Steel R., Doherty J.P., Buzzard K., Clemons N., Hawkins C.J., Anderson R.L. (2004) Hsp72 inhibits apoptosis upstream of the mitochondria and not through interactions with Apaf-1. J. Biol. Chem. 279:51490–51499.[Abstract/Free Full Text]
  32. Cirman T., Oresic K., Mazovec G.D., Turk V., Reed J.C., Myers R.M., Salvesen G.S., Turk B. (2004) Selective disruption of lysosomes in HeLa cells triggers apoptosis mediated by cleavage of Bid by multiple papain-like lysosomal cathepsins. J. Biol. Chem. 279:3578–3587.[Abstract/Free Full Text]
  33. Heinrich M., Neumeyer J., Jakob M., et al. (2004) Cathepsin D links TNF-induced acid sphingomyelinase to Bid-mediated caspase-9 and -3 activation. Cell Death Differ. 11:550–563.[CrossRef][Web of Science][Medline]
  34. Barry M., Heibein J.A., Pinkoski M.J., Lee S.F., Moyer R.W., Green D.R., Bleackley R.C. (2000) Granzyme B short-circuits the need for caspase 8 activity during granule-mediated cytotoxic T-lymphocyte killing by directly cleaving Bid. Mol. Cell. Biol. 20:3781–3794.[Abstract/Free Full Text]
  35. Nylandsted J., Gyrd-Hansen M., Danielewicz A., Fehrenbacher N., Lademann U., Hoyer-Hansen M., Weber E., Multhoff G., Rohde M., Jaattela M. (2004) Heat shock protein 70 promotes cell survival by inhibiting lysosomal membrane permeabilization. J. Exp. Med. 200:425–435.[Abstract/Free Full Text]
  36. Muramatsu T., Tada H., Kobayashi N., Yamji M., Shirai T., Ohnishi T. (1992) Induction of the 72-kD heat shock protein in organ-cultured normal human skin. J. Invest. Dermatol. 98:786–790.[CrossRef][Web of Science][Medline]
  37. Jäättelä M. (1999) Escaping cell death: survival proteins in cancer. Exp. Cell Res. 248:30–43.[CrossRef][Web of Science][Medline]
  38. Jäättelä M. (1995) Over-expression of hsp70 confers tumorigenicity to mouse fibrosarcoma cells. Int. J. Cancer 60:689–693.[Web of Science][Medline]
  39. Kleinjung T., Arndt O., Feldmann H.J., et al. (2003) Heat shock protein 70 (Hsp70) membrane expression on head-and-neck cancer biopsy-a target for natural killer (NK) cells. Int. J. Radiat. Oncol. Biol. Phys. 57:820–826.[CrossRef][Web of Science][Medline]
  40. Schmitt E., Maingret L., Puig P.E., Rerole A.L., Ghiringhelli F., Hammann A., Solary E., Kroemer G., Garrido C. (2006) Heat shock protein 70 neutralization exerts potent antitumor effects in animal models of colon cancer and melanoma. Cancer Res. 66:4191–4197.[Abstract/Free Full Text]
Received March 28, 2006; revised August 14, 2006; accepted August 18, 2006.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GutHome page
V Dudeja, S M Vickers, and A K Saluja
The role of heat shock proteins in gastrointestinal diseases
Gut, July 1, 2009; 58(7): 1000 - 1009.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Autefage, V. Albinet, V. Garcia, H. Berges, M.-L. Nicolau, N. Therville, M.-F. Altie, C. Caillaud, T. Levade, and N. Andrieu-Abadie
Lysosomal Serine Protease CLN2 Regulates Tumor Necrosis Factor-{alpha}-mediated Apoptosis in a Bid-dependent Manner
J. Biol. Chem., April 24, 2009; 284(17): 11507 - 11516.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/3/537    most recent
bgl152v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Bivik, C.
Right arrow Articles by Öllinger, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bivik, C.
Right arrow Articles by Öllinger, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?