Skip Navigation


Carcinogenesis Advance Access originally published online on October 17, 2006
Carcinogenesis 2007 28(3):584-594; doi:10.1093/carcin/bgl190
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/3/584    most recent
bgl190v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Blanco-Aparicio, C.
Right arrow Articles by Carnero, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanco-Aparicio, C.
Right arrow Articles by Carnero, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Mice expressing myrAKT1 in the mammary gland develop carcinogen-induced ER-positive mammary tumors that mimic human breast cancer

Carmen Blanco-Aparicio1, Lucía Pérez-Gallego2,3, Belén Pequeño1, Juan F.M. Leal1, Oliver Renner1 and Amancio Carnero1,*

1 Experimental Therapeutics Programme, Spanish National Cancer Center (CNIO) Madrid, Spain
2 Biotechnology Programme, Spanish National Cancer Center (CNIO) Madrid, Spain
3 Present address: Anatomy pathology service, Hospital General de Palencia ‘Río Carrión’ Palencia, Spain

*To whom correspondence should be addressed at: Experimental Therapeutics Programme, Spanish National Cancer Center (CNIO), c/o Melchor Fernández Almagro n 3; 28029 Madrid, Spain. Tel: +34 91 732 8021; Fax: +34 91 224 6976; Email: acarnero{at}cnio.es


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
AKT1/PKB is a serine/threonine protein kinase that regulates biological processes such as proliferation, apoptosis and growth in a variety of cell types. To assess the oncogenic capability of an activated form of AKT in vivo we have generated several transgenic mouse lines that overexpress in the mammary epithelium the murine Akt1 gene modified with a myristoylation signal, which renders active this protein by localizing it to the plasma membrane. We demonstrate that expression of myristoylated AKT in the mammary glands increases the susceptibility of these mice to the induction of mammary tumors of epithelial origin by the carcinogen 9,10-dimethyl-1,2 benzanthracene (DMBA). We have found that while carcinogen-treated wild-type mice show mostly mammary tumors of sarcomatous origin, AKT transgenic mice treated with DMBA developed mainly adenocarcinoma or adenosquamous tumors, all of them displaying activated AKT. We analyzed other possible molecular alterations cooperating with AKT and found that neither Ras nor ß-catenin/Wnt pathways seemed altered nor p53 mutated. We have found that 100% of mammary DMBA-induced tumors and benign lesions in myrAKT mice are estrogen receptor (ER{alpha})-positive and are more frequent than in wild-type littermates. These data show that AKT activation cooperates with deregulation of the estrogen receptor in the DMBA-induced mammary tumorigenesis model and recapitulate two characteristics of some human breast tumors. Thus, our model might provide a preclinical relevant model system to study the role of AKT and ER{alpha} in breast tumorigenesis and the response of mammary gland tumors to chemotherapeutics.

Abbreviations: DMBA, 9,10-dimethyl-1,2-benzanthracene; MIN, mammary intraepithelial neoplasia; MMTV, mouse mammary tumor virus; PDK1, 3-phosphoinositide-dependent protein kinase-1; TMA, tissue microarray


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
Tumorigenesis in mouse mammary glands is influenced by viral, chemical, hormonal, genetic, immunologic and dietary factors (1). Epithelial apoptosis plays a key role in the development and function of the mammary gland. It is involved in the formation of ducts during puberty and it is required to remove the excess of epithelial cells after lactation so that the gland returns to a normal inter-pregnancies state. Deregulation of apoptosis contributes to the genesis and malignant progression of breast cancer (2). The serine-threonine kinase AKT-1 is a key regulator of apoptosis through the modification of numerous downstream effectors involved in cell survival, cell cycle progression and cellular growth. Activation of AKT can interfere with normal mammary gland involution by attenuating apoptotic death in the exceeding glandular epithelia of the breast (35).

Akt was first discovered as a viral oncogene that affected both proliferation and survival pathways (6). In mammals it has two homologues, AKT2 and AKT3 (7,8). Activation of AKT is initiated by translocation to the membrane after cell stimulation and PI (35) P3 (PIP3) production by phosphatidylinositol 3'-OH kinase (PI3K). At the membrane, AKT is phosphorylated by PDK1 (3-phosphoinositide-dependent protein kinase-1) at Thr308 and by rictor–mTOR (mammalian target of rapamycin) complex or DNA–PK at Ser473 (9,10). Phosphorylation at these two sites causes full activation of AKT (11,12). AKT has been documented to phosphorylate and inactivate multiple proteins relevant to apoptosis, including the Bcl-2 family member BAD, caspase-9 and forkhead transcription factors (13). AKT can also affect proliferation signaling to the cell-cycle machinery. It has been shown that AKT1 down regulates the levels of the cyclin-dependent kinase (CDK) inhibitor p27/Kip1 through phosphorylation and inhibition of the forkhead family of transcription factors (14). AKT can modulate p21/Cip1 activity through phosphorylation and facilitate its binding to proliferating cell nuclear antigen (PCNA) (15). Finally AKT1 also has an important role preventing cyclin D1 degradation through the regulation of glycogen synthase kinase 3ß, a kinase of cyclin D1 (16). AKT activity has been linked to both proliferative and anti-apoptotic effects of ER{alpha} in breast tumor cells, both in an estrogen dependent and independent way (17,18).

Several lines of evidence suggest that Akt-1 is implicated in human cancer progression: Akt-1 gene is amplified in human gastric cancers (6), overexpressed and overactivated in thyroid cancer (19) and AKT-1 kinase activity is frequently increased in breast, ovarian and prostate cancer where it is associated with poor prognosis (20) and resistance to tamoxifen and radiotherapy (21).

PI3K can be activated via its recruitment to activated receptor tyrosine kinases (RTKs) as the ErbB family receptors and to cytoplasmic protein tyrosine kinases (PTKs) as Src and breast tumor kinase (BRK). All of them are overexpressed or activated in human breast cancer (22,23). PTKs apart form their capability to enhance mammary epithelial cell mitogenesis, also enhance resistance to apoptotic signals activating the PI3K/AKT pathway, and both effects can promote the tumor growth.

The product of the gene PTEN (phosphatase and tensin homolog deleted from chromosome 10) is a lipid phosphatase that reverses the activity of PI3K by dephosphorylating the D3 position of PIP3 (24). Mice with a mammary-specific deletion of the PTEN gene displayed precocious lobulo-alveolar development, excessive ductal branching, delayed involution and severely reduced apoptosis (25). Moreover, the loss of PTEN accelerates mammary tumorigenesis induced by other mammary oncogenes not known to activate PI3K signaling, such as Wnt (26).

Constitutive membrane localization of AKT leads to its deregulated activation and can induce oncogenic transformation in vitro (27). We assessed the in vivo oncogenic potential of Akt1 in the mammary gland generating transgenic mice that express the murine myristoylated Akt1 under the control of a mouse mammary tumor virus (MMTV) LTR. These mice do not develop spontaneous mammary tumors but they show a higher incidence of benign lesions and delay in mammary involution (3). In the present work we show that they have increased susceptibility to epithelial mammary tumor formation induced by the carcinogen 9,10-dimethyl-1,2-benzanthracene (DMBA). We describe the nature of the mammary tumors resulting from the DMBA treatment of transgenic mice overexpressing membrane-targeted AKT1. We also investigated possible cooperative genetic alterations induced by the carcinogenic treatment in the mammary glands. We found that the activated AKT expressing tumors overexpressed estrogen receptor, constituting a good estrogen receptor-{alpha} (ER{alpha})-positive breast cancer mouse model.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
Transgene construction
We generated a myristoylated version of pMB vector by introducing in the NheI–XhoI sites the human myristoylation sequence of src using the following oligos: Forward :GCTAGCGGCCGCCATGGGGAGCAGCAAGAGCAAGCCCAAGGAC CCCAGCCAGCGCGGGGGAACTAGTGCCGGCCTCGAC, and reverse: CTCGAGGCCGGCACTAGTTTCCCCGCGCTGGCTGGGGTCCTTG GGCTTGCTC TTGCTGCTCCCCATGGCGGCCGC TAGC. These oligos include NheI, NotI and NcoI sites at the 5' and XhoI, NaeI and SpeI in the 3' to facilitate further subclonning strategies. The strategy for subcloning the murine Akt1 cDNA in this pMB modified consisted of a three steps protocol. First, murine cDNA was amplified with oligos that introduce new points for restriction enzymes (SalI and SpeI 5' and NruI and MluI after the stop codon). Second, murine cDNA was digested with SpeI and MluI. Third, cDNA was inserted into the pMB vector previously linearized with SpeI and MluI in frame with the myristoylation sequence to produce the final plasmid pMMTV-myrAKT1.

Generation of the transgenic mice
Transgenic mice were generated by the microinjection of the 4.7 kb fragment from the digested pMMTV-myrAKT1 with AatII+SalI, (this fragment contains the MMTV promoter, myrAKT1 sequences and SV40 poly-adenylation signal) into the pronucleus of single-cell embryos isolated from super-ovulated B6/CBA mice, according to standard procedures by the Transgenic Unit, CNIO. Embryos that survived the microinjection were implanted into pseudo-pregnant females and allowed to develop to term. All the crosses where kept in C57BL6 genetic background. Genotyping of the transgenic MMTV-myrAKT1 mice was performed by PCR of tail DNA. For details, see Supplementary material.

Whole mounts
Virgin females and 3 days after weaning pregnant females were euthanized using CO2, and mammary glands were harvested, placed on dry, silanized glass slides and fixed overnight in 1:3:6 parts of glacial acetic acid:chloroform:100% ethanol. Tissues were rehydrated through successive incubations with 70% ethanol followed by distilled water, and stained with Carmine red alum overnight. Tissues were then dehydrated through successive incubations in graded ethanol followed by mixed xylenes and mounted in Permount® (Fisher Scientific, Puerto Rico).

DMBA treatment
The carcinogen 9,10-dimethyl-1,2-benzanthracene (DMBA, Sigma) was dissolved in cotton oil at a concentration of 10 mg/ml. This mixture was heated at 37°C and shaken vigorously to fully dissolve the DMBA. Virgin female mice, 9-week-old, were treated with five weekly doses of 1 mg DMBA via oral gavage. Oral gavage consisted of inserting a curved blunt tipped needle attached to a 1 ml syringe into the mid-throat of a firmly grasped mouse and injecting 100 µl of a 10 mg/ml solution of DMBA. The mice were maintained in the absence of males and were checked by palpation for mammary tumor formation. Mice were sacrificed by CO2 inhalation either when tumors reached 300 mm3 or if the mice became moribund.

Histopathology and immunohistochemistry
For immunostaining, slides from the tissue microarray (TMA; see Supplementary material for details of the tissue microarray construction) were processed with 100 mM citrate buffer (pH 6.5) by pressure cooking (2 min at full pressure). Endogenous peroxidases were quenched with 0.3% H2O2 in methanol for 30 min. Blocking solution from Dako (Denmark) was applied for 1 h. Primary and secondary antibodies were applied for 1 h each in blocking solution. Streptavidin-biotin/peroxidase complexes (Dako) were applied for 30 min. Reactivity was detected using diaminobenzidine (DAB; Dako) staining, and the slides were counterstained with Harris-modified hematoxylin (Fisher Scientific) according to the manufacturer’s instructions. Slides were coveslipped in Permount® (Fisher Scientific). The following antibodies were used: rabbit anti-phosphoS473AKT1 (New England Biolab, Beverly, MA) diluted 1:50; rabbit anti-AKT1 (New England Biolab) diluted 1:25; rabbit polyclonal anti-keratin 8 (Developmental studies hybridoma Bank, IA) diluted 1:50; mouse monoclonal anti-keratin 14 (NeoMarkers, Fremont, CA) diluted 1:25; anti-Ki67 (Master diagnostica, Spain) prediluted; goat polyclonal anti-p21 (Santa Cruz Biotechnology, Santa Cruz CA) diluted 1:40; anti-p27 (Neomarkers) diluted 1:75; rabbit polyclonal anti-phospho Thr202/Tyr204 ERK1/2 (New England Biolab) diluted 1:100; rabbit polyclonal anti-p53 (Novocastra, Newcastle, UK) diluted 1:100; rabbit polyclonal anti ER alpha (Santa Cruz Biotechnology) diluted 1:150; anti-E-cadherin (BD Transduction Laboratories,) diluted 1:100; goat polyclonal anti-ßcatenin (Santa Cruz Biotechnology) diluted 1:200; rabbit polyclonal anti phosphoS167ER{alpha} (New England Biolab) diluted 1:25; horseradish peroxidase goat anti-rabbit IgG (Dako) diluted 1:50; horseradish peroxidase goat anti-mouse IgG (Jackson Immunoresearch, West Grove, PA) diluted 1:50; horseradish peroxidase rabbit anti-goat IgG (Dako) diluted 1:50.

Western analysis
Total protein was extracted from snap-frozen tissues by homogenization using a Dounce homogeneizer in 1 ml extraction buffer (25 mM Tris, pH 7.5, 150 mM NaCl, 1% TritonX-100, 15 mM EDTA, 10 mM NaF, 2 mM TAME, 5 mM benzamide, 10 µg/ml aprotinin, 40 µg/ml bestatin, 10 µg/ml EA4, 300 µg/ml phosphoramidon, 50 µg/ml antipain, 2.5 mM Na4P2O7, 15 mM pNPP, 1 mM DTT, 60 mM ß-glycerophosphate, 10 µg/ml leupeptine, 0.14 µg/ml chymostatin, 0.7 µg/ml pepstatin, 1 mg/ml pefabloc and complete protease inhibitor cocktail tablet (Roche molecular Biochemicals, Spain). Homogenates were centrifuged at 10 000 g for 10 min at 4°C twice, and fat was removed from the surface. Final supernatants were analyzed by western blot as described previously (28).

DNA isolation and sequencing of ras genes from mammary and lung tumors
See Supplementary material.

Statistical analysis
All statistics were analyzed using the SPSS statistical package (version 13.0 for Windows). Statistical analysis of tumor–free survival curves included calculation of Kaplan–Meier distributions of survival of two different groups of mice and comparison by a two-sided log-rang test. Spearman rank tests were conducted to test the differential incidence of epithelial and non-epithelial tumors between the different groups of treated mice. A P-value of <0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
MMTV driven membrane targeted Akt1 transgenic mice
To asses the potential role of Akt1 as an oncogene in mammary epithelium, we examined the consequences of the overexpression of activated AKT1 in the mammary gland of mice. Murine Akt1 cDNA was 5'-tagged with the SRC myristoylation sequence (myr-AKT), which activates this protein by localizing it to the plasma membrane (29). Myr-AKT cDNA was cloned under the MMTV promoter and a linearized DNA sequence of 4.7 kb containing the promoter, cDNA and polyA sequences was microinjected into fertilized mouse oocytes obtained from C57BL6 F1 donor mice. Six transgenic lines were identified by PCR from tail DNA samples and two of them, EA2 and EA4, showed high level of transgene expression.

We analyzed the tissue distribution of transgenic AKT expression by western blot and immunohistochemistry. In females, we detected expression only in mammary glands, brain, salivary gland, ovary and uterus in both EA2 and EA4 lines (data not shown). The analysis of the mammary glands of 9-week-old virgin females showed a clear increase of AKT phosphorylation in Ser473 correlating with the phosphorylation of its downstream target Forkhead ligand 1 (FHKRL1) as an indication of its activity (Figure 1a). Both transgenic lines showed clear activation of AKT in comparison to wild-type littermates but we detected a higher activation of the pathway in the EA2 line. Quantification of AKT activation showed that the EA2 line have 18-fold higher phosphorylated AKT levels than control littermates while the activation measured as FHKRL phosphorylation was 6.1-fold. The EA4 line showed 2-fold higher level of AKT-P while FHKRL-P was 2.9-fold over the control littermates. The immunohistochemical analysis of the mammary glands of 9-week-old virgin females clearly showed higher levels of expression of AKT and Ser473 phosphorylation in ductal cells of mammary epithelium of both transgenic lines in comparison to wild-type littermates (Figure 1b). Due to the hormone-responsive MMTV promoter driving the transgene, expression of myrAKT1 in the mammary gland was strongly induced during pregnancy (data not shown). Young virgin transgenic mice did not exhibit a dominant phenotype, but upon cessation of lactation, a notable delay in involution occurred compared to age-matched non-transgenic mice (Figure 1c). There was no evidence of mammary dysplasia or neoplasia during the lifespan of multiparous transgenic mice (data not shown), but there was an increase in the incidence of benign lesions as hyperplasia, cystic dilatation and alveolar proliferation in virgin and multiparous transgenic females respect to wild-type littermates (data not shown). These data are in agreement with the results obtained in other mouse models overexpressing wild-type AKT or a constitutively active version of AKT driven by the MMTV promoter (4,5).


Figure 1
View larger version (85K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Expression of activated AKT in nulliparous and multiparous mice. (a) Immunoblot analysis of AKT and FKHRL1 activation in the mammary gland extracts from nine weeks old nulliparous transgenic mice and wild-type littermates. (b) Immunohistochemical detection of phosphoS473 AKT1 and total levels of AKT in mammary glands of nine weeks old nulliparous transgenic mice and wild-type littermates. (c) Red carmin and haematoxilin staining and immunohistochemical detection of phosphoS473 AKT1 in mammary gland of multiparous transgenic mice and wild-type littermates.

 
Tumor development in females treated with the carcinogen DMBA
The above studies indicated that AKT1 is involved in cell survival in the mammary gland during lactation and involution, but that overexpression of AKT1 alone is insufficient to cause the development of mammary tumors. To investigate the potential role of myrAKT1 in enhancing mammary tumor development we took advantage of the well-established DMBA-induced mammary carcinogenesis model.

Transgenic virgin females from both founder lines (EA2, n = 13; EA4, n = 15) and control mice (n = 12) were given 1 mg doses, once a week, of DMBA by oral gavage for 5 consecutive weeks beginning at the age of 9 weeks (Figure 2a). Mice were then examined every 2 weeks for tumors. Between 13 and 39 weeks, after DMBA administration, mammary tumors appeared, consistent with the timing reported by others using the same protocol of carcinogenesis (30,31). Oral DMBA treatment induced several types of tumors, resulting in the death of wild-type and transgenic animals with similar timing (Figure 2b). However, while in the wild-type animals tumors of non-epithelial origin were prevalent, in both transgenic lines the balance is switched towards tumors of epithelial origin (Figure 2c and d). In wild-type animals only one-quarter of the tumors induced by DMBA were from epithelial origin as verified by pathological analysis. We considered epithelial tumors in the wild-type mice the stomach carcinoma and the mammary tumors with epithelial component (see Table I). 75% of the tumors were from ovary and lymphoid cells with one quarter of the animals carrying mammary tumors (Figure 2c). In transgenic lines, in average, 70% of tumors were epithelial with a clear increase in the proportion of mammary, lung and epidermoid carcinomas (Figure 2c). If we exclude the ovary granulose cell tumors and lympoid tumors then 100% of tumors developed by transgenic mice were of epithelial origin (Figure 2d). These data clearly show that activated AKT1 expression cooperates with DMBA in the induction of epithelial tumors.


Figure 2
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Survival and tumor development in wild-type and MMTV myr-AKT transgenic mice treated with DMBA. (a) Scheme of DMBA treatment. (b) Tumor-free survival curves in wild-type and MMTV myr-AKT mice treated with DMBA. Survival curves were computed using the Kaplan-Meier product-limit method. Animals sacrificed at the end of the experiment are shown with asterisk. The numbers of mice are the following: wild-type (n = 12); EA2 transgenic mice (n = 13); EA4 transgenic mice (n = 15). (c) Tumor spectrum in wild-type and MMTV myr-AKT transgenic mice treated with DMBA. Ovarian tumors, prevalent in DMBA treated wild-type mice, were granullosa cell tumors, a non-epithelial type of tumor associated to DMBA treatment. DMBA is a potent carcinogen that induces tumors in many tissues in transgenic and wild-type littermates by its mutagenic action. Some of these tumors are of epithelial origin but they appear in tissues without transgene overexpression (such in lung or stomach). * See Table I for detailed histopatological description of the mammary tumors. (d) Incidence of epithelial and non-epithelial tumors developed by wild-type and MMTV myr-AKT mice treated with DMBA. Each tumor has been considered as an event and lymphoid and ovary tumors are excluded from the representation. *, statistically significant increase in epithelial tumor incidence between wild-type and MMTV myr-AKT mice treated with DMBA.

 


View this table:
[in this window]
[in a new window]

 
Table I Incidence and histopatological description of the mammary benign lesions and tumors in wild-type and MMTVmyrAKT1 transgenic mice treated with DMBA

 
Focusing the analysis on the tumors induced in the mammary glands, clear differences were found between wild-type and transgenic animals. Although with subtle differences between lines, all the mammary tumors found in transgenic animals where of epithelial origin (Table I), adenosquamous carcinomas or adenocarcinomas with several grades of differentiation. The difference in the incidence between the two transgenic lines could be due to the difference in the level of expression of AKT1 in both transgenic lines or to the fact that are two independently generated transgenic lines. None of these tumors were found in wild-type mice, which developed mostly sarcomas or carcinosarcomas (Table I), although in a small percentage of tumors some epithelial component was found (Figure 3). The number of premalignant lesions, as mammary intraepithelial neoplasia (MIN), detected was similar between wild-type and transgenic mice. However a difference could also be observed in respect to benign lesions (Table I). We found a prevalence of cystic dilatation, benign papillary growth and hyperplasia in the transgenic lines expressing active AKT1.


Figure 3
View larger version (74K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Histologic characterization of mammary tumors. DMBA induced mammary tumors from wild-type mice (A and B); EA2 transgenic mice (C and D); and EA4 transgenic mice (E and F). (a) Representative H&E staining from the histopathologically heterogeneous tumor types, including sarcoma (A), carcinosarcoma (B), adenosquamous carcinoma (C and E), poorly differentiated adenocarcinoma without or with mixoid change in the stroma (D and F, respectively). Characterization of epithelial component of tumors by immunohistochemical staining with CK14 (b) and CK8 (c). The magnification used for all pictures is x200.

 
Although some animals developed more than one type of tumor, most transgenic mice developed a single mammary tumor per animal, with outstanding alveolar hyperplasia, low grade MIN with or without atypia in terminal ductules, cystic dilation and fibroadenomas in the non-affected mammary glands suggesting a strong oncogenic role for AKT1 in the mouse mammary epithelium.

The immunohistochemical characterization of the tumors induced in the mammary glands was performed on a tissue microarray containing all the tumors and benign lesions found; in the next figures we show representative pictures of each staining on the different tumor types. For the histopathological classification we followed the consensus report and recommendations from the Annapolis Meeting (32). The differentiation grade of the epithelial tumors or the epithelial component of carcinosarcomas was determined by immunostaining with K8 as a marker of mammary ductal cells and K14 as a marker of mammary myoepithelial cells or indicator of squamous differentiation (Figure 3b and c). Histological examination showed that tumors from myrAKT transgenic mice were heterogeneous, including adenosquamous carcinomas (Figure 3, pictures C and E), adenocarcinomas poorly differentiated with or without mixoid change in the stroma (Figure 3, pictures D and F, respectively), adenocarcinomas poorly differentiated with small focus of squamous metaplasia or adenocarcinomas with papillary differentiation. Tumors from wild-type mice were also heterogeneous, but the typology changed to high-grade sarcomas, carcinosarcoma with bone and cartilage metaplasia or condroid component (Figure 3, pictures A and B, respectively) or malignant fibroadenomas.

AKT activation in mammary tumors
Molecular analysis showed that tumors from myrAKT1 transgenic mice were characterized by hyperactivation of AKT in respect to tumors from wild-type animals (Figure 4a: pictures C, D, E and F versus A and B). These results confirmed that activated AKT1 expression cooperates with DMBA in the induction of epithelial tumors. Both mammary tumors developed by transgenic and wild-type mice showed a high proliferative rate and high levels of nuclear expression of two downstream AKT targets such as cyclin D1 and p27 (Figure 4B, C and D). Overexpression of activated AKT leads to differences in the kind of tumor but it does not generate differences neither in the proliferative rate of the tumors, nor in the expression or localization of some AKT targets such as cyclin D1 and p27.


Figure 4
View larger version (98K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Molecular characterization of DMBA-induced mammary tumors. Representative immunohistochemical staining for AKT-P (a), Ki67 (b), cyclin D1(c) and p27 (d) sections of mammary tumors. The sections are from tumors of wild-type mice (A and B); EA2 transgenic mice (C and D); and EA4 transgenic mice (E and F). A x200 magnification was used and a x400 magnification was inserted in the corner. The quantifications of the stainings are shown.

 
Cooperating mutations in AKT tumors
It has been described that DMBA induces ras mutations during the carcinogenic process in the mammary gland (33). Since oncogenic ras might provide a proliferative signal that could cooperate with AKT in tumorigenesis, we have analyzed the tumors to detect any exon 1 and 2 mutations in all the ras family members, H-ras, N-ras and K-ras. We did not find any mutation of ras in mammary tumors (data not shown). K-Ras mutations were only found in lung tumors (data not shown). As Hutchinson and coworkers have been shown that activation of AKT1 can accelerate HER-2 mediated mammary tumorigenesis but suppresses tumor invasion what correlates with differentiated pathology of the tumors (34), we analyzed ERK phosphorylation as marker for ras activation or HER2 overexpression (35). The great majority of the mammary tumors were negative for ERK phosphorylation (Supplementary Figure S1a).

Mutations in p53 have also been related to the pathogenesis of breast carcinomas (36). However, p53 mutations are infrequent in DMBA-induced mammary tumors (37). Only one sarcomatous mammary tumor in a wild-type mouse carried a mutation in p53 (positive staining for p53, Supplementary Figure S1b).

ß-catenin is a cytoplasmic protein that plays essential roles in intracellular adhesion and Wnt-mediated transcriptional activation (for a review see ref. 38). Alterations in the Wnt/ß-catenin signaling pathway have been found in various human cancers, especially in breast tumors (39).

AKT can modulate the Wnt/ß-catenin pathway either by repressing E-cadherin expression (40) or through phosphorylation of GSK3ß, a kinase that controls ß-catenin degradation. Since tumors arising from the DMBA treatment in our transgenic mice overexpressed active AKT and showed phenotypic features similar to murine tumors with deregulated Wnt pathway, we analyzed whether this pathway was altered. We did not detect changes in the level of expression of E-cadherin in the epithelial component of the tumors nor in the expression or localization of ß-catenin (Supplementary Figure S2 and data not shown).

The previous data indicate that neither ras, HER2, p53 nor E-cadherin/ß-catenin were the genetic alterations cooperating with AKT1 in mammary tumorigenesis.

AKT1 expressing tumors overexpress the estrogen receptor
Estrogen is critical in the etiology of breast cancer and ER{alpha} mediates estrogen responsiveness in these tumors (41,42). Deregulation of ER{alpha} expression has been reported during the premalignant and malignant stages of human breast carcinogenesis (4345). We analyzed by immunohistochemistry the status of ER{alpha} expression in mammary gland benign lesions and tumors from wild-type and transgenic mice. All the benign lesions and mammary tumors were ER{alpha} positive (Figure 5). However, we detected an increase in number and clustering of ER{alpha} positive cells in tumors arising in the AKT transgenic lines (Figure 5a). ER{alpha} expression was not associated with a specific mammary tumor. The level of ER{alpha} expression seemed to be associated with the level of AKT expression, since ER{alpha} levels were higher in tumors arising in myrAKT transgenic lines (Figure 5a). This correlates with the fact that both benign lesions and mammary tumors are more frequent in MMTV-myrAKT transgenic mice than in wild-type mice (Table I). Staining for ER-{alpha} in transgenic mice was mainly detected in cells that also stained for keratin 8 (a marker for ductal epithelial cells in the breast) or in squamous differentiated cells that had lost the staining for keratin 8 and showed staining for keratin 14. Thus, ER-{alpha} expression is limited to epithelial tumor cells in myrAKT-induced mammary tumors. By contrast, in wild-type mice staining for ER-{alpha} was detected in stromal and epithelial cells. Several in vitro studies and in vivo studies have suggested the existence of a cross-talk between AKT and ER{alpha} (17,46,47). AKT can phosphorylate and activate human ER{alpha} at Ser167 in vitro, in cell culture systems, in the ligand independent transcriptional activation domain (AF1), and in vivo in a model of an endometrioid subtype of endometrial cancer developed by Pten+/– mice (18,47,48). To assess whether this functional link exists in our model, we did immunohistochemistry on serial sections of benign and tumoral mammary lesions from wild-type and transgenic mice using antibodies recognizing the phosphorylated, active forms of both AKT (Ser473) and ER{alpha} (Ser171) (which is equivalent to Ser167 in human ER{alpha}, and correacts with the antibody raised against the human protein). The benign lesions as well the tumors of transgenic mice showed strikingly areas with increased phosphoprotein levels of both AKT and ER{alpha}, (Figure. 5b–d). However, the mammary tumors of wild-type mouse express lowest levels of both active AKT and Ser171-phosphorylated ER{alpha} (Figure 5d). This observation could suggest a direct causal relationship between AKT activation and ER{alpha} phosphorylation in vivo.


Figure 5
View larger version (105K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Estrogen receptor {alpha} expression in DMBA-induced mammary tumors and benign lesions, and its phosphorylation by activated AKT. Representative immunohistochemical staining sections of tumors from EA2 (A and B) and EA4 transgenic mice (C and D) for ER{alpha} (a) and phosphoS167 ER{alpha} (b). A 200x magnification was used and a 400x magnification was inserted in the corner. AKT (S473) and ER{alpha} (S167) phosphorylation in DMBA-induced benign mammary lesions (c) and mammary tumors (d). (c) Representative immunohistochemical staining sections of a fibroadenoma from a transgenic mouse stained with anti-phospho S473-AKT (A) and anti-phospho S167 ER{alpha} (B). A 400x magnification was used. (d) Representative sections of witld-type (A and D), EA2 (B and E) and EA4 (C and F) mammary tumors, stained with anti-phospho S473-AKT (A–C) and anti-phospho S167 ER{alpha} (D--F). A 400x magnification was used.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
In the present study we examine the consequences that AKT-1 activation in the mammary gland epithelium has on the development of DMBA-induced mammary tumors. We describe the generation and analysis of mice carrying a MMTV-myrAKT1 transgene. Since no activating mutations have been described in human tumors, myristoylation of AKT is a well-accepted mechanism to target AKT to the membrane to produce its constitutive activation. The transgene was maintained in a C57BL6 genetic background, highly resistant to spontaneous mammary tumor formation (45). We used it in an attempt to reduce the tumoral background in non-transgenic control mice. C57BL6 mice treated with DMBA after pituitary isograft show a low mammary tumor incidence (32%), and hyperplasic alveolar nodules are rare when compared with other backgrounds (1), but overexpression of myrAKT without pituitary isograft leads to a clear increase in the incidence of epithelial tumors, among them mammary tumors (Figure 2c and d). DMBA carcinogenic treatment did not produce differences in disease-free survival between wild-type and transgenic animals (Figure 2B). Most wild-type mice died because of non-epithelial tumors, probably due to the toxicity of DMBA both in lymphoid and non-lymphoid tissues (49).

We found that mammary tumors induced by DMBA in myrAKT1 transgenic mice were heterogeneous, including adenosquamous carcinomas, and adenocarcinomas poorly differentiated or with papillary differentiation. The incidence of adenosquamous carcinoma was the same for both transgenic lines and adenocarcinoma as well, but there is a slight difference in the grade of differentiation between both transgenic lines. In EA2 transgenic mice the predominant adenocarcinoma type was invasive poorly differentiated while in EA4 transgenic mice adenocarcinoma with papillary differentiation was as frequent as poorly differentiated (Table I). These two types of tumors showed the highest histopathological similarity to human mammary tumors. By contrast, tumors from wild-type mice were high-grade sarcomas, carcinosarcomas with bone and cartilage metaplasia or condroid component, or malignant fibroadenomas (Table I).

The pathogenesis of human breast cancer is thought to involve multiple genetic events, the majority of which fall into two categories, gain-of-function mutations in protooncogenes such as c-myc, cyclinD1, HER-2 and various growth factors which are involved in supporting cell growth, division and survival and loss-of-function mutations in so-called tumor suppressor genes. Our data indicate that mammary tumors in the myr-AKT transgenic mice overexpress activated AKT, but this overexpression by itself is unable to induce mammary tumors. This means that it needs another oncogenic event that eventually would cooperate with the overexpression of AKT in the mammary tumorigenesis.

Overexpression of cyclin D1 and elevated levels of cytoplasmic p27 have been well documented in the pathogenesis of breast cancer in humans (50,51). We have detected cyclinD1 overexpression and nuclear expression of p27 in mammary tumors from both wild-type and transgenic mice (Figure 4c and d), but we could not find a correlation with the overexpression of activated AKT1, in line with previous results obtained in DMBA-treated rats and mice (52,53).

H-ras mutation is a hallmark of DMBA–TPA- induced skin tumorigenesis, and it is also found in DMBA-induced mammary gland tumors in wild-type animals (33). It has been described that 70% of the carcinomas from DMBA/TPA-treated Pten+/– mice do not exhibit this mutation, and in all the cases have lost the wild-type Pten allele. Tumors that retain the Pten wild-type allele also have H-ras mutations, indicating that activation of H-ras and complete loss of Pten wild-type allele are mutually exclusive events in skin carcinomas (54). Our results in mammary tumors also showed that overexpression of active AKT1 and ras mutations are mutually exclusive, since we didn’t detect any mutation in any of the three ras genes in mammary tumors. In the same way we can exclude that HER2 and p53 are the genetic alterations cooperating. In our model as in the mammary tumors developed by bitransgenic mice expressing AKT-1 and HER2, the tumors are poorly invasive and rarely metastasized. In both cases this behavior could be correlated with a more differentiated phenotype, which has a negative correlation with metastasis. The difference between our model and the bitransgenic mice expressing AKT-1 and HER2 is the speed of the tumor progression. The bitransgenic tumors have a very short latency, which correlates with an increase in the expression of cyclin D1. In our model cyclin D1 nor p27 seems to have tumorigenic relevance.

Estrogen induction of proliferation in normal cells from responsive tissues has been considered a stimulus for the initiation and promotion of tumorigenesis in these organs. The upregulation of the C16 alpha-hydroxylation pathway during 17beta-estradiol (E2) metabolism has been associated with the transformation of mammary cells. DMBA treatment upregulates the ratio of 16 alpha/C2 hydroxylation of E2 leading to increased formation of 16-alpha-OHE1 (55).

In our mouse model, both benign lesions and mammary tumors induced by DMBA were ER positive. Moreover, the overexpression of activated AKT1 induced an increase of ER{alpha} staining, number of ER{alpha} positive cells and frequency of benign and tumoral lesions. These results allow us to suggest a cooperation between the AKT and ER{alpha} pathways. Female estrogens stimulate the MMTV promoter, which would activate AKT thus selecting tumors AKT+/ER+. However, we have identified both, ER+ and ER– cells in mammary ducts of virgin females overexpressing AKT, suggesting an initial activation of the transgene by female hormones with further cooperation with ER. In this case, it is possible that the tumors arise only from AKT+/ER+ cells underlining the AKT–ER cooperation in mammary tumorigenesis.

It has been described that constitutively active AKT may phosphorylate ER{alpha} resulting in alteration of gene expression and activity independently of estrogen (18,46). Moreover, it has been suggested that in endometrial lesions as a consequence of the loss of Pten, the supraphysiologic activation of ER{alpha} as a direct consequence of AKT activation is an obligatory pathway for the development of these tumors (47). Additionally, AKT can phosphorylate FKHR and inhibit its co-repressor function on ER{alpha} (56). AKT activity has also been linked to both the proliferative and anti-apoptotic effects of ER{alpha} in breast tumor cells, in estrogen-dependent and independent ways. Therefore, the overexpression of activated AKT might cooperate with ER{alpha} activity in the development of mammary tumors induced by DMBA. In our model we have observed that both benign lesions and mammary tumor with higher levels of activated AKT1, also show higher levels of phosphorylated ER{alpha}, indicating that AKT-mediated phosphorylation of ER{alpha} could significantly enhance the receptor response and thus contribute to the initiation of the neoplastic process. It is possible that the initial upregulation of 16-alpha-OHE1 by the DMBA treatment (55) enhanced the MMTV activation of the transgene, increasing the levels of active AKT1. In this case the very high levels of active AKT could be responsible of the increased incidence of epithelial tumors observed. Nevertheless, in our hands, homozygous myrAKT (tg/tg) alone did not show this tumoral phenotype (data not shown). These could indicate that estrogen could cooperate with AKT activation and ER{alpha} to facilitate the neoplastic process as it has been suggested for the endometrial neoplastic transformation in Pten+/– mice. Recently it has been described a positive association between AKT and ERß in a clinical setting, as well as it has been shown the ability of AKT to regulate several components of ERß-mediated transcription (57). However, the E2-mediated upregulation of PI3K/AKT pathway is mediated by ER{alpha} but not by ERß (58). We cannot rule out the possible additional activation of ERß by activated AKT in our model.

Most human breast cancers (70%) are estrogen receptor positive and estrogen-dependent (59). Thus far, most established mouse models seldom produce ER{alpha}-positive mammary tumors (60). Among all estrogen receptor-positive tumors only 50% are responsive at first presentation to antiestrogens such as tamoxifen; and many become resistant to endocrine treatment, leading to tumor progression, metastasis and death (61). Therefore, a better knowledge of the factors influencing tumor sensitivity to various types of endocrine therapies is needed. We have found relevant human breast cancer characteristics in DMBA-induced mammary tumors from MMTV-myrAkt1 transgenic mice, as activated AKT, overexpression of cyclin D1 and coexpression of ER{alpha}. Furthermore, it has been described on breast cancer cells a molecular link between activation of the PI3K/AKT survival pathway, hormone-independent activation of ER{alpha} and chemoresistance (18,62). Moreover, studies with patients have linked activation of AKT with decreased overall survival in ER{alpha}-positive breast cancers treated with tamoxifen; and PI3KCA mutations have been associated with expression of estrogen and progesterone receptors, lymph node metastasis and ERBB2 overexpression (63). On the other hand, AKT is a new target broadly used to develop new antitumor therapies. Our model will also be useful regarding in vivo tests of new compounds inhibiting AKT or downstream proteins.

Therefore, we believe that the model described here would be suitable to study the effectiveness of novel therapies and the possible resistance to them, and to validate the possibility that AKT may be a novel molecular target for therapies that would improve the outcome of patients with breast cancer.


    Supplementary material
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
Supplementary material is available at carcinogenesis online.


    Acknowledgments
 
The authors acknowledge the members of the Assay Development Group and Nicolas Diaz-Chico for helpful discussions and critical reading of this manuscript; the Comparative Pathology Unit of the CNIO for the histological and immunohistochemical work, and their help in the design and construction of the TMA; the Trangenic Unit at the CNIO for the pronuclei microinjection; the Animal Facility Unit for the maintenance and care of the mice; and Wendy Colpoys for kindly providing the phosphoER{alpha} antibody. This work has been funded in part by Spanish Ministry of Health (FIS-02/0126), Fundacion Mutua Madrileña, Spanish Ministry of science and technology (SAF2005-00944) and Eli Lilly. Thanks are also due to Jim Thomas for his technical help and support.

Conflict of Interest Statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 

  1. Medina D. (1974) Mammary tumorigenesis in chemical carcinogen-treated mice. I. Incidence in BALB-c and C57BL mice. J. Natl Cancer Inst. 53:213–221.[Web of Science][Medline]
  2. Green K.A. and Streuli C.H. (2004) Apoptosis regulation in the mammary gland. Cell Mol. Life Sci. 61:1867–1883.[Web of Science][Medline]
  3. Schwertfeger K.L., Richert M.M., Anderson S.M. (2001) Mammary gland involution is delayed by activated Akt in transgenic mice. Mol. Endocrinol. 15:867–881.[Abstract/Free Full Text]
  4. Hutchinson J., Jin J., Cardiff R.D., Woodgett J.R., Muller W.J. (2001) Activation of Akt (protein kinase B) in mammary epithelium provides a critical cell survival signal required for tumor progression. Mol. Cell. Biol. 21:2203–2212.[Abstract/Free Full Text]
  5. Ackler S., Ahmad S., Tobias C., Johnson M.D., Glazer R.I. (2002) Delayed mammary gland involution in MMTV-AKT1 transgenic mice. Oncogene 21:198–206.[CrossRef][Web of Science][Medline]
  6. Staal S.P. (1987) Molecular cloning of the akt oncogene and its human homologues AKT1 and AKT2: amplification of AKT1 in a primary human gastric adenocarcinoma. Proc. Natl Acad. Sci. USA 84:5034–5037.[Abstract/Free Full Text]
  7. Jones P.F., Jakubowicz T., Hemmings B.A. (1991) Molecular cloning of a second form of rac protein kinase. Cell Regul. 2:1001–9.[Web of Science][Medline]
  8. Nakatani K., Sakaue H., Thompson D.A., Weigel R.J., Roth R.A. (1999) Identification of a human Akt3 (protein kinase B gamma) which contains the regulatory serine phosphorylation site. Biochem. Biophys. Res. Commun. 257:906–910.[CrossRef][Web of Science][Medline]
  9. Sarbassov D.D., Guertin D.A., Ali S.M., Sabatini D.M. (2005) Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307:1098–1101.[Abstract/Free Full Text]
  10. Feng J., Park J., Cron P., Hess D., Hemmings B.A. (2004) Identification of a PKB/Akt hydrophobic motif Ser-473 kinase as DNA-dependent protein kinase. J. Biol. Chem. 279:41189–41196.[Abstract/Free Full Text]
  11. Andjelkovic M., Alessi D.R., Meier R., Fernandez A., Lamb N.J., Frech M., Cron P., Cohen P., Lucocq J.M., Hemmings B.A. (1997) Role of translocation in the activation and function of protein kinase B. J. Biol. Chem. 272:31515–31524.[Abstract/Free Full Text]
  12. Bellacosa A., Chan T.O., Ahmed N.N., Datta K., Malstrom S., Stokoe D., McCormick F., Feng J., Tsichlis P. (1998) Akt activation by growth factors is a multiple-step process: the role of the PH domain. Oncogene 17:313–325.[CrossRef][Web of Science][Medline]
  13. Datta S.R., Dudek H., Tao X., Masters S., Fu H., Gotoh Y., Greenberg M.E. (1997) Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231–241.[CrossRef][Web of Science][Medline]
  14. Medema R.H., Kops G.J., Bos J.L., Burgering B.M. (2000) AFX-like Forkhead transcription factors mediate cell-cycle regulation by Ras and PKB through p27kip1. Nature 404:782–787.[CrossRef][Medline]
  15. Rossig L., Jadidi A.S., Urbich C., Badorff C., Zeiher A.M., Dimmeler S. (2001) Akt-dependent phosphorylation of p21(Cip1) regulates PCNA binding and proliferation of endothelial cells. Mol. Cell. Biol. 21:5644–5657.[Abstract/Free Full Text]
  16. Diehl J.A., Cheng M., Roussel M.F., Sherr C.J. (1998) Glycogen synthase kinase-3beta regulates cyclin D1 proteolysis and subcellular localization. Genes Dev. 12:3499–3511.[Abstract/Free Full Text]
  17. Martin M.B., Franke T.F., Stoica G.E., Chambon P., Katzenellenbogen B.S., Stoica B.A., McLemore M.S., Olivo S.E., Stoica A. (2000) A role for Akt in mediating the estrogenic functions of epidermal growth factor and insulin-like growth factor I. Endocrinology 141:4503–4511.[Abstract/Free Full Text]
  18. Campbell R.A., Bhat-Nakshatri P., Patel N.M., Constantinidou D., Ali S., Nakshatri H. (2001) Phosphatidylinositol 3-kinase/AKT-mediated activation of estrogen receptor alpha: a new model for anti-estrogen resistance. J. Biol. Chem. 276:9817–9824.[Abstract/Free Full Text]
  19. Ringel M.D., Hayre N., Saito J., Saunier B., Schuppert F., Burch H., Bernet V., Burman K.D., Kohn L.D., Saji M. (2001) Overexpression and overactivation of Akt in thyroid carcinoma. Cancer Res. 61:6105–6111.[Abstract/Free Full Text]
  20. Perez-Tenorio G. and Stal O. (2002) Activation of AKT/PKB in breast cancer predicts a worse outcome among endocrine treated patients. Br. J. Cancer 86:540–545.[CrossRef][Web of Science][Medline]
  21. Stal O., Perez-Tenorio G., Akerberg L., Olsson B., Nordenskjold B., Skoog L., Rutqvist L.E. (2003) Akt kinases in breast cancer and the results of adjuvant therapy. Breast Cancer Res. 5:R37–R44.[CrossRef][Web of Science][Medline]
  22. Fry M.J. (2001) Phosphoinositide 3-kinase signalling in breast cancer: how big a role might it play? Breast Cancer Res. 3:304–312.[CrossRef][Web of Science][Medline]
  23. Zhang P., Ostrander J.H., Faiver E.J., Olsen A., Fitzsimmons D., Lange C.A. (2004) Regulated association of PKB/Akt with breast tumor kinase (Brk). J. Biol. Chem. 280:1982–1991.
  24. Cantley L.C. and Neel B.G. (1999) New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc. Natl Acad. Sci. USA 96:4240–4245.[Abstract/Free Full Text]
  25. Li G., Robinson G.W., Lesche R., et al. (2002) Conditional loss of PTEN leads to precocious development and neoplasia in the mammary gland. Development 129:4159–4170.[Abstract/Free Full Text]
  26. Li Y., Podsypanina K., Liu X., Crane A., Tan L.K., Parsons R., Varmus H.E. (2001) Deficiency of Pten accelerates mammary oncogenesis in MMTV-Wnt-1 transgenic mice. BMC Mol. Biol. 2:2.[CrossRef][Medline]
  27. Mirza A.M., Kohn A.D., Roth R.A., McMahon M. (2000) Oncogenic transformation of cells by a conditionally active form of the protein kinase Akt/PKB. Cell Growth Differ. 11:279–292.[Abstract/Free Full Text]
  28. Blanco-Aparicio C., Pequeno B., Moneo V., Romero L., Leal J.F., Velasco J., Fominaya J., Carnero A. (2005) Inhibition of phosphatidylinositol-3-kinase synergizes with gemcitabine in low-passage tumor cell lines correlating with Bax translocation to the mitochondria. Anticancer Drugs 16:977–987.[CrossRef][Medline]
  29. Cross F.R., Garber E.A., Pellman D., Hanafusa H. (1984) A short sequence in the p60src N terminus is required for p60src myristylation and membrane association and for cell transformation. Mol. Cell. Biol. 4:1834–1842.[Abstract/Free Full Text]
  30. Yao Y., Slosberg E.D., Wang L., Hibshoosh H., Zhang Y.J., Xing W.Q., Santella R.M., Weinstein I.B. (1999) Increased susceptibility to carcinogen-induced mammary tumors in MMTV-Cdc25B transgenic mice. Oncogene 18:5159–5166.[CrossRef][Web of Science][Medline]
  31. Witty J.P., Lempka T., Coffey R.J. Jr, Matrisian L.M. (1995) Decreased tumor formation in 7,12-dimethylbenzanthracene-treated stromelysin-1 transgenic mice is associated with alterations in mammary epithelial cell apoptosis. Cancer Res. 55:1401–1406.[Abstract/Free Full Text]
  32. Cardiff R.D., Anver M.R., Gusterson B.A., et al. (2000) The mammary pathology of genetically engineered mice: the consensus report and recommendations from the Annapolis meeting. Oncogene 19:968–988.[CrossRef][Web of Science][Medline]
  33. Qing W.G., Conti C.J., LaBate M., Johnston D., Slaga T.J., MacLeod M.C. (1997) Induction of mammary cancer and lymphoma by multiple, low oral doses of 7,12-dimethylbenz[a]anthracene in SENCAR mice. Carcinogenesis 18:553–559.[Abstract/Free Full Text]
  34. Hutchinson J.N., Jin J., Cardiff R.D., Woodgett J.R., Muller W.J. (2004) Activation of Akt-1 (PKB-alpha) can accelerate ErbB-2-mediated mammary tumorigenesis but suppresses tumor invasion. Cancer Res. 64:3171–3178.[Abstract/Free Full Text]
  35. Amundadottir L.T. and Leder P. (1998) Signal transduction pathways activated and required for mammary carcinogenesis in response to specific oncogenes. Oncogene 16:737–746.[CrossRef][Web of Science][Medline]
  36. Hollstein M., Hergenhahn M., Yang Q., Bartsch H., Wang Z.Q., Hainaut P. (1999) New approaches to understanding p53 gene tumor mutation spectra. Mutat Res. 431:199–209.[Web of Science][Medline]
  37. Jerry D.J., Kittrell F.S., Kuperwasser C., Laucirica R., Dickinson E.S., Bonilla P.J., Butel J.S., Medina D. (2000) A mammary-specific model demonstrates the role of the p53 tumor suppressor gene in tumor development. Oncogene 19:1052–1058.[CrossRef][Web of Science][Medline]
  38. Miyoshi K. and Hennighausen L. (2003) Beta-catenin: a transforming actor on many stages. Breast Cancer Res. 5:63–68.[Web of Science][Medline]
  39. Meniel V. and Clarke A.R. (2003) Wnt-cadherin connections in normal and neoplastic mammary epithelium. J. Mammary Gland Biol. Neoplasia 8:435–447.[CrossRef][Web of Science][Medline]
  40. Grille S.J., Bellacosa A., Upson J., Klein-Szanto A.J., van Roy F., Lee-Kwon W., Donowitz M., Tsichlis P.N., Larue L. (2003) The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness of squamous cell carcinoma lines. Cancer Res. 63:2172–2178.[Abstract/Free Full Text]
  41. Marshall E. (1993) Epidemiology. Search for a killer: focus shifts from fat to hormones. Science 259:618–621.[Free Full Text]
  42. Seidman H., Stellman S.D., Mushinski M.H. (1982) A different perspective on breast cancer risk factors: some implications of the nonattributable risk. CA Cancer J. Clin. 32:301–313.[Free Full Text]
  43. Shoker B.S., Jarvis C., Clarke R.B., Anderson E., Hewlett J., Davies M.P., Sibson D.R., Sloane J.P. (1999) Estrogen receptor-positive proliferating cells in the normal and precancerous breast. Am. J. Pathol. 155:1811–1815.[Abstract/Free Full Text]
  44. Khan S.A., Rogers M.A., Khurana K.K., Meguid M.M., Numann P.J. (1998) Estrogen receptor expression in benign breast epithelium and breast cancer risk. J. Natl Cancer Inst. 90:37–42.[Abstract/Free Full Text]
  45. Turusov V.S., Morozova O.V., Samoilov D.V. (1994) Estrogen modification of 1,2-dimethylhydrazine carcinogenesis in C3HA mice. Cancer Lett. 83:51–58.[CrossRef][Web of Science][Medline]
  46. Stoica G.E., Franke T.F., Moroni M., et al. (2003) Effect of estradiol on estrogen receptor-alpha gene expression and activity can be modulated by the ErbB2/PI 3-K/Akt pathway. Oncogene 22:7998–8011.[CrossRef][Web of Science][Medline]
  47. Vilgelm A., Lian Z., Wang H., Beauparlant S.L., Klein-Szanto A., Ellenson L.H., Di Cristofano A. (2006) Akt-mediated phosphorylation and activation of estrogen receptor alpha is required for endometrial neoplastic transformation in Pten+/– mice. Cancer Res. 66:3375–3380.[Abstract/Free Full Text]
  48. Sun M., Paciga J.E., Feldman R.I., Yuan Z., Coppola D., Lu Y.Y., Shelley S.A., Nicosia S.V., Cheng J.Q. (2001) Phosphatidylinositol-3-OH Kinase (PI3K)/AKT2, activated in breast cancer, regulates and is induced by estrogen receptor alpha (ERalpha) via interaction between ERalpha and PI3K. Cancer Res. 61:5985–5991.[Abstract/Free Full Text]
  49. Aldaz C.M., Liao Q.Y., LaBate M., Johnston D.A. (1996) Medroxyprogesterone acetate accelerates the development and increases the incidence of mouse mammary tumors induced by dimethylbenzanthracene. Carcinogenesis 17:2069–2072.[Abstract/Free Full Text]
  50. Weinstat-Saslow D., Merino M.J., Manrow R.E., Lawrence J.A., Bluth R.F., Wittenbel K.D., Simpson J.F., Page D.L., Steeg P.S. (1995) Overexpression of cyclin D mRNA distinguishes invasive and in situ breast carcinomas from non-malignant lesions. Nat. Med. 1:1257–1260.[CrossRef][Web of Science][Medline]
  51. Fredersdorf S., Burns J., Milne A.M., et al. (1997) High level expression of p27(kip1) and cyclin D1 in some human breast cancer cells: inverse correlation between the expression of p27(kip1) and degree of malignancy in human breast and colorectal cancers. Proc. Natl Acad. Sci. USA 94:6380–6385.[Abstract/Free Full Text]
  52. Shan L., He M., Yu M., Qiu C., Lee N.H., Liu E.T., Snyderwine E.G. (2002) cDNA microarray profiling of rat mammary gland carcinomas induced by 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine and 7,12-dimethylbenz[a]anthracene. Carcinogenesis 23:1561–1568.[Abstract/Free Full Text]
  53. Wijnhoven S.W., Zwart E., Speksnijder E.N., et al. (2005) Mice expressing a mammary gland-specific R270H mutation in the p53 tumor suppressor gene mimic human breast cancer development. Cancer Res. 65:8166–8173.[Abstract/Free Full Text]
  54. Mao J.H., To M.D., Perez-Losada J., Wu D., Del Rosario R., Balmain A. (2004) Mutually exclusive mutations of the Pten and ras pathways in skin tumor progression. Genes Dev. 18:1800–1805.[Abstract/Free Full Text]
  55. Telang N.T., Suto A., Wong G.Y., Osborne M.P., Bradlow H.L. (1992) Induction by estrogen metabolite 16 alpha-hydroxyestrone of genotoxic damage and aberrant proliferation in mouse mammary epithelial cells. J. Natl Cancer Inst. 84:634–638.[Abstract/Free Full Text]
  56. Zhao H.H., Herrera R.E., Coronado-Heinsohn E., et al. (2001) Forkhead homologue in rhabdomyosarcoma functions as a bifunctional nuclear receptor-interacting protein with both coactivator and corepressor functions. J. Biol. Chem. 276:27907–27912.[Abstract/Free Full Text]
  57. Duong B.N., Elliott S., Frigo D.E., et al. (2006) AKT Regulation of Estrogen Receptor {beta} Transcriptional Activity in Breast Cancer. Cancer Res. 66:8373–81.[Abstract/Free Full Text]
  58. Lee Y.R., Park J., Yu H.N., Kim J.S., Youn H.J., Jung S.H. (2005) Up-regulation of PI3K/Akt signaling by 17beta-estradiol through activation of estrogen receptor-alpha, but not estrogen receptor-beta, and stimulates cell growth in breast cancer cells. Biochem. Biophys. Res. Commun. 336:1221–1226.[CrossRef][Web of Science][Medline]
  59. Greenwald P. (2004) Clinical trials in cancer prevention: current results and perspectives for the future. J. Nutr. 134:3507S–3512S.[Abstract/Free Full Text]
  60. Nandi S., Guzman R.C., Yang J. (1995) Hormones and mammary carcinogenesis in mice, rats, and humans: a unifying hypothesis. Proc. Natl Acad. Sci. USA 92:3650–3657.[Abstract/Free Full Text]
  61. Osborne C.K. (1998) Tamoxifen in the treatment of breast cancer. N. Engl. J. Med. 339:1609–1618.[Free Full Text]
  62. Knuefermann C., Lu Y., Liu B., Jin W., Liang K., Wu L., Schmidt M., Mills G.B., Mendelsohn J., Fan Z. (2003) HER2/PI-3K/Akt activation leads to a multidrug resistance in human breast adenocarcinoma cells. Oncogene 22:3205–3212.[CrossRef][Web of Science][Medline]
  63. Saal L.H., Holm K., Maurer M., et al. (2005) PIK3CA mutations correlate with hormone receptors, node metastasis, and ERBB2, and are mutually exclusive with PTEN loss in human breast carcinoma. Cancer Res. 65:2554–9.[Abstract/Free Full Text]
Received July 4, 2006; revised September 25, 2006; accepted October 2, 2006.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
P. Bhat-Nakshatri, G. Wang, N. R. Collins, M. J. Thomson, T. R. Geistlinger, J. S. Carroll, M. Brown, S. Hammond, E. F. Srour, Y. Liu, et al.
Estradiol-regulated microRNAs control estradiol response in breast cancer cells
Nucleic Acids Res., June 14, 2009; (2009) gkp500v1.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Bhat-Nakshatri, G. Wang, H. Appaiah, N. Luktuke, J. S. Carroll, T. R. Geistlinger, M. Brown, S. Badve, Y. Liu, and H. Nakshatri
AKT Alters Genome-Wide Estrogen Receptor {alpha} Binding and Impacts Estrogen Signaling in Breast Cancer
Mol. Cell. Biol., December 15, 2008; 28(24): 7487 - 7503.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. Renner, C. Blanco-Aparicio, M. Grassow, M. Canamero, J. F.M. Leal, and A. Carnero
Activation of Phosphatidylinositol 3-Kinase by Membrane Localization of p110{alpha} Predisposes Mammary Glands to Neoplastic Transformation
Cancer Res., December 1, 2008; 68(23): 9643 - 9653.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. K. de Ostrovich, I. Lambertz, J. K. L. Colby, J. Tian, J. E. Rundhaug, D. Johnston, C. J. Conti, J. DiGiovanni, and R. Fuchs-Young
Paracrine Overexpression of Insulin-Like Growth Factor-1 Enhances Mammary Tumorigenesis in Vivo
Am. J. Pathol., September 1, 2008; 173(3): 824 - 834.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Segrelles, J. Lu, B. Hammann, M. Santos, M. Moral, J. L. Cascallana, M. F. Lara, O. Rho, S. Carbajal, J. Traag, et al.
Deregulated Activity of Akt in Epithelial Basal Cells Induces Spontaneous Tumors and Heightened Sensitivity to Skin Carcinogenesis
Cancer Res., November 15, 2007; 67(22): 10879 - 10888.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
C. Blanco-Aparicio, O. Renner, J. F.M. Leal, and A. Carnero
PTEN, more than the AKT pathway
Carcinogenesis, July 1, 2007; 28(7): 1379 - 1386.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/3/584    most recent
bgl190v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Blanco-Aparicio, C.
Right arrow Articles by Carnero, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanco-Aparicio, C.
Right arrow Articles by Carnero, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?