Carcinogenesis Advance Access originally published online on September 28, 2006
Carcinogenesis 2007 28(3):639-647; doi:10.1093/carcin/bgl169
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Identification of kaempferol as an inhibitor of cigarette smoke-induced activation of the aryl hydrocarbon receptor and cell transformation
Department of Molecular and Biomedical Pharmacology, MS 305 University of Kentucky Medical Center KY 40536, USA
1 Graduate Center for Toxicology, University of Kentucky, Lexington KY 40536, USA
*To whom correspondence should be addressed at: Department of Molecular and Biomedical Pharmacology, UKMC MS-305, 800 Rose Street, Lexington, KY 40536-0084, USA. Tel: +1 859 323 1463; Fax: +1 859 323 1981; Email: hswan{at}uky.edu
| Abstract |
|---|
|
|
|---|
The aryl hydrocarbon receptor (AHR) is a cytosolic receptor which upon activation by its agonists, translocates into the nucleus and forms a dimer with ARNT (aryl hydrocarbon nuclear translocator). The AHR/ARNT dimer regulates the expression of its target genes by binding to DNA recognition elements termed dioxin responsive elements (DREs). Many AHR agonists, like the polyaromatic hydrocarbons and polyhalogenated hydrocarbons are known human carcinogens. Human exposure to these compounds is common due to their presence in air pollution and cigarette smoke. Interestingly, many dietary constituents that have chemo preventative properties have been found to also act as antagonists of the AHR pathway. Thus, a chemopreventive approach that may be effective in decreasing the incidences of many human cancers may involve a dietary regimen that includes a number of these naturally occurring AHR antagonists. With this idea in mind, we have assayed the ability of 15 flavonoids to inhibit AHR activated reporter activity and selected kaempferol for further analysis. Kaempferol proved to be capable of inhibiting binding of agonist and agonist-induced formation of the AHR/ARNT DNA-binding complex and upregulation of the AHR target gene, CYP1A1. Using an in vitro paradigm of events that are thought to occur during cigarette-smoke-induced lung cancer, we found that kaempferol also inhibited the ability of cigarette smoke condensate to induce growth of immortalized lung epithelial (BEAS-2B) cells in soft agar. Taken together, these results illustrate the promise associated with the use of flavonoids, that inhibit both AHR signaling and the carcinogenic actions of AHR agonists, for chemopreventive purposes.
Abbreviations: AHR, aryl hydrocarbon receptor; ARNT, aryl hydrocarbon nuclear translocator; bHLH, basic helixloophelix; conDRE, consensus DRE; CSC, cigarette smoke condensate; DRE, dioxin responsive elements; MNF, 3'-methoxy-4'-nitroflavone; mutDRE, mutated DRE; TCDD, 2,3,7,8 tetrachlorodibenzo-p-dioxin.
| Introduction |
|---|
|
|
|---|
The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor belonging to the basic helixloophelix (bHLH)-PAS family (1,2). Prior to ligand-binding, the AHR resides primarily in the cytoplasm as part of a multi protein complex consisting of two molecules of chaperone protein hsp90 (90 kDa heat shock protein), an X-associated protein2 (XAP2) and a 23 kDa co-chaperone protein, p23. The ligand-bound AHR undergoes a series of transformation processes, leading to the exposure of a nuclear-localization signal present in the N-terminal bHLH domain and translocation of the protein complex into the nucleus. Once in the nucleus, the AHR interacts with its dimerization partner, aryl hydrocarbon nuclear translocator (ARNT), also known as hypoxia inducible factor ß. The formation of the AHR/ARNT dimerization complex converts the AHR into a high affinity DNA-binding form that recognizes specific DNA recognition sites termed DREs. In this manner, the agonist activated AHR upregulates a battery of target genes, including those involved in the metabolism of chemical carcinogens, such as CYP1A1 and CYP1B1.
Most of the studies addressing the effects of AHR agonists have been performed using 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD), as the prototypical agonist, as it binds the AHR with high affinity and specificity (2). However, additional agonists that have been identified include other xenobiotics, such as the polyhalogenated and polychlorinated aromatic hydrocarbons that are ubiquitous environmental contaminants and those postulated to act as its endogenous agonists, such as 2-(1'H-indole-3'carbonyl)-thiazole-4-carboxylic acid methyl ester (3). Many of the polyhalogenated and polychlorinated aromatic hydrocarbons that act as AHR agonists are classified as human carcinogens that are constituents of air pollution and cigarette smoke and thus are frequently encountered by a significant segment of the human population (4). In fact, it is their presence in cigarette smoke that is thought to make a major contribution to the events that occur in the development of cigarette-smoke-induced cancers associated with the oral cavity, esophagus and lung (5). With respect to lung cancer alone, exposure to cigarette smoke has been postulated to account for 90% of lung cancer cases and
1.2 million deaths a year (6).
The carcinogenic actions of many polyaromatic hydrocarbons (PAHs) require the AHR. For example, using the mouse skin carcinogenesis model, it has been shown that mice that lack the expression of the AHR (AHR/) have a significantly lower tumor burden than the wild-type mice following exposure to either benzo[a]pyrene (7) or dibenzo[a,l]pyrene (8). Similar results have been obtained using cigarette smoke condensate (CSC) as the initiating agent. For example, using the formation of micronucleated erythrocytes as an indicator of cigarette-smoke-induced genotoxicity, it was found that the frequency of micronucleated erythrocytes induced by CSC was significantly higher in the AHR+/+ versus the AHR/ mice (9).
Since the AHR plays an important role in mediating the carcinogenic properties of many constituents of cigarette smoke, it is plausible that an appropriate antagonist(s) that inhibits the AHR pathway could serve as a chemoprotective agent that would attenuate the rates of cigarette-smoke-induced lung cancer. Of the few AHR antagonists currently available, the most potent, MNF (3'-methoxy-4'-nitroflavone) (10,11), has recently been discovered to act as a weak agonist that is capable of inducing the classic AHR target gene, CYP1A1 (12). However, other flavonoids have also been reported to act as antagonists of the AHR pathway (2,1320) and have also been shown to exhibit a number of beneficial properties including inhibition of the progression of cancer (2124), cardiovascular diseases (25,26) and neuro-degenerative disorders (27,28). These activities have been attributed to their ability to act as potent anti-oxidants (29), COX inhibitors (30) and anti-inflammatory agents (31), inhibitors of mitogen signaling (32) and cell-cycle progression (33) and inducers of apoptosis (34). The extent to which their interaction with the AHR contributes to these beneficial effects of flavonoids is poorly understood.
In this study, we have tested the hypothesis that antagonizing the AHR pathway using naturally occurring compounds can be of value in preventing the adverse effects associated with AHR agonists, in particular, those found in cigarette smoke. Towards this end, we report that kaempferol not only blocks the agonistic effect of TCDD and CSC on the AHR-signaling pathway but also reduces the number of cells transformed by CSC.
| Materials and methods |
|---|
|
|
|---|
Materials
Benzo(a)pyrene was a generous gift from Dr. Kenneth Ramos (University of Louisville, KY) TCDD and MNF (3'-methoxy-4'-nitroflavone) were gifts from Dr Stephen H. Safe (Texas A&M University, College Station, TX) and Dr Thomas A. Gaseiwicz (University of Rochester, Rochester, NY) respectively. CSC was generated as previously described (35). Unless otherwise mentioned, all chemicals were purchased from Sigma or Aldrich. [3H]-TCDD was obtained from ChemSyn Laboratories (Lenexa, KS).
Cell culture
Human hepatoma (HepG2) cells that were stably transfected with the CYP1A1 promoter upstream of the luciferase reporter gene (HepG2-p450luc) (36) and Hepa-1c1c7 cells were maintained in Dulbecco's Modified Eagle's Media (DMEM) with glucose and glutamine (Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum (FBS) (Invitrogen Life Technologies, Carlsbad, CA) at 37°C and 5% CO2. BEAS-2B cells were a gift from Dr Chendil and were maintained in BEGM®Bronchial Epithelial Medium (Cambrex Bio Science Rockland, ME) at 37°C and 5% CO2. The impact of flavonoid treatment on cell number was determined using the MTT assay (ATCC).
Luciferase assays
The HepG2-Luc cells were cultured in 96-well assay plates and pretreated with either DMSO alone or with the compounds at the indicated concentrations for 1 h. Subsequently, the cells were treated with TCDD (1 nM) for 4 h. The cells were then harvested and the CYP1A1 promoter activity was determined as a measure of luciferin generated using the Luciferase Assay System kit from Promega according to the manufacturer's protocol using TR 717 Microplate Luminometer from Applied Biosystem (Foster City, CA).
Electrophoretic mobility shift assays (EMSA)
The impact of kaempferol on the AHR/ARNT DNA-binding complex formed in cultured cells was determined by treating HepG2 cells with kaempferol for 1 h prior to the administration of either DMSO (0.01%) or TCDD (1 nM). After 1 h incubation, the cells were harvested and nuclear extracts were prepared using the Nucbuster protein extraction kit from Novagen (Madison, Wis.). Aliquots of the extracts (12 µg) were incubated with salmon sperm DNA (1 µg) and KCL (0.1 M final concentration) at room temperature for 15 min. The samples were then incubated for 15 min at room temperature with the radiolabeled (32P) consensus DRE sequences (underlined) (5'-TCGAGC TGGGGGCATTGCGTGACATTAC and 3'-TCGAGGTATGTCACGC AATGCC CCCAGC as previously described (37). In some cases, a 50-fold molar excess of either the consensus DRE (conDRE) or mutated DRE (mtDRE) (37) was added 15 min prior to the addition of the probe. For supershift analysis, the samples were incubated with 2 µg of mouse anti-AHR (Santa Cruz) or anti-rabbit IgG. After a 15 min incubation, samples were separated using 4% acrylamide non-denaturing gel electrophoresis and 0.5x TBE (45 mM Tris base, 45 mM boric acid and 1 nM EDTA, pH 8.0) as running buffer. In vitro formation of the DNA-binding complexes of the AHR and ARNT proteins was performed following in vitro synthesis using pmuAhR and phuARNT plasmids (36,38) and the TNT Coupled Reticulocyte Lysate System from Promega according to the manufacturer's protocol. Aliquots of the AHR and ARNT containing mixtures (2.5 µl) were then incubated with MENG buffer (25 mM MOPS, 1 mM EDTA, 3.8 mM NaN3 and 10% glycerol, pH 7.5) for 2 h at 30°C in the presence or absence of the indicated ligands. The samples were then subjected to EMSA as described above.
Ligand-binding assays
Ligand-binding assays were performed using cytosolic protein extracts from Hepa1c1c7 cells as described previously (39). Briefly, the Hepa1c1c7 cells were harvested and the protein was extracted by resuspending the cell pellet in HEDG buffer (25 mM HEPES, 1 mM EDTA, 1 mM DTT and 10% (v/v) glycerol, pH 7.5) containing 0.4 mM leupeptin, 4 mg/ml aprotinin and 0.3 mM PMSF. The samples were then homogenized and centrifuged at 10 000 r.p.m. for 10 min. Protein concentrations in the supernatant were quantitated using BCA protein assay reagents (Pierce, Rockford, IL). Aliquots of protein (200 µg) were then incubated at room temperature for 2 h with 3 nM of [3H]-TCDD in the absence or presence of varying concentrations of kaempferol. After the incubation, hydroxyapatite gel was added to the samples and incubated on ice for 30 min. Following this incubation, HEDG buffer containing 0.5% Tween-80 was added, centrifuged, washed twice and resuspended in 200 µl of scintillation fluid and subjected to scintillation counting. Total binding of TCDD was estimated by using [3H]-TCDD alone and non-specific binding determined using a 200 molar excess of unlabeled TCDF (tetrachlorodibenzofuran). Specific binding values were obtained by subtracting total binding from non-specific binding. The values were then expressed as a percent of TCDD in the absence of competitor.
Western blot analysis
BEAS-2B cells (human bronchial epithelial cells) were pre-treated with kaempferol for 4 h followed by the addition of either TCDD (1 nM) or CSC (25 µg). A 4-h pretreatment with kaempferol was used for these experiments to ensure that sufficient inhibition of CYP1A1 induction would be observed. After a 68-h incubation, the cells were harvested and the total cellular extracts were prepared using F buffer (10 mM Tris, 50 mM NaCl, 30 mM sodium pyrophosphate, 50 mM NaF, 5 µM ZnCl2, 0.1 mM Na3VO4, 1% Triton X-100, 1 mM PMSF, 5 U/ml
2-macroglobulin, 2.5 U/ml pepstatin A, 2.5 U/ml leupeptin, 150 µM benzamidine and 2.8 µg/ml aprotinin; pH 7.05). The protein concentrations were estimated using BCA analysis. Aliquots of cellular extracts (
100 µg) were separated by sodium dodecyl sulfate gel electrophoresis and the proteins were transferred to nitrocellulose. After a brief incubation in blocking buffer, the blots were probed using antibodies that recognized AHR (Abcam, Cambridge MA), CYP1A1 (Santa Cruz Biotechnology, Santa Cruz CA) and ß-actin (Sigma, St Louis, MO).
Cell transformation assays
The BEAS-2B cells were pre-treated with kaempferol (1 x 105 M) for 4 h followed by the addition of either CSC (25 µg/ml) (35) or benzo[a]pyrene (100 nM) (40). After 68 h, the cells were harvested and counted using a hemocytometer. For the soft agar assays, a 0.8% of soft agar base layer followed by 0.4% top agar layer containing the cells was applied to 6-well plates. Cell culture media on top of the 0.4% top agar layer was changed twice every week. After 3 (CSC-treated) or 7 weeks (benzo[a]pyrene-treated), the colonies formed were stained using 0.005% crystal violet stain, visualized using reverse phase contrast microscopy and quantitated.
Statistical analysis
The data was analyzed, where indicated, using one-way ANOVA followed by either Tukey's or Dunnett's multiple comparison tests (Graph Pad Prism 3.0).
| Results |
|---|
|
|
|---|
Select flavonoids inhibit TCDD-induced CYP1A1 promoter activity
An increasing body of literature supports the idea that naturally occurring plant components may be effective antagonists of the AHR-signaling pathway (13,1520,41). Based on these previous studies and their structural similarities with known AHR ligands, we chose 15 flavonoids for our analyses. As a first step we compared their relative biological potencies with respect to their AHR antagonistic properties by performing a screen that utilized a stable human hepatoma cell line (HepG2-p450luc) that contains the luciferase reporter gene regulated by the CYP1A1 promoter (36). In these assays, we included the previously characterized AHR antagonist, MNF (10,42) to serve as a positive control that would inhibit TCDD-induced luciferase activity. As shown in Figure 1A, administration of luteolin, morin, naringenin, hesperitin, or PD98059 alone, or in combination with TCDD revealed that these compounds did not significantly inhibit TCDD-induction of CYP1A1 promoter activity. Further screening identified curcumin, resveratrol (Figure 1B), apigenin, chrysin, kaempferol, emodin and piperine (Figure 1C) as more promising AHR antagonists as they appeared to be effective in inhibiting TCDD-induced gene transcription. However, at high concentrations (i.e., 1 x 105 M) some, in particular, emodin and piperine also inhibited basal (DMSO-treated) activity which may be indicative of either inhibition of endogenous activity or non-specific cytoxicity. Further, while apigenin significantly inhibited the actions of TCDD in this assay (at a concentration of 1 x 105 M), its increasing agonistic activity observed as its concentration decreased indicated that this compound may be capable of exerting mixed AHR agonist/antagonist actions. To evaluate the possible cytotoxic actions of apigenin, kaempferol and emodin, we utilized the MTT assay and quantitated cell numbers. While treatment with either apigenin or kaempferol appeared to increase the cell number, with that of emodin significantly decreased the cell number (Figure 1D). Given these results, emodin was excluded from further analyses.
|
In summary, these analyses revealed that of the flavonoids tested, kaempferol appears to be the most promising AHR antagonist based on (i) its lack of a doseresponsive agonist activity, (ii) its lack of overt cytotoxic actions, and (iii) its ability to inhibit TCDD-induction of CYP1A1 promoter activity in a dose-responsive manner.
Inhibition of in vitro formation of the AHR/ARNT DNA-binding complex by kaempferol
Our next goal was to determine whether kaempferol was also capable of inhibiting in vitro formation of the AHR/ARNT/DNA-binding complex. Towards this end, in vitro synthesized AHR and ARNT proteins were incubated with the AHR agonist, BNF, in the absence or presence of kaempferol and formation of the AHR/ARNT DNA-binding complex was evaluated using EMSA. For these experiments, we used AHR encoded by the mouse AHRb1 allele (rather than the human AHR) given that this form of the AHR is highly responsive to in vitro formation of the AHR/ARNT complex. As reported previously (37), incubation with BNF induced the formation of the AHR/ARNT DNA-binding complex (Figure 2A, lanes 1 and 2). Our choice of BNF, rather than TCDD for use in these experiments was based on our unpublished findings that, in these in vitro conditions BNF is more effective than TCDD in inducing formation of the AHR/ARNT DNA-binding complex. Treatment with kaempferol alone did not significantly induce formation of the AHR/ARNT/DNA-binding complex (Figure 2A, lanes 35 and B). However, kaempferol inhibited the ability of BNF to induce formation of the AHR/ARNT DNA-binding complex at all concentrations tested (Figure 2A, lanes 68 and B).
|
Inhibition of agonist-induced formation of the AHR/ARNT/DNA-binding complex by kaempferol in cultured cells
To further characterize the impact of kaempferol on agonist induction of the AHR-signaling pathway in a human cell line, we questioned whether these flavonoids would be effective in inhibiting the ability of an AHR agonist to activate formation of the AHR/ARNT DNA-binding complex in intact cells derived from a human source. Towards this end, HepG2 cells were treated with kaempferol prior to the addition of TCDD, nuclear extracts were prepared and formation of the AHR/ARNT/DNA complex was evaluated again using EMSA. A 1-h pretreatment with kaempferol was performed based on our previous observations that nuclear localization of the AHR initiated by many ligands is typically maximal following a 1-h incubation. As shown in Figure 2C, TCDD treatment induced formation of a specific DNA-binding complex (lanes 1 and 2). The presence of the AHR in this complex was confirmed by the ability of the AHR (Figure 2C, lane 3), but not non-specific antibody (Figure 2C, lane 4) to supershift the complex. Like that observed in Figure 2A, treatment with kaempferol alone failed to induce formation of the AHR/ARNT DNA-binding complex indicating that it does not act as an AHR agonist (Figure 2C, lane 5). However, treatment with kaempferol at a concentration of 1 x 105 M prior to the administration of TCDD blocked formation of the AHR/ARNT DNA-binding complex (Figure 2C, lane 6).
Kaempferol interacts with the AHR ligand-binding site
In a final characterization of kaempferol as an AHR antagonist, we examined its ability to compete with TCDD for binding to the AHR. For these assays, we used extracts from the Hepa1c1c7 cell line as the stability of the AHR and its expression levels are relatively high in this cell line (43). As shown in Figure 3, increasing concentrations of kaempferol were effective in competing with the tritiated TCDD ([3H]-TCDD). Determination of the IC50 value revealed that kaempferol displays a relatively high AHR-binding affinity (IC50 = 39.8 nM).
|
Impact of kaempferol on CSC-induced CYP1A1 promoter activity
Upon establishing that kaempferol is capable of acting as an AHR antagonist that inhibits AHR agonist-induced gene transcription and interacts with the AHR ligand-binding site, we then focused our efforts towards determining whether these AHR inhibiting properties could translate into chemopreventive activities. To investigate this, we chose to determine the impact of kaempferol on CSC-induced activation of the AHR-signaling pathway and transformation of lung epithelial cells based on the evidence that a number of AHR agonists are present in cigarette smoke and that cigarette smoking is associated with the development of human lung cancers.
Our first goal was to establish the appropriate dose of CSC that would be similar to 1 nM of TCDD with respect to its activation of the AHR pathway by again analyzing CYP1A1 reporter activity. As shown in Figure 4A, increasing concentrations of CSC yielded a corresponding increase in CYP1A1 reporter activity. An approximate equipotent dose of CSC that corresponded to that of TCDD used in the previous analyses (i.e. 1 nM, Figure 1) proved to be 25 µg/ml. Similar to that observed in Figure 1 using TCDD as the AHR agonist, co-treatment with kaempferol (1 x 105 M) inhibited CSC-induced CYP1A1 promoter activity by
50% (Figure 4B).
|
To verify that CSC activated the AHR-signaling pathway in a manner that was inhibited by kaempferol in human lung epithelial cells, we analyzed their impact on AHR and CYP1A1 protein expression in the BEAS-2B cell line, a cell line previously used to recapitulate some of the events associated with the progression of human lung cancers (44,45). As shown in Figure 5, treatment with either TCDD or CSC resulted in a decrease in AHR protein levels and a corresponding increase in CYP1A1 protein levels, actions that would be predicted for an AHR agonist (3). In addition, treatment with kaempferol failed to alter CYP1A1 protein levels, again indicating that kaempferol does not exhibit significant AHR agonist activity. Further, pretreatment of kaempferol with CSC proved to be effective in blocking the ability of TCDD and CSC to induce CYP1A1 protein expression.
|
Impact of kaempferol on CSC-induced cell transformation
We then questioned whether treatment with kaempferol would prove to be effective in blocking CSC-induced growth in soft agar. As shown in Figure 6 (A and B), treatment of the BEAS-2B cells with 25 µg/ml CSC for 72 h resulted in a significant increase in the number of colonies detected in this assay relative to the DMSO control (i.e. a 3.6 fold increase). Co-treatment of kaempferol with CSC significantly inhibited the ability of CSC to induce colony formation.
|
Finally, we questioned whether kaempferol could inhibit colony formation induced by a well characterized AHR agonist that is also a constituent of CSC, benzo[a]pyrene. Based on a previous analysis of benzo[a]pyrene-induced colony formation using BEAS-2B cells (40), we used a concentration of 100 nM benzo[a]pyrene. As shown in Figure 6C, this treatment resulted in a small increase in colony formation that although decreased, was not significantly altered by kaempferol.
| Discussion |
|---|
|
|
|---|
In this report, we have compared the properties of several flavonoids with respect to their ability to block both agonist interactions with the ligand-binding site of the AHR, and agonist-induction of the AHR-signaling pathway and in the case of those present in CSC, agonist induction of cell transformation. From molecular and pharmacological perspectives, kaempferol appeared to be the most effective AHR antagonist and was capable of inhibiting CSC induction of cell growth in soft agar. Our analysis of kaempferol is similar to that reported previously in MCF7 cells where it was shown to be an effective AHR antagonist, but failed to demonstrate agonistic activities (14). Taken together, these data indicate that use of kaempferol to inhibit the AHR pathway at the initial stages of chemical-induced carcinogenesis (i.e. transformation) may prove to be an effective chemopreventive strategy.
Development of the best AHR antagonist currently available, MNF (10,42), represented a major step forward in the AHR field as it generated a pharmacological tool with which to probe the specific actions of the AHR. In addition, it has also been used to demonstrate the promise associated with using the AHR as a target for effective chemopreventive approaches. For example, in vivo treatment of mice with MNF has been shown to inhibit the genotoxicity induced by benzo[a]pyrene and completely block that induced by CSC (46). Similarly, use of another AHR antagonist, resveratrol, that naturally occurs in red wine, has been shown to inhibit benzo[a]pyrene-induced genotoxicity in vivo (47). However, a problem associated with use of these AHR antagonists is either lack of specificity (i.e. resveratrol is also a potent ER agonist (48)) or their actions as partial agonists [i.e. MNF (12)]. Previous studies have shown that kaempferol exhibits a number of activities that likely contribute to its putative chemopreventive properties including its inhibition of cell growth (49), induction of apoptosis (4952), inhibition of proteosome activity (51) and activation of the ERK (50) and MEKMAPK-signaling pathways (49). Thus, it remains to be determined whether use of kaempferol will be limited due to its AHR-independent actions that oppose, rather than potentiate the beneficial properties associated with its AHR antagonistic activities.
Our initial attempts to determine the extent to which kaempferol's chemopreventive properties are mediated by the AHR are shown in Figure 6. Here, the data indicates that while kaempferol can inhibit colony formation induced by CSC that contains a plethora of chemical carcinogens (Figure 6A and B), it failed to inhibit colony formation induced by the AHR agonist and procarcinogen, benzo[a]pyrene (Figure 6C). However, these data should be interpreted with caution as in the conditions used in this study, the ability of benzo[a]pyrene to induce colony formation was relatively modest (Figure 6C) and as such, may have lacked sufficient sensitivity. Future studies will focus on this important question using a number of known AHR agonists and cells that vary in their expression levels of the AHR.
The ability of flavonoids to act as either AHR agonists or antagonists as reported in the current study is consistent with that previously reported (2,41). For example, apigenin appears to act as a partial agonist as it induces CYP1A1 promoter activity (Figure 1C) and CYP1A1 enzyme activity (33) at relatively low concentrations, but at higher concentrations (i.e. at least 10 µM), it exhibits antagonistic activities. In contrast, kaempferol and emodin exhibit little agonistic activities, but act primarily as relatively potent AHR antagonists. In studies using cell lines derived from breast and liver cancers it has previously been suggested that the antagonistic activities of flavonoids such as kaempferol, quercetin and myricetin may be cell-type-specific with these activities dependent on the relative expression levels of ER
and ERß (41). In fact, apigenin and to a lesser extent, kaempferol have been shown to selectively activate ERß (as compared with ER
) (53). Further, the observations that (i) both ER
and ERß are expressed in BEAS-2B cells (54), (ii) TCDD increases mRNA expression levels of ERß (55) and (iii) ER
interacts with the AHR (56) and appears to act as an AHR co-activator (57) implies that the actions of at least some of these flavonoids (i.e. apigenin and kaempferol) may involve cross-talk between the AHR and ER.
Examination of the structure activity relationships between the different flavonoid compounds and antagonistic activities are consistent with previous observations (11) that indicate the importance of the 4'-position of the flavonoids where substitutions at the 4'-position significantly altered both the ability of these compounds to interact with the AHR ligand-binding site and inhibit the actions of the agonist (Figure 7). It has been postulated that this site contributes to formation of an external hydrogen bond between the flavone antagonist and the amino acid residues of the AHR (11). For example, while apigenin demonstrated excellent antagonistic activities (Figures 1C and 2B), chrysin which is structurally similar to apigenin, except that it lacks the 4'-OH group, inhibited TCDD-induced gene activation only at the highest dose used (i.e. 10 µM, Figure 1C) and failed to inhibit BNF-induced formation of the AHR/ARNT/DNA-binding complex (Data not shown). In addition, while kaempferol demonstrated excellent antagonistic activities in all of the analyses performed herein, galangin which is structurally similar except again lacks the 4' OH substituent failed to effectively inhibit TCDD-induced gene activation (Figure 1C).
|
In summary, we have demonstrated that kaempferol is effective in inhibiting CSC's induction of not only the AHR-signaling pathway, but also the growth of immortalized lung epithelial cells in soft agar. Thus, the data presented within the current study supports the idea that kaempferol may exert its chemopreventive properties, in part, via its AHR antagonistic actions and its subsequent inhibition of the metabolic activation of the chemical carcinogens present in cigarette smoke.
| Acknowledgments |
|---|
We are thankful to Drs Stephen Safe, Thomas Gaseiwicz and Dr Kenneth Ramos for providing us with TCDD, MNF and BaP. We would also like to thank all the members of the Swanson lab for providing their insights into this project and for their assistance in the preparation of this manuscript. This work was supported by NIH grants ES11295 and ES08088.
Conflict of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Kewley R.J., Whitelaw M.L., Chapman-Smith A. (2004) The mammalian basic helixloophelix/PAS family of transcriptional regulators. Int. J. Biochem. Cell Biol. 36:189204.[CrossRef][ISI][Medline]
- Denison M.S. and Nagy S.R. (2003) Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu. Rev. Pharmacol. Toxicol. 43:309334.
- Song Z. and Pollenz R.S. (2002) Ligand-dependent and independent modulation of aryl hydrocarbon receptor localization, degradation, and gene regulation. Mol. Pharmacol. 62:806816.
[Abstract/Free Full Text] - Hecht S.S. (2003) Tobacco carcinogens, their biomarkers and tobacco-induced cancer. Nat. Rev. Cancer 3:733744.[CrossRef][ISI][Medline]
- Greenlee R.T., Hill-Harmon M.B., Murray T., Thun M. (2001) Cancer statistics, 2001. CA Cancer J. Clin. 51:1536.
[Abstract/Free Full Text] - Peto R., Lopez A.D., Boreham J., Thun M., Heath C. Jr, Doll R. (1996) Mortality from smoking worldwide. Br. Med. Bull. 52:1221.
[Abstract/Free Full Text] - Shimizu Y., Nakatsuru Y., Ichinose M., Takahashi Y., Kume H., Mimura J., Fujii-Kuriyama Y., Ishikawa T. (2000) Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor. Proc. Natl Acad. Sci. USA 97:779782.
[Abstract/Free Full Text] - Nakatsuru Y., Wakabayashi K., Fujii-Kuriyama Y., Ishikawa T., Kusama K., Ide F. (2004) Dibenzo[A,L]pyrene-induced genotoxic and carcinogenic responses are dramatically suppressed in aryl hydrocarbon receptor-deficient mice. Int. J. Cancer 112:179183.[CrossRef][ISI][Medline]
- Dertinger S., Silverstone A., Gasiewicz T. (1998) Influence of aromatic hydrocarbon receptor-mediated events on the genotoxicity of cigarette smoke condensate. Carcinogenesis 19:20372042.
[Abstract/Free Full Text] - Lu Y.F., Santostefano M., Cunningham B.D., Threadgill M.D., Safe S. (1995) Identification of 3'-methoxy-4'-nitroflavone as a pure aryl hydrocarbon (Ah) receptor antagonist and evidence for more than one form of the nuclear Ah receptor in MCF-7 human breast cancer cells. Arch. Biochem. Biophys. 316:470477.[CrossRef][ISI][Medline]
- Gasiewicz T.A., Kende A.S., Rucci G., Whitney B., Willey J.J. (1996) Analysis of structural requirements for Ah receptor antagonist activity: ellipticines, flavones, and related compounds. Biochem. Pharmacol. 52:17871803.[CrossRef][ISI][Medline]
- Zhou J. and Gasiewicz T.A. (2003) 3'-methoxy-4'-nitroflavone, a reported aryl hydrocarbon receptor antagonist, enhances Cyp1a1 transcription by a dioxin responsive element-dependent mechanism. Arch. Biochem. Biophys. 416:6880.[CrossRef][ISI][Medline]
- Ciolino H.P., Daschner P.J., Wang T.T., Yeh G.C. (1998) Effect of curcumin on the aryl hydrocarbon receptor and cytochrome P450 1A1 in MCF-7 human breast carcinoma cells. Biochem. Pharmacol. 56:197206.[CrossRef][ISI][Medline]
- Jeuken A., Keser B.J., Khan E., Brouwer A., Koeman J., Denison M.S. (2003) Activation of the Ah receptor by extracts of dietary herbal supplements, vegetables, and fruits. J. Agric. Food Chem. 51:54785487.[CrossRef][ISI][Medline]
- Ciolino H.P., Daschner P.J., Yeh G.C. (1999) Dietary flavonols quercetin and kaempferol are ligands of the aryl hydrocarbon receptor that affect CYP1A1 transcription differentially. Biochem. J. 340:715722.
- Ciolino H.P. and Yeh G.C. (1999) The flavonoid galangin is an inhibitor of CYP1A1 activity and an agonist/antagonist of the aryl hydrocarbon receptor. Br. J. Cancer 79:13401346.[CrossRef][ISI][Medline]
- Ciolino H.P. and Yeh G.C. (1999) Inhibition of aryl hydrocarbon-induced cytochrome P-450 1A1 enzyme activity and CYP1A1 expression by resveratrol. Mol. Pharmacol. 56:760767.
[Abstract/Free Full Text] - Ashida H. (2000) Suppressive effects of flavonoids on dioxin toxicity. Biofactors 12:201206.[ISI][Medline]
- Amakura Y., Tsutsumi T., Sasaki K., Yoshida T., Maitani T. (2003) Screening of the inhibitory effect of vegetable constituents on the aryl hydrocarbon receptor-mediated activity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Biol. Pharm. Bull. 26:17541760.[CrossRef][ISI][Medline]
- Reiners J.J. Jr, Lee J.Y., Clift R.E., Dudley D.T., Myrand S.P. (1998) PD98059 is an equipotent antagonist of the aryl hydrocarbon receptor and inhibitor of mitogen-activated protein kinase kinase. Mol. Pharmacol. 53:438445.
[Abstract/Free Full Text] - Surh Y.J. (2003) Cancer chemoprevention with dietary phytochemicals. Nat. Rev. Cancer 3:768780.[CrossRef][ISI][Medline]
- Gescher A.J., Sharma R.A., Steward W.P. (2001) Cancer chemoprevention by dietary constituents: a tale of failure and promise. Lancet Oncol. 2:371379.[CrossRef][Medline]
- Santini D.L., Rigas B., Shiff S.J. (1999) Role of diet and NSAIDs in the chemoprevention of colorectal cancer. J. Assoc. Acad. Minor. Phys. 10:6876.[Medline]
- Vaisman N. and Arber N. (2002) The role of nutrition and chemoprevention in colorectal cancer: from observations to expectations. Best Pract. Res. Clin. Gastroenterol. 16:201217.[CrossRef][Medline]
- Kris-Etherton P.M., Hecker K.D., Bonanome A., Coval S.M., Binkoski A.E., Hilpert K.F., Griel A.E., Etherton T.D. (2002) Bioactive compounds in foods: their role in the prevention of cardiovascular disease and cancer. Am. J. Med. 113:Suppl. 9B, 71S88S.
- Kris-Etherton P.M. and Keen C.L. (2002) Evidence that the antioxidant flavonoids in tea and cocoa are beneficial for cardiovascular health. Curr. Opin. Lipidol. 13:4149.[CrossRef][ISI][Medline]
- Schroeter H., Boyd C., Spencer J.P., Williams R.J., Cadenas E., Rice-Evans C. (2002) MAPK signaling in neurodegeneration: influences of flavonoids and of nitric oxide. Neurobiol. Aging 23:861880.[CrossRef][ISI][Medline]
- Youdim K.A., Spencer J.P., Schroeter H., Rice-Evans C. (2002) Dietary flavonoids as potential neuroprotectants. Biol. Chem. 383:503519.[CrossRef][ISI][Medline]
- Noda Y., Anzai K., Mori A., Kohno M., Shinmei M., Packer L. (1997) Hydroxyl and superoxide anion radical scavenging activities of natural source antioxidants using the computerized JES-FR30 ESR spectrometer system. Biochem. Mol. Biol. Int. 42:3544.[Medline]
- Szewczuk L.M., Forti L., Stivala L.A., Penning T.M. (2004) Resveratrol is a peroxidase-mediated inactivator of COX-1 but not COX-2: a mechanistic approach to the design of COX-1 selective agents. J. Biol. Chem. 279:2272722737.
[Abstract/Free Full Text] - Nakatsuka T., Tomimori Y., Fukuda Y., Nukaya H. (2004) First total synthesis of structurally unique flavonoids and their strong anti-inflammatory effect. Bioorg. Med. Chem. Lett. 14:32013203.[CrossRef][Medline]
- Agullo G., Gamet-Payrastre L., Manenti S., Viala C., Remesy C., Chap H., Payrastre B. (1997) Relationship between flavonoid structure and inhibition of phosphatidylinositol 3-kinase: a comparison with tyrosine kinase and protein kinase C inhibition. Biochem. Pharmacol. 53:16491657.[CrossRef][ISI][Medline]
- Reiners J.J. Jr, Clift R., Mathieu P. (1999) Suppression of cell cycle progression by flavonoids: dependence on the aryl hydrocarbon receptor. Carcinogenesis 20:15611566.
[Abstract/Free Full Text] - Plaumann B., Fritsche M., Rimpler H., Brandner G., Hess R.D. (1996) Flavonoids activate wild-type p53. Oncogene 13:16051614.[ISI][Medline]
- Narayan S., Jaiswal A.S., Kang D., Srivastava P., Das G.M., Gairola C.G. (2004) Cigarette smoke condensate-induced transformation of normal human breast epithelial cells in vitro. Oncogene 23:58805889.[CrossRef][ISI][Medline]
- Heid S.E., Walker M.K., Swanson H.I. (2001) Correlation of cardiotoxicity mediated by halogenated aromatic hydrocarbons to aryl hydrocarbon receptor activation. Toxicol. Sci. 61:187196.
[Abstract/Free Full Text] - Hoagland M.S., Hoagland E.M., Swanson H.I. (2005) The p53 inhibitor pifithrin-alpha is a potent agonist of the aryl hydrocarbon receptor. J. Pharmacol. Exp. Ther. 314:603610.
[Abstract/Free Full Text] - Dolwick K.M., Schmidt J.V., Carver L.A., Swanson H.I., Bradfield C.A. (1993) Cloning and expression of a human Ah receptor cDNA. Mol. Pharmacol. 44:911917.[Abstract]
- Denison M.S., Vella L.M., Okey A.B. (1986) Hepatic Ah receptor for 2,3,7,8-tetrachlorodibenzo-p-dioxin. Partial stabilization by molybdate. J. Biol. Chem. 261:1018910195.
[Abstract/Free Full Text] - van Agen B., Maas L.M., Zwingmann I.H., Van Schooten F.J., Kleinjans J.C. (1997) B[a]P-DNA adduct formation and induction of human epithelial lung cell transformation. Environ. Mol. Mutagen. 30:287292.[CrossRef][ISI][Medline]
- Zhang S., Qin C., Safe S.H. (2003) Flavonoids as aryl hydrocarbon receptor agonists/antagonists: effects of structure and cell context. Environ. Health Perspect. 111:18771882.[ISI][Medline]
- Henry E.C., Kende A.S., Rucci G., Totleben M.J., Willey J.J., Dertinger S.D., Pollenz R.S., Jones J.P., Gasiewicz T.A. (1999) Flavone antagonists bind competitively with 2,3,7, 8-tetrachlorodibenzo-p-dioxin (TCDD) to the aryl hydrocarbon receptor but inhibit nuclear uptake and transformation. Mol. Pharmacol. 55:716725.
[Abstract/Free Full Text] - Holmes J.L. and Pollenz R.S. (1997) Determination of aryl hydrocarbon receptor nuclear translocator protein concentration and subcellular localization in hepatic and nonhepatic cell culture lines: development of quantitative Western blotting protocols for calculation of aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator protein in total cell lysates. Mol. Pharmacol. 52:202211.
[Abstract/Free Full Text] - Ke Y., Reddel R.R., Gerwin B.I., Miyashita M., McMenamin M., Lechner J.F., Harris C.C. (1988) Human bronchial epithelial cells with integrated SV40 virus T antigen genes retain the ability to undergo squamous differentiation. Differentiation 38:6066.[ISI][Medline]
- Reddel R.R., Ke Y., Gerwin B.I., McMenamin M.G., Lechner J.F., Su R.T., Brash D.E., Park J.B., Rhim J.S., Harris C.C. (1988) Transformation of human bronchial epithelial cells by infection with SV40 or adenovirus-12 SV40 hybrid virus, or transfection via strontium phosphate coprecipitation with a plasmid containing SV40 early region genes. Cancer Res. 48:19041909.
[Abstract/Free Full Text] - Dertinger S., Nazarenko D., Silverstone A., Gasiewicz T. (2001) Aryl hydrocarbon receptor signaling plays a significant role in mediating benzo[a]pyrene- and cigarette smoke condensate-induced cytogenetic damage in vivo. Carcinogenesis 22:171177.
[Abstract/Free Full Text] - Revel A., Raanani H., Younglai E., Xu J., Rogers I., Han R., Savouret J.F., Casper R.F. (2003) Resveratrol, a natural aryl hydrocarbon receptor antagonist, protects lung from DNA damage and apoptosis caused by benzo[a]pyrene. J. Appl. Toxicol. 23:255261.[CrossRef][ISI][Medline]
- Signorelli P. and Ghidoni R. (2005) Resveratrol as an anticancer nutrient: molecular basis, open questions and promises. J. Nutr. Biochem. 16:449466.[CrossRef][ISI][Medline]
- Jin X., Nguyen D., Zhang W.W., Kyritsis A.P., Roth J.A. (1995) Cell cycle arrest and inhibition of tumor cell proliferation by the p16INK4 gene mediated by an adenovirus vector. Cancer Res. 55:32503253.
[Abstract/Free Full Text] - Braig M., Lee S., Loddenkemper C., Rudolph C., Peters A.H., Schlegelberger B., Stein H., Dorken B., Jenuwein T., Schmitt C.A. (2005) Oncogene-induced senescence as an initial barrier in lymphoma development. Nature 436:660665.[CrossRef][Medline]
- Chen C. and Kong A.N. (2005) Dietary cancer-chemopreventive compounds: from signaling and gene expression to pharmacological effects. Trends. Pharmacol. Sci. 26:318326.[CrossRef][Medline]
- Niering P., Michels G., Watjen W., Ohler S., Steffan B., Chovolou Y., Kampkotter A., Proksch P., Kahl R. (2005) Protective and detrimental effects of kaempferol in rat H4IIE cells: implication of oxidative stress and apoptosis. Toxicol. Appl. Pharmacol. 209:114122.[CrossRef][ISI][Medline]
- Harris D.M., Besselink E., Henning S.M., Go V.L., Heber D. (2005) Phytoestrogens induce differential estrogen receptor alpha- or Beta-mediated responses in transfected breast cancer cells. Exp. Biol. Med. (Maywood) 230:558568.
[Abstract/Free Full Text] - Mollerup S., Jorgensen K., Berge G., Haugen A. (2002) Expression of estrogen receptors alpha and beta in human lung tissue and cell lines. Lung Cancer 37:153159.[CrossRef][ISI][Medline]
- Dasmahapatra A.K., Wimpee B.A., Trewin A.L., Hutz R.J. (2001) 2,3,7,8-Tetrachlorodibenzo-p-dioxin increases steady-state estrogen receptor-beta mRNA levels after CYP1A1 and CYP1B1 induction in rat granulosa cells in vitro. Mol. Cell Endocrinol. 182:3948.[CrossRef][ISI][Medline]
- Klinge C.M., Kaur K., Swanson H.I. (2000) The aryl hydrocarbon receptor interacts with estrogen receptor alpha and orphan receptors COUP-TFI and ERRalpha1. Arch. Biochem. Biophys. 373:163174.[CrossRef][ISI][Medline]
- Matthews J., Wihlen B., Thomsen J., Gustafsson J.A. (2005) Aryl hydrocarbon receptor-mediated transcription: ligand-dependent recruitment of estrogen receptor alpha to 2,3,7,8-tetrachlorodibenzo-p-dioxin-responsive promoters. Mol. Cell Biol. 25:53175328.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






