Skip Navigation


Carcinogenesis Advance Access originally published online on October 19, 2006
Carcinogenesis 2007 28(4):809-815; doi:10.1093/carcin/bgl183
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
28/4/809    most recent
bgl183v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Google Scholar
Right arrow Articles by Horia, E.
Right arrow Articles by Watkins, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horia, E.
Right arrow Articles by Watkins, B. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Complementary actions of docosahexaenoic acid and genistein on COX-2, PGE2 and invasiveness in MDA-MB-231 breast cancer cells

Eva Horia and Bruce A. Watkins*

Center for Enhancing Foods to Protect Health, Lipid Chemistry and Molecular Biology Laboratory Purdue University, West Lafayette, IN 47907, USA

*To whom correspondence should be addressed. Tel: +1 765 494 5802; Fax: +1 765 494 7953; Email: baw{at}purdue.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
N-3 polyunsaturated fatty acids (PUFA) and genistein have been associated with lowered cancer risk by reducing inflammatory prostanoids, cyclooxygenase-2 (COX-2) activity, and altering cell signaling. Few studies have investigated the effect of these compounds in combination on the molecular control of the COX-2 gene. In a series of experiments we examined a potential synchronous action of n-3 PUFA and genistein in down-regulating COX-2 expression to diminish prostaglandin E2 (PGE2) production in MDA-MB-231 human breast cancer cells. Cells were treated with genistein and various PUFA including arachidonic acid (AA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA). PGE2 concentrations, expression of COX-2, and cell invasiveness were determined. The n-3 PUFA and genistein alone lowered PGE2 concentration, and genistein in combination with AA reversed the high level of this prostanoid in cell cultures enriched with AA. The degree of cell invasiveness was reversed by genistein in cell cultures treated with AA and further reduced in those given DHA. The n-3 PUFA, in contrast to AA, reduced COX-2 and NF{kappa}B expression. Genistein combined with AA reversed the effects of AA alone on the expression of COX-2 and NF{kappa}B. All three fatty acids increased the expression of PPAR{gamma} in the cells only when combined with genistein. Our results support the premise that DHA and genistein exert complementary actions whilst genistein is antagonistic to AA for controlling PGE2 production as well as invasiveness of MDA-MB-231 cells in culture by modulating the level of NF{kappa}B expression.

Abbreviations: AA, arachidonic acid; COX, cyclooxygenase; DHA, docosahexaenoic acid; EPA, eicosapentaenoic acid; IL, interleukin; LA, linoleic acid; NF{kappa}B, nuclear factor kappa B; PGE2, prostaglandin E2; PPAR, peroxisome proliferator activated receptor; PPRE, peroxisome proliferator receptor element; LC-PUFA, long-chain polyunsaturated fatty acids; Q-PCR, quantitative polymerase chain reaction; TNF{alpha}, tumor necrosis factor-{alpha}.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Variation in the incidence of cancer around the world is, in part, attributed to the significant difference in dietary patterns for fats and phytochemicals, such as those in the USA compared to Japan. Cancer is the second leading cause of death, while breast cancer is the most common type of this disease among Americans with 1 in 7 women developing breast cancer (1). In contrast, the incidence and mortality rates of breast cancer in Japanese women are only one-third of those in Americans (2). Although the rates of breast cancer are much lower in Japan, they have continually climbed in the past 30 years as the diet in Japan has become more westernized similar to that in America.

In the past four decades, Japanese have increased their consumption of animal products and calories from fat while decreased their intake of grains (3). Meat consumption has increased 7-fold and dairy (which includes conjugated linoleic acids) up to 4-fold in Japan. Since animal products are the principle sources of arachidonic acid (AA), the change in the Japanese diet has resulted in an extraordinary rise in the amount of n-6 polyunsaturated fatty acids (PUFA) thus elevating the ratio of n-6/n-3 PUFA. Regardless of this increase, in the year 2000 the estimated dietary ratio of 4:1 for n-6/n-3 PUFA in Japan is still considerably lower than the 10:1–15:1 range in the American diet (4). The major dietary sources of n-3 PUFA (eicosapentaenoic acid EPA and docosahexaenoic acid DHA) in the Japanese diet include fish, shellfish and seaweed.

In addition to the high n-3 PUFA intake, Japanese consume several soy containing food products. Individually, n-3 PUFA or soy components have been implicated in epidemiological (5,6), cell culture and animal studies (7,8) to play a role in reducing the risk of breast cancer. However, few studies (only two) have investigated the combined effects of n-3 PUFA and soy genistein on breast cancer (9,10). Considering that these food components, n-3 PUFA and soy genistein, are usually consumed as part of the daily Japanese diet, often together in the same meal, they may provide additive or synergistic beneficial effects to protect against chronic diseases.

The most prominent mechanism for the chemopreventive action of n-3 PUFA is their suppressive effect on the production of AA-derived prostanoids, particularly prostaglandin E2 (PGE2). This prostanoid has been implicated to play a critical role in immune response to cancer cells, inflammation, cancer cell proliferation, differentiation, apoptosis, angiogenesis and metastasis (7). The n-3 PUFA compete with n-6 PUFA for incorporation into the membrane phospholipids (11), for the activity of elongases and desaturases involved in the conversion of 18 carbon to 20 and 22 carbon PUFA, and for cyclooxygenase (COX) catalytic sites (12). Moreover, some studies proposed that n-3 PUFA down-regulate COX-2 expression (13) by affecting nuclear transcription factors, and altering signal transduction and cell signaling (14). Importantly, EPA-derived PGE3 is much less efficient compared to PGE2 in inducing COX-2 expression (15) and it is a weaker inflammatory agent (16).

Genistein was reported to lower PGE2 production in mesangial cells and macrophages (17,18). Genistein may lower PGE2 by blocking the mitogen-activated protein kinase signaling cascades (19) that activate the transcription of the COX-2 gene, or as a potent peroxisome proliferator-activated receptor gamma (PPAR{gamma}) ligand increasing peroxisome proliferator response element (PPRE) transcriptional activity at concentrations of ≥5 µmol/l (20). Genistein has also been demonstrated to activate PPRE transcriptional activity through PPAR{alpha} in HeoG2 human hepatoma cells (21). Activation of PPRE has been associated with the inhibition of nuclear factor kappa B (NF{kappa}B) activity and a consequential reduction in COX-2 expression (22). In addition, genistein can act via a PPAR{gamma}-independent mechanism to inhibit NF{kappa}B activation and the binding of NF{kappa}B to DNA (23,24). Therefore, genistein can potentially reduce the level of COX-2 protein and PGE2 production by altering NF{kappa}B signaling as demonstrated in macrophages (18).

In the present investigation, n-3 PUFA and genistein were hypothesized to synergistically suppress AA-derived PGE2 production and COX-2 expression in MDA-MB-231 cancer cells to decrease cell invasiveness. MDA-MB-231 is a highly invasive cancer cell line that overexpresses COX-2. The effects of n-6 PUFA compared with n-3 PUFA alone and in combination with genistein were studied on PGE2 production and COX-2 expression. Levels of NF{kappa}B and PPAR{gamma}, the nuclear factors involved in the transcription of COX-2 gene, and the invasive capacity of the cells were also examined.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cells and reagents
The MDA-MB-231 human breast cancer cell line was purchased from American Type Culture Collection (ATCC, Manassas, VA). Iscove's Modified Dulbecco Medium (IMDM) and fetal bovine serum (FBS) were obtained from Sigma (St Louis, MO) and antibiotic-antimycotic solution from Invitrogen (Carlsbad, CA).

The following were also purchased: AA, EPA and DHA (≥99% purity) from Nu-Chek-Prep (Elysian, MN); fatty acid free-bovine serum albumin (BSA), dimethyl sulfoxide (DMSO), formalin solution (4% formaldehyde), and methylene blue from Sigma; genistein (5,7,4'-trihydroxyisoflavone, >99% pure) from Indofine Chemical Company, Inc. (Hillsborough, NJ); tetradecanoyl phorbol acetate (TPA, ≥99% purity) from Calbiochem (San Diego, CA); and ethanol from AAPER Alcohol and Chemical Co. (Shelbyville, KY). All other chemicals, unless noted, were purchased from Sigma.

STAT-PGE2 assay kits were purchased from Cayman Chemical (Ann Arbor, MI), Matrigel and filter inserts from BD Biosciences (Bedford, MA), RNAquaeous®-4PCR kit from Ambion (Austin, TX), iScriptTM cDNA Synthesis kit from Bio-Rad (Hercules, CA), SYBR® Green PCR master mix from Applied Biosystems (Warrington, UK) and all primers from Sigma-Genosys (Woodlands, TX).

Cell culture
MDA-MB-231 cells were routinely maintained in IMDM supplemented with 10% FBS and 1% antibiotic-antimycotic solution at 37°C in 5% CO2. Cells from passages 5–40 were used for the experiments.

Fatty acid enrichment and genistein treatment
Treatment media with fatty acids were prepared by addition of fatty acids dissolved in ethanol (<0.1% ethanol) into IMDM at a ratio of BSA to fatty acids of 2:1 (500 µmol/l BSA) as described previously (25). For treatments with genistein, the medium was prepared by addition of genistein dissolved in DMSO to the medium immediately prior to use, maintaining a 0.1% concentration of DMSO in the medium. The media for the control cell cultures contained only vehicle (BSA, DMSO or BSA plus DMSO).

PGE2 assay
MDA-MB-231 cells were seeded at 30 000 cells/well in 12-well plates for 3 days until 90% confluent. After 24 h of treatment with fatty acid and/or genistein-supplemented medium, cells were washed with PBS then treated with IMDM containing 10% FBS and 10 nmol/l TPA for 24 h. TPA was dissolved in DMSO (not to exceed 0.1% in the medium). Samples of cell culture media were collected and PGE2 concentrations analyzed with a competitive enzyme immunoassay kit (STAT-PGE2).

Invasion assay
The invasion capacity of MDA-MB-231 cells was examined using a modified Boyden chamber Matrigel invasion assay (26). Cells were grown to ~90% confluency, serum starved for 24 h, followed by 24 h treatment with PUFA and/or genistein. At the end of the treatment period, 2 x 105 cells suspended in fresh treatment medium were added to the upper compartment of the Boyden chamber and treatment medium containing 10% FBS was added to the lower chamber. Boyden chambers were prepared by coating the upper surface of track-etched polyethylene terephthalate 8 µm-pore size filter inserts with 85 µg/cm2 Matrigel. After cells were incubated for 18 h at 37°C, the invaded cells on the lower side of the membrane were fixed with formalin solution (4% w/v formaldehyde–10% neutral buffered AFIP formulation) and stained with 0.2% methylene blue. The filters were examined by microscopy and results were expressed as percentage of invaded cells in the treatment group compared to those in the control group.

Quantitative real-time PCR
Cells were cultured in 6-well plates until 90% confluent followed by treatment with fatty acid and/or genistein-supplemented media for the times selected. Total RNA was isolated using an RNAquaeous®-4PCR kit. The yield and quality of the RNA were assessed by UV absorbance at 260 and 280 nm, respectively. First strand cDNA for COX-2, NF{kappa}B, PPAR{gamma} and ß-actin were synthesized from 1 µg RNA using an iScriptTM cDNA Synthesis kit. Quantitative real-time PCR was performed in 96-well optical plates using the ABI Prism 7700 Sequence Detection System (Applied Biosystems, Warrington, UK). Briefly, 1 µl of the cDNA product, 12.5 µl of SYBR® Green PCR master mix, 9.5 µl nuclease-free water and 1 µl (25 pmole/µl) each of the forward and reverse primers, were added to each well to a final volume of 25 µl. All primers were designed using Primer Express® Software v2.0 (Applied Biosystems). Primer sequences for the genes were as follows: COX-2 forward: GAATCATTCACCAGGCAAATTG, COX-2 reverse: TCTGTACTGCGGGTGGAACA, NF{kappa}B forward: GGCTACACCGAAGCAATTGAA, NF{kappa}B reverse: CAGCGAGTGGGCCTGAGA, PPAR{gamma} forward: GGCTTCATGACAAGGGAGTTTC, PPAR{gamma} reverse: AAACTCAAACTTGGGCTCCATAAA, ß-actin forward: CCTGGCACCCAGCACAAT, ß-actin reverse: GCCGATCCACACGGAGTACT. The thermal settings for PCR were 50°C for 2 min, 95°C for 10 min, 95°C for 15 s, and 59°C for 1 min (40x). Additional steps at 95°C for 15 s, 59°C for 20 s and 19 min 59 s temperature ramp to reach 95°C and held for 15 s were performed to construct thermal dissociation curves to confirm the absence of nonspecific amplification.

Statistical analyses
Data were analyzed by either a Student's t-test or one-way ANOVA. For ANOVA analysis, where significant differences were found, a Tukey's multiple comparison test was performed at a probability of P < 0.05 (SAS software, SAS Institute Inc., Cary, NC). All data are presented as means ± SD or as standardized differences calculated from the difference between values of treatment and control divided by the pooled SEM.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
PGE2 biosynthesis
To determine whether PUFA act alone or in combination with genistein to affect PGE2 synthesis, MDA-MB-231 cells were treated for 24 h and subsequently treated with TPA for an additional 24 h. First, the effect of genistein alone was characterized on PGE2 production. Genistein dose-dependently reduced the amount of PGE2 produced by MDA-MB-231 cells compared to the vehicle control (Figure 1 panel A). The suppression observed in cells treated with genistein was 11% at 1.0 µmol/l and 13% at 2.5 µmol/l compared with the vehicle control. The effect of DHA on PGE2 synthesis was also determined. DHA showed dose-dependent reduction of PGE2 synthesis in MDA-MB-231 cells compared with the vehicle control (Figure 1 panel B). The production of PGE2 in cells treated with AA was 57-fold higher compared with the vehicle control (Figure 1 panel C). The addition of genistein to cells enriched with AA reduced the amount of PGE2 by 26% compared to the treatment of AA alone. Both EPA and DHA treatments [long-chain (LC) n-3 PUFA] with and without genistein resulted in significantly lower amounts of PGE2 in cells compared with the AA treatment. Importantly, the treatment of DHA with genistein resulted in a 37% lower concentration of PGE2 compared with the vehicle control (Figure 1 panel C, inset).


Figure 1
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 The effects of PUFA and genistein on the production of PGE2. In panel A, genistein dose-dependently reduced PGE2 in MDA-MB-231 cells. Subconfluent cells were treated with genistein for 24 h and were subsequently induced with 10 nmol/l TPA for an additional 24 h. Vehicle control cells were treated with 0.1% DMSO. Asterisks on bars indicate significant difference from control (P < 0.05) by two-tailed Student's t-test (n = 2). In panel B, DHA dose-dependently reduced PGE2 synthesis. Subconfluent cells were treated with DHA for 24 h and were subsequently induced with 10 nmol/l TPA for an additional 24 h. Vehicle control cells were treated with BSA. Letters on bars indicate significant difference (P < 0.05) by Tukey's multiple comparison test (n = 3). In panel C, n-3 PUFA and genistein in combination reduced the synthesis of PGE2. Subconfluent cells were treated with 200 µmol/l PUFA and 2.5 µmol/l genistein for 24 h and were subsequently induced with 10 nmol/l TPA for an additional 24 h. Vehicle control cells were treated with 100 µmol/l BSA and 0.1% DMSO vehicle. Letters on bars indicate significant difference (P < 0.05) by Tukey's multiple comparison test (n = 3). The data shown is indicative of three separate experiments.

 
Invasion assay
The Matrigel invasion assay was performed to examine whether the changes in PGE2 concentrations resulting from PUFA and genistein treatments correlated with the invasive phenotype of the MDA-MB-231 cells. Genistein alone at 10 µmol/l significantly reduced the number of cells invading the membrane by 40% compared to the vehicle control (Figure 2). At concentrations <10 µmol/l, genistein did not significantly affect the invasive capacity of MDA-MB-231 cells (data not shown). Treatment of cells with AA increased invasion by 40% compared with the vehicle control. However, simultaneous addition of genistein with AA abolished the effect of AA on cancer cell invasiveness. Thus, genistein treatment with AA attenuated the cancer promoting effect of this n-6 PUFA on breast cancer cells. In contrast, DHA significantly reduced invasion by 27%, and with the addition of genistein a further decline in the number of invaded cells was observed (a decrease of 61% compared with the vehicle control). EPA alone did not affect the invasiveness of the cells when compared to those in the vehicle control. These findings indicate that genistein blunted the invasiveness of breast cancer cells subjected to AA and markedly reduced invasiveness when treated simultaneously with DHA.


Figure 2
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 The effects of PUFA and genistein on Matrigel invasion capacity of MDA-MB-231 cells. N-3 PUFA and genistein in combination reduced cell invasiveness. Subconfluent cells were serum starved for 24 h followed by treatment with vehicle control (100 µmol/l BSA + 0.1% DMSO), PUFA (200 µmol/l) and/or genistein (10 µmol/l) for an additional 24 h. Cells were subsequently placed into the Boyden chambers with fresh treatment media for 18 h. Results are expressed as % invasion compared with the vehicle control cells (V-CTRL, 100% invasion) represented by the dotted line. Letters on bars indicate a significant difference (P < 0.05) by Tukey's multiple comparison test (n = 4). The data shown is indicative of two separate experiments.

 
Expression of COX-2, PPAR{gamma} and NF{kappa}B genes
The effect of genistein at concentrations ranging from 0.1 to 2.5 µM on the expression of COX-2 gene in MDA-MB-231 cells was determined after 24 h treatment (Figure 3). No significant change in the level of COX-2 mRNA was detected using quantitative real-time PCR method. The effects of 24 h treatments with PUFA at 50 µmol/l (with and without genistein, 0 and 2.5 µmol/l) on the transcription rate of COX-2, PPAR{gamma} and NF{kappa}B were also investigated using quantitative real-time PCR in MDA-MB-231 cells. The EPA and DHA treatments including those with genistein led to reduced COX-2 mRNA levels compared to the vehicle control, but AA did not show a suppressive action on COX-2 transcription unless combined with genistein (Figure 4 panel A). Importantly, genistein alone did not affect the level of COX-2 mRNA (as also shown in Figure 3) and hence the suppression observed in the AA plus genistein treatment was an effect exclusive to the combination of these compounds. This finding suggests that genistein has a protective effect by reducing the action of AA on COX-2 at the transcription level to the same extent achieved by LC n-3 PUFA treatments. To further study how PUFA and genistein impact the mechanism involved in the molecular control of the COX-2 gene expression, the effects of these dietary components on PPAR{gamma} and NF{kappa}B genes expression were also examined. Genistein treatment alone at the concentration used had no significant effect on mRNA levels for both PPAR{gamma} (Figure 4 panel B) and NF{kappa}B (Figure 4 panel C). The combination of all PUFA treatments with genistein resulted in a higher level of PPAR{gamma} mRNA, however, EPA alone reduced this transcription factor in these cells. Both LC n-3 PUFA independent of genistein addition significantly reduced the levels of NF{kappa}B mRNA. In contrast, the addition of genistein was necessary to lower NF{kappa}B mRNA in cells treated with AA (Figure 4 panel C). Looking at the expression pattern of COX-2, PPAR{gamma}, and NF{kappa}B, it can be deduced that suppression in COX-2 gene transcription concurred with the increase in PPAR{gamma} expression and the decrease in NF{kappa}B expression. The changes in mRNA levels for PPAR{gamma} and NF{kappa}B involved in the molecular control of the COX-2 gene with treatment of LC n-3 PUFA and genistein might suggest a dietary means to attenuate COX-2 protein amplification associated with the invasive phenotype of the MDA-MB-231 human breast cancer cells. Our study also found that the changes in the gene expression levels of PPAR{gamma} and NF{kappa}B did not take place at the 2 and 8 h treatment durations although the changes in the expression of COX-2 gene was observed at 8 h (data not presented). This finding may suggest that physiological concentrations of n-3 PUFA and genistein maintained for long duration are effective to sustain COX-2 gene suppression through their actions on PPAR{gamma} and NF{kappa}B.


Figure 3
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Genistein did not affect the expression of COX-2 gene. Subconfluent MDA-MB-231 cells were treated with genistein at concentrations 0.1, 1.0 and 2.5 µmol/l in serum-free media for 24 h. The value from vehicle control cells treated with 0.1% DMSO was set at 1 and represented by the dotted line. For each sample, the CT (threshold concentration) values for the COX-2 gene were adjusted to the CT for the control gene ß-actin ({Delta}CT = CTcox-2CTactin). The {Delta}CT values were further normalized to the {Delta}CT of the vehicle control ({Delta}{Delta}CT = {Delta}CTtreatment{Delta}CTcontrol). The relative quantity of the gene in a treatment group compared with the control was calculated by 2{Delta}{Delta}Ct. Bars represent mean values (n = 2). Significant difference from control (*) was calculated by a two-tailed Student's t-test (P < 0.05).

 


Figure 4
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 The effects of PUFA and genistein on COX-2 (panel A), PPAR{gamma} (panel B) and NF{kappa}B (panel C) genes expression. Subconfluent MDA-MB-231 cells were treated with 50 µmol/l PUFA and/or 2.5 µmol/l genistein in serum-free media for 24 h. The values from vehicle control cells treated with 25 µmol/l BSA and 0.1% DMSO were set at one and represented by the dotted line. For each sample, the CT (threshold concentration) values for the gene of interest was adjusted to the CT for the control gene ß-actin ({Delta}CT = CTgeneCTactin). The {Delta}CT values were further normalized to the {Delta}Ct of the vehicle control ({Delta}{Delta}CT = {Delta}CTtreatment{Delta}CTcontrol). The relative quantity of the gene in a treatment group compared with the control was calculated by 2{Delta}{Delta}Ct. Bars represent mean values (n = 2) and are indicative of two experiments. Significant difference from control (*) and from PUFA only treatment ({dagger}) is calculated by a two-tailed Student's t-test (P < 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The chemopreventive capacity of LC n-3 PUFA has been documented in the past two decades. Evidence suggests that LC n-3 PUFA antagonize AA-derived prostanoid formation through mechanisms involving substrate replacement, enzyme competition, signal transduction and modulation of gene expression (7,27). Genistein has also been reported to have chemopreventive actions in cancer cells (28,29), and to inhibit COX-2 expression and PGE2 production (18,30).

The present investigation demonstrated that genistein reduced the synthesis of PGE2 in MDA-MB-231 human breast cancer cells that overexpress the COX-2 gene. Genistein, at a physiological concentration (2.5 µmol/l) reduced the production of PGE2 by 13%. This significant finding indicates that genistein suppressed PGE2 production at a much lower concentration (which can be achieved by diet) than previously reported (18). Plasma concentrations of genistein were found to be as high as 6 µmol/l in subjects receiving dietary intervention (31) while the serum concentration of genistein in Japanese male subjects not receiving any dietary intervention was ~0.5 µmol/l (32). Therefore, the 2.5 µmol/l genistein used in the present study is relevant to an achievable dietary level and validates the findings on prostanoid synthesis in breast cancer cells.

When MDA-MB-231 cells were exposed to AA and genistein, the level of PGE2 was reduced compared with those treated with AA alone. In cells treated with EPA, a prostanoid precursor, the level of PGE2 produced was substantially lower than that in cells treated with AA. However, nearly a 50% higher PGE2 concentration was observed in EPA-treated cells compared to the vehicle control. Since the antibody for PGE2 used in this assay had a 43% cross-reactivity with PGE3, the apparent increase in PGE2 concentration observed in EPA-treated cells (compared to the vehicle control) was likely due to an increase in EPA-derived PGE3, not PGE2. Indeed, treatment of A549 human lung cancer cells with 50 µM EPA was shown to boost PGE3 synthesis and increase the ratio of PGE3–PGE2 level 10-fold by the preferential action of COX-2 over COX-1 enzyme (33). Moreover, it has been established that the MDA-MB-231 cells express a low level of COX-1, and that, prostanoid synthesis in these cells is catalyzed mostly by the constitutively high level of COX-2 (34). When cells were treated with DHA, a non-PG precursor, we demonstrated that DHA dose-dependently reduced the synthesis of PGE2. In a separate experiment to determine the effect of DHA in combination with genistein on PGE2 production, treatment with DHA alone tended to lower the PGE2 concentration (although not significant), and cells treated with DHA and genistein in combination had the level of PGE2 further lowered. Hence, our data provide evidence for an additive effect of DHA plus genistein in suppressing the endogenous production of PGE2 in MDA-MB-231 cells.

In our study, treatments with LC n-3 PUFA reduced COX-2 mRNA level independent of the addition of genistein. This is not surprising since both DHA and EPA were reported to lower COX-2 expression by blocking the toll-like receptor-mediated pathway thereby inhibiting NF{kappa}B activation (35). Treatments with AA, on the other hand, showed reduction in COX-2 mRNA level only when combined with genistein. We observed that the reduction in COX-2 expression coincided with increased PPAR{gamma} expression and lowered NF{kappa}B expression. Our observation is consistent with another study in which cervical cancer cells treated with PPAR{gamma} ligand had upregulated PPAR{gamma} expression, suppressed binding activity of NF{kappa}B, and reduced expression of COX-2 gene (36). Genistein has been shown to activate PPAR{gamma} (20), and to inactivate NF{kappa}B or prevent NF{kappa}B binding to DNA (37). We propose that LC n-3 PUFA act complementarily with genistein to increase the transcription of PPAR{gamma} and decrease the transcription of NF{kappa}B to suppress the expression of COX-2. Since NF{kappa}B has two binding sites on the COX-2 promoter (37), it is feasible that the addition of genistein to cells enriched with AA led to inactivation of NF{kappa}B, mediated through higher expression of PPAR{gamma} or by direct effect on NF{kappa}B, to reduce the transcription of the COX-2 gene. When genistein was in combination with EPA or DHA, genistein did not enhance the suppression of COX-2 gene expression but worked through another mechanism (likely to also involve PPAR{gamma}) to lower PGE2 production and the invasive phenotype of the cancer cells. It is also noteworthy that activation of PPRE may directly induce the COX-2 gene promoter (38), however, since there are two sites for NF{kappa}B and only one for PPRE which is located much further upstream from the start site of transcription compared with the NF{kappa}B sites, it seems that suppression of NF{kappa}B may override activation of PPRE.

From our investigation, the chemopreventive effect of LC n-3 PUFA and genistein may be 3-fold. First, we observed that treatment with DHA and genistein reduced the synthesis of PGE2, a compound implicated in carcinogenesis and inflammation. Second, EPA and DHA lowered the expression of COX-2 and NF{kappa}B to decrease the production of PGE2. The lowering effect of EPA and DHA on NF{kappa}B transcription in the same breast cancer cells was observed in our laboratory with stearidonic acid (18:4 n-3) enrichment (25). Third, genistein blocked the actions of AA on PGE2, cell invasiveness, and COX-2 and NF{kappa}B expression.

Simultaneous targeting of COX-2 and PPAR{gamma} has been suggested as a powerful mechanism to lower the risk of cancer (39). We observed that LC n-3 PUFA effectively down-regulated PGE2 production, along with DHA being a potential ligand for RXR{alpha} (40) and genistein as a PPAR{gamma} ligand, they appear to work together to activate the PPRE trans-suppression of pro-inflammatory and pro-carcinogenic genes (e.g. NF{kappa}B). In breast cancer cells, including the MDA-MB-231 cell line used in our study, treatment with 15-d-PGJ2 was reported to induce apoptosis (41) and inhibit proliferation (42). Therefore, our study is the first to evoke a complementary nature of DHA and genistein that would alter or decrease the flux through prostanoid pathways.

Intakes of foods containing LC n-3 PUFA and genistein may be an effective strategy to reduce the risk of breast cancer by down-regulating the production of pro-inflammatory cytokines and invasiveness of cancer cells. Importantly, this study found that in AA-treated human cancer cells, genistein effectively lowered PGE2 as well as the expression of COX-2 and NF{kappa}B, suggesting a potential cancer protective effect of soy products in Japanese populations that recently began to consume increasing amounts of dietary n-6 PUFA (AA). Figure 5 illustrates possible targets for the proposed antagonistic effect of genistein on AA and its complementary actions with DHA on prostanoid synthesis. Genistein antagonized the effect of AA but complemented those of EPA and DHA on molecular and biochemical controls for PGE2 production. We found in this study that genistein in combination with EPA and DHA affected the expression of COX-2; however, additional research must confirm changes in the transcriptional activity of the COX-2 gene by various transcription factors and the dietary factors used in this investigation.


Figure 5
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 In the present study, the combination of DHA and genistein antagonized the effect of AA on prostanoid production. Genistein and DHA can inhibit the activation of NF{kappa}B by PPAR{gamma}-dependent and -independent mechanisms (20,23,24,35,40), leading to down-regulation of the COX-2 gene, PGE2 production, and synthesis of NF{kappa}B-regulated pro-inflammatory cytokines (18,22,43). DHA and genistein can also suppress the production of PGE2 by altering the flux through the COX-2 enzyme (11,12). Additionally, genistein can potentially interfere with signal transduction involved in the elevation of cAMP levels (17,44), hence it prevents the inducing effect of PGE2 on COX-2 gene transcription.

 

    Acknowledgments
 
The assistance of Dr Sophie Lelievre with the invasion assay is appreciated. This work was supported by a 21st Century Research and Technology grant awarded to the Center for Enhancing Foods to Protect Health (http://www.efph.purdue.edu) at Purdue University.

Conflict of Interest Statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. American Cancer Society. (2003) Breast Cancer Facts and Figures 2003-2004(American Cancer Society, Atlanta, GA).
  2. Ferlay J., Bray F., Pisani P., Parkin D.M. (2001) GLOBOCAN 2000: Cancer Incidence, Mortality and Prevalence Worldwide,(IARC Press, Lyon).
  3. Office for Health Statistics, Vital and Health Statistics Division. (2001) National Nutrition Survey.
  4. Sugano M. and Hirahara F. (2000) Polyunsaturated fatty acids in the food chain in Japan. Am. J. Clin. Nutr. 71:189S–196S.[Abstract/Free Full Text]
  5. Sasaki S., Horacsek M., Kesteloot H. (1993) An ecological study of the relationship between dietary fat intake and breast cancer mortality. Prev. Med. 22:187–202.[CrossRef][Web of Science][Medline]
  6. Yamamoto S., Sobue T., Kobayashi M., Sasaki S., Tsugane S. (2003) Soy, isoflavones, and breast cancer risk in Japan. J. Natl Cancer Inst. 95:906–913.[Abstract/Free Full Text]
  7. Larsson S.C., Kumlin M., Ingelman-Sundberg M., Wolk A. (2004) Dietary long-chain n-3 fatty acids for the prevention of cancer: a review of potential mechanisms. Am. J. Clin. Nutr. 79:935–945.[Abstract/Free Full Text]
  8. Sarkar F.H. and Li Y. (2002) Mechanisms of cancer chemoprevention by soy isoflavone genistein. Cancer Metastasis Rev. 21:265–280.[CrossRef][Web of Science][Medline]
  9. Nakagawa H., Yamamoto D., Kiyozuka Y., Tsuta K., Uemura Y., Hioki K., Tsutsui Y., Tsubura A. (2000) Effects of genistein and synergistic action in combination with eicosapentaenoic acid on the growth of breast cancer cell lines. J. Cancer Res. Clin. Oncol. 126:448–454.[CrossRef][Web of Science][Medline]
  10. Hilakivi-Clarke L., Cho E., Cabanes A., DeAssis S., Olivo S., Helferich W., Lippman M.E., Clarke R. (2002) Dietary modulation of pregnancy estrogen levels and breast cancer risk among female rat offspring. Clin. Cancer Res. 8:3601–3610.[Abstract/Free Full Text]
  11. Hatala M.A., Rayburn J., Rose D.P. (1994) Comparison of linoleic acid and eicosapentaenoic acid incorporation into human breast cancer cells. Lipids 29:831–837.[Web of Science][Medline]
  12. Malkowski M.G., Thuresson E.D., Lakkides K.M., Rieke C.J., Micielli R., Smith W.L., Garavito R.M. (2001) Structure of eicosapentaenoic and linoleic acids in the cyclooxygenase site of prostaglandin endoperoxide H synthase-1. J. Biol. Chem. 276:37547–37555.[Abstract/Free Full Text]
  13. Badawi A.F., El Sohemy A., Stephen L.L., Ghoshal A.K., Archer M.C. (1999) Modulation of the expression of the cyclooxygenase 1 and 2 genes in rat mammary glands: role of hormonal status and dietary fat. Adv. Exp. Med. Biol. 469:119–124.[Web of Science][Medline]
  14. Bishop-Bailey D. and Wray J. (2003) Peroxisome proliferator-activated receptors: a critical review on endogenous pathways for ligand generation. Prostagland. Lipid Mediat. 71:1–22.
  15. Bagga D., Wang L., Farias-Eisner R., Glaspy J.A., Reddy S.T. (2003) Differential effects of prostaglandin derived from omega -6 and omega -3 polyunsaturated fatty acids on COX-2 expression and IL-6 secretion. Proc. Natl Acad. Sci. USA 100:1751–1756.[Abstract/Free Full Text]
  16. Mooney M.A., Vaughn D.M., Reinhart G.A., Powers R.D., Wright J.C., Hoffman C.E., Swaim S.F., Baker H.J. (1998) Evaluation of the effects of omega-3 fatty acid-containing diets on the inflammatory stage of wound healing in dogs. Am. J. Vet. Res. 59:859–863.[Web of Science][Medline]
  17. Coyne D.W. and Morrison A.R. (1990) Effect of the tyrosine kinase inhibitor, genistein, on interleukin-1 stimulated PGE2 production in mesangial cells. Biochem. Biophys. Res. Commun. 173:718–724.[CrossRef][Web of Science][Medline]
  18. Liang Y.C., Huang Y.T., Tsai S.H., Lin-Shiau S.Y., Chen C.F., Lin J.K. (1999) Suppression of inducible cyclooxygenase and inducible nitric oxide synthase by apigenin and related flavonoids in mouse macrophages. Carcinogenesis 20:1945.[Abstract/Free Full Text]
  19. Das R. and Vonderhaar B.K. (1996) Activation of raf-1, MEK, and MAP kinase in prolactin responsive mammary cells. Breast Cancer Res. Treat. 40:141–149.[CrossRef][Web of Science][Medline]
  20. Dang Z.C., Audinot V., Papapoulos S.E., Boutin J.A., Lowik C.W.G.M. (2003) Peroxisome proliferator-activated receptor gamma (PPAR{gamma}) as a molecular target for the soy phytoestrogen genistein. J. Biol. Chem. 278:962.[Abstract/Free Full Text]
  21. Kim S., Shin H.J., Kim S.Y., Kim J.H., Lee Y.S., Kim D.H., Lee M.O. (2004) Genistein enhances expression of genes involved in fatty acid catabolism through activation of PPAR{alpha}. Mol. Cell Endocrinol. 220:51–58.[CrossRef][Web of Science][Medline]
  22. Inoue H., Tanabe T., Umesono K. (2000) Feedback control of cyclooxygenase-2 expression through PPAR{gamma}. J. Biol. Chem. 275:28028–28032.[Abstract/Free Full Text]
  23. Choi C., Cho H., Park J., Cho C., Song Y. (2003) Suppressive effects of genistein on oxidative stress and NF{kappa}B activation in RAW 264.7 macrophages. Biosci. Biotechnol. Biochem. 67:1916–1922.[CrossRef][Medline]
  24. Davis J.N., Kucuk O., Sarkar F.H. (1999) Genistein inhibits NF{kappa}B activation in prostate cancer cells. Nutr. Cancer 35:167–174.[CrossRef][Web of Science][Medline]
  25. Horia E. and Watkins B.A. (2005) Comparison of stearidonic acid and alpha-linolenic acid on PGE2 production and COX-2 protein levels in MDA-MB-231 breast cancer cell cultures. J. Nutr. Biochem. 16:184–192.[CrossRef][Web of Science][Medline]
  26. Albini A. (1998) Tumor and endothelial cell invasion of basement membranes. The matrigel chemoinvasion assay as a tool for dissecting molecular mechanisms. Pathol. Oncol. Res. 4:230–241.[Medline]
  27. Rose D.P. and Connolly J.M. (1999) Omega-3 fatty acids as cancer chemopreventive agents. Pharmacol. Therap. 83:217–244.[CrossRef][Web of Science][Medline]
  28. Magee P.J., McGlynn H., Rowland I.R. (2004) Differential effects of isoflavones and lignans on invasiveness of MDA-MB-231 breast cancer cells in vitro. Cancer Lett. 208:35–41.[CrossRef][Web of Science][Medline]
  29. Lamartiniere C.A., Cotroneo M.S., Fritz W.A., Wang J., Mentor-Marcel R., Elgavish A. (2002) Genistein chemoprevention: timing and mechanisms of action in murine mammary and prostate. J. Nutr. 132:552S–558S.[Abstract/Free Full Text]
  30. Corbett J.A., Kwon G., Marino M.H., Rodi C.P., Sullivan P.M., Turk J., McDaniel M.L. (1996) Tyrosine kinase inhibitors prevent cytokine-induced expression of iNOS and COX-2 by human islets. Am. J. Physiol. Cell Physiol. 270:C1581–C1587.[Abstract/Free Full Text]
  31. Xu X., Harris K.S., Wang H.J., Murphy P.A., Hendrich S. (1995) Bioavailability of soybean isoflavones depends upon gut microflora in women. J. Nutr. 125:2307–2315.[Abstract/Free Full Text]
  32. Morton M.S., Arisaka O., Miyake N., Morgan L.D., Evans B.A.J. (2002) Phytoestrogen concentrations in serum from Japanese men and women over forty years of age. J. Nutr. 132:3168.[Abstract/Free Full Text]
  33. Yang P., Chan D., Felix E., Cartwright C., Menter D.G., Madden T., Klein R.D., Fischer S.M., Newman R.A. (2004) Formation and antiproliferative effect of prostaglandin E3 from eicosapentaenoic acid in human lung cancer cells. J. Lipid Res. 45:1030–1039.[Abstract/Free Full Text]
  34. Liu X.H. and Rose D.P. (1996) Differential expression and regulation of cyclooxygenase-1 and -2 in two human breast cancer cell lines. Cancer Res. 56:5125–5127.[Abstract/Free Full Text]
  35. Lee J.Y., Plakidas A., Lee W.H., Heikkinen A., Chanmugam P., Bray G., Hwang D.H. (2003) Differential modulation of toll-like receptors by fatty acids: preferential inhibition by n-3 polyunsaturated fatty acids. J. Lipid Res. 44:479–486.[Abstract/Free Full Text]
  36. Han S., Inoue H., Flowers L.C., Sidell N. (2003) Control of COX-2 gene expression through peroxisome proliferator-activated receptor-{gamma} in human cervical cancer cells. Clin. Cancer Res. 9:4627–4635.[Abstract/Free Full Text]
  37. Smith W.L., Dewitt D.L., Garavito R.M. (2000) Cyclooxygenases: structural, cellular, and molecular biology. Annu. Rev. Biochem. 69:145–182.[CrossRef][Web of Science][Medline]
  38. Meade E.A., McIntyre T.M., Zimmerman G.A., Prescott S.M. (1999) Peroxisome proliferators enhance cyclooxygenase-2 expression in epithelial cells. J. Biol. Chem. 274:8328–8334.[Abstract/Free Full Text]
  39. Badawi A.F., Eldeen M.B., Liu Y., Ross E.A., Badr M.Z. (2004) Inhibition of rat mammary gland carcinogenesis by simultaneous targeting of cyclooxygenase-2 and peroxisome proliferator-activated receptor-{gamma}. Cancer Res. 64:1181–1189.[Abstract/Free Full Text]
  40. Fan Y.Y., Spencer T.E., Wang N., Moyer M.P., Chapkin R.S. (2003) Chemopreventive n-3 fatty acids activate RXR{alpha} in colonocytes. Carcinogenesis 24:1541–1548.[Abstract/Free Full Text]
  41. Clay C.E., Namen A.M., Atsumi G.i., Willingham M.C., High K.P., Kute T.E., Trimboli A.J., Fonteh A.N., Dawson P.A., Chilton F.H. (1999) Influence of J series prostaglandins on apoptosis and tumorigenesis of breast cancer cells. Carcinogenesis 20:1905–1911.[Abstract/Free Full Text]
  42. Elstner E., Muller C., Koshizuka K., Williamson E.A., Park D., Asou H., Shintaku P., Said J.W., Heber D., Koeffler H.P. (1998) Ligands for peroxisome proliferator-activated receptor-{gamma} and retinoic acid receptor inhibit growth and induce apoptosis of human breast cancer cells in vitro and in BNX mice. Proc. Natl Acad. Sci. USA 95:8806–8811.[Abstract/Free Full Text]
  43. Chawla A., Barak Y., Nagy L., Liao D., Tontonoz P., Evans R.M. (2001) PPAR-{gamma} dependent and independent effects on macrophage-gene expression in lipid metabolism and inflammation. Nat. Med. 7:48–52.[CrossRef][Web of Science][Medline]
  44. Das U.N. (1991) Arachidonic acid as a mediator of some of the actions of phorbolmyristate acetate, a tumor promoter and inducer of differentiation. Prostagland. Leukot. Essent. Fatty Acids 42:241–244.[CrossRef][Web of Science][Medline]
Received March 17, 2006; revised August 20, 2006; accepted September 11, 2006.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
28/4/809    most recent
bgl183v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Google Scholar
Right arrow Articles by Horia, E.
Right arrow Articles by Watkins, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horia, E.
Right arrow Articles by Watkins, B. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?