Carcinogenesis Advance Access originally published online on November 24, 2006
Carcinogenesis 2007 28(5):1008-1020; doi:10.1093/carcin/bgl233
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Biological assays and genomic analysis reveal lipoic acid modulation of endothelial cell behavior and gene expression
Centro di Biotecnologie Avanzate, Genova, Italy
1 Servizio di Oncologia Sperimentale-A Istituto Nazionale per la Ricerca sul Cancro, Genova, Italy
2 Dipartimento di Scienze Cliniche e Biologiche, Università dell'Insubria, Varese, Italy
3 Polo Scientifico e Tecnologico, IRCCS Multimedica, Via Fantoli, 16/15, 20100 Milano, Italy
* To whom correspondence should be addressed. Tel: +39 02 55406574; Fax: +39 101 5737231; Email: adriana.albini{at}multimedica.it
| Abstract |
|---|
|
|
|---|
Lipoic acid (LA) is a sulfated antioxidant produced physiologically as a coenzyme of the pyruvate dehydrogenase complex; it is currently used for treatment of non-insulin-dependent diabetes to favor the cellular uptake of glucose. We have previously described the angiopreventive potential of molecules sharing common features with LA: N-acetyl cysteine, epigallocatechin-3-gallate and xanthohumol. To expand these studies, we have tested the capacity of LA to modulate angiogenesis in tumor growth using a Kaposi's sarcoma model. Endothelial cells exposed to LA displayed a dose-dependent reduction of cell migration and a time-dependent modulation of the phosphorylation of key signaling molecules. In vivo, LA efficiently repressed angiogenesis in matrigel plugs and KS-Imm tumor growth. We analyzed modulation of gene expression in endothelial cells treated with LA for 5 h (early response), finding a mild anti-apoptotic, antioxidant and anti-inflammatory response. A group of LA-targeted genes was selected to perform real-time polymerase chain reaction time-lapse experiments. The long-term gene regulation (48 h and 4 days) shows higher rates of modulation as compared with the array data, confirming that LA is able to switch the regulation of several genes linked to cell survival, inflammation and oxidative stress. LA induced the production of tumor necrosis factor-alpha-related apoptosis-inducing ligand (TRAIL) in KS-Imm and activin-A in KS-Imm and endothelial cells; these factors show anti-angiogenic activity in vivo contributing to explain the inhibitory effect of LA on neovascularization. According to our data, LA has promising anti-angiogenic properties, though its influence on central metabolic pathways should suggest more caution about its widespread and not prescribed use at pharmacological doses.
Abbreviations: EGCG, epigallocatechin-3-gallate; GPCR, G protein-coupled receptor; HO-1, heme oxygenase-1; KS-CM, Kaposi's sarcoma cell-conditioned medium; LA, lipoic acid; NAC, N-acetyl cysteine; NF-kB, nuclear factor-kappaB; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; TBS, Tris-buffered saline; TNF, tumor necrosis factor; TRAIL, tumor necrosis factor-alpha-related apoptosis-inducing ligand; VEGF, vascular endothelial growth factor
| Introduction |
|---|
|
|
|---|
Lipoic acid (LA), also known as thioctic acid, 1,2-dithiolane-3-pentanoic acid and 1,2-dithiolane-3 valeric acid, is a naturally occurring compound that is synthesized by plants and animals. LA is not found in our bodies as a detectable, free circulating form, but bound to a lysine residue in proteins. In its protein bound form, lipoamide, LA is a required cofactor for several multi-enzymatic complexes that catalyze critical energy metabolism reactions.
Early studies evaluated the effect of low-dose LA on lipid and carbohydrate catabolism, observing little or no effect (1); yet, a common response in these trials was an increased glucose uptake from serum (2). LA increases glucose uptake through recruitment of the glucose transporter-4 to plasma membranes, a mechanism that is shared with insulin-stimulated glucose uptake (3). LA improves glucose clearance in patients with type-II diabetes (4) and is particularly suited to the prevention of diabetic complications that arise from an overproduction of reactive oxygen and nitrogen species, due to its antioxidant properties. In experimental and clinical studies, LA markedly reduced the symptoms of diabetic pathologies, including polyneuropathy and vascular damage (5,6). In human trials, LA was usually tested for 36 weeks at pharmacological oral doses of 6001200 mg/day (6,7). Exogenous LA is readily and almost completely absorbed, with a limited absolute bioavailability of
30%, caused by high hepatic extraction (8).
Zhang et al. (9) showed that pre-incubation of human aortic endothelial cells for 48 h with LA (0.051 mM) dose dependently inhibited tumor necrosis factor (TNF)-alpha-induced expression of E-selectin, vascular cell adhesion molecule 1, intercellular adhesion molecule 1 and macrophage chemotactic protein 1, without affecting the expression of TNF-alpha receptor 1. LA dose dependently inhibited TNF-alpha-induced IkB kinase activation and nuclear translocation of nuclear factor-kappaB (NF-kB). This observation suggested a possible application of LA to block the inflammatory stimuli acting on the endothelial cell in tumor micro-environment. Tumor development is a multi-step process where angiogenesis is fundamental from the beginning, and the early imbalance of the angiogenic switch towards inhibition could induce tumor dormancy and significantly prevent cancer progression (10). Most chemopreventive molecules exert a powerful anti-inflammatory and antioxidant activity, counteracting part of the epigenetic signals involved in tumor development (11). We have previously described the angiopreventive potential of a molecule sharing common features with LA, N-acetyl cysteine (NAC). NAC, in addition to its antioxidant and glutathione-restoring activity is able to inhibit tumor and endothelial cell invasion in vitro and to restrain the vascularization of matrigel plugs containing angiogenic growth factors in vivo (12,13). In addition, we have shown that other antioxidant flavonoids inhibit the NF-kB and Akt pathways, including the green tea polyphenol epigallocatechin-3-gallate (EGCG) (14) and the hops-derived chalchone xanthohumol (15). Since previous studies suggested that LA could target these same pathways, we tested LA in similar experimental settings.
| Materials and methods |
|---|
|
|
|---|
Reagents
All growth factors (acidic fibroblast growth factor (aFGF), basic fibroblast growth factor (bFGF), epithelial growth factor (EGF)) were purchased from PeproTech (London, UK), heparin was purchased from ICN (Irvine, CA), water-soluble hydrocortisone and inhibin-ßa/activin-A were purchased from Sigma (St Louis, MO), LA was supplied by Antibioticos (Milan, Italy), tumor necrosis factor-alpha-related apoptosis-inducing ligand (TRAIL) was purchased from Alexis Biochemicals (San Diego, CA). Kaposi's sarcoma cell-conditioned medium (KS-CM) and NIH 3T3-conditioned medium were obtained as described previously (16,17).
Cell lines
The Kaposi's sarcoma cell line, KS-Imm, established in our laboratory (18), was cultured in Dulbecco's modified Eagle's medium 10% fetal calf serum splitting the cells 1:3 every other day. Primary human umbilical vein endothelial cells (HUVEC) cell cultures were purchased from Cascade Biologics (Portland, OR) and cultured in gelatin-coated flasks using M199, 10% fetal calf serum supplemented with FGF (1 µg aFGF + 1 µg bFGF/100 ml medium), EGF (1 µg/100 ml medium), heparin (10 mg/100 ml medium) and hydrocortisone (0.1 mg/100 ml medium).
In vivo angiogenesis
The matrigel model of angiogenesis in vivo introduced by Passaniti et al. (19) and modified by Albini et al. (20) was utilized. KS-CM was concentrated 10x in Centricon (cut-off 3 kDa, Amicon-Millipore, Billerica MA) and added to liquid matrigel containing heparin at 4°C to a final volume of 0.5 ml. C57/bl6 mice were treated everyday with LA (86 µg per mouse per day, corresponding to
150 mg/kg dose) in drinking water, starting from 3 days before matrigel injection. Ten implants were used for each experimental point. Hemoglobin content quantification and histological analysis were performed as described previously (20).
The same assay was used to assess the anti-angiogenic activity of recombinant TRAIL or inhibin-ßa/activin-A (100 ng per implant) added to liquid matrigel, using a vascular endothelial growth factor (VEGF) (50 ng/ml) + TNF-alpha (2 ng/ml) + heparin (26 U/ml) cocktail as angiogenesis inducers and eight implants for each experimental point, as described previously (14).
In vivo tumor growth
Kaposi's sarcoma tumor growth was obtained as described previously (14). LA (86 µg per mouse per day) was administered in sterilized drinking water to nude mice, starting from the day of tumor cells injection. Tumor size was assessed on days 9, 11, 13, 16, 18, 20, 23, 25 and 27. All animals (eight for each experimental point) were killed when the first tumor reached the size of
1 cm3. Samples were paraffin embedded and stained with hematoxylin and eosin for histological analysis. Vessel quantification was obtained by analyzing 10 µm-thick tissue slices under a fluorescence microscope (100x total magnification) with a triple-band filter: thick slices do not loose erythrocytes from vessels which, in turn, show a strong orange auto-fluorescence; CD-31 staining was also performed on some 3 µm-thin slices of tumor samples (with an anti-CD-31 rat monoclonal antibody, clone BM4086B, Acris, Germany) for confirmation.
Growth assay
At day 0, cells were plated in 96-microwell plates at 1000 cells in 200 µl of culture medium. LA was added to the cells at different concentrations (10, 50, 250, 500 and 1000 µM). Due to the different growth rates, KS-Imm cells were monitored at days 2 and 4, whereas HUVECs were quantified at days 3 and 5. Indirect optical density quantification was obtained fixing/staining the cells for 20 min with a crystal violet solution as described previously (14).
Chemotaxis
Cell migration was assessed in Boyden chambers (Costar no longer produces chemotaxis chambers, Neuro Probe, Gaithersburg, MD 20877 USA) using serum-free 3T3-conditioned medium (for KS-Imm) or KS-CM (for HUVECs) as chemoattractants as described previously (14,16). Cells were pre-treated with LA at the indicated doses and times, and treated with the same concentration of LA used for preconditioning also during the chemotaxis assay. Cell migration was assessed by direct counting of five to eight unit fields per filter or densitometric scanning of whole filter surface. Each test was performed in triplicate and repeated three times.
Adhesion
The 96-microwell plates for bacterial culture (Nunc GmbH, Wiesbaden, Germany) were pre-coated with 100 µl per well of water containing gelatin (50 µg/ml). After 1 h, all coating solution was removed and HUVE or KS-Imm cells were plated (3000 cells/200 ml per well) in Dulbecco's modified Eagle's medium 1% bovine serum albumin. Cell cultures were treated with LA either only during the test or for 24 h or 4 days before the test. Cells were incubated for 2 h at 37°C in 5% CO2 and eventually quantified by crystal violet solution as above.
Apoptosis
Cytoplasmic histone-associated DNA fragmentation was evaluated by the Cell Death Detection Kit, Roche, Milan, Italy according to manufacturer's instructions. KS-Imm and HUVE cells were plated (20 000 cells/ml per well) in complete medium and allowed to grow for 48 h in 24-well plates. After this stabilization period, the culture medium was changed and supplemented either with LA (0, 10, 50, 250, 500 and 1000 µg/ml) or vincristine (0.51 µM).
Preparation of RNA and cRNA
Total RNA for microarray experiments was isolated from HUVECs treated for 5 h with 200 µM LA as described previously (21). RNA samples were similarly prepared for real-time polymerase chain reaction (PCR) testing using KS-Imm and HUVE cells treated with 10, 50, 250, 500 and 1000 mM LA for 24 h, 48 h and 4 days.
Gene chip microarray analysis and data normalization
The labeled cRNAs were used for screening GeneChip Human Genome U95Av2 arrays (Affymetrix, Santa Clara, CA). Data were collected using an Affymetrix scanner. The raw data of 32 features for each probe set were analyzed by Microarray Analysis Suite MAS 5.0. This included a statistical analysis of data consistency (one-sided Wilcoxon's signed rank test) within a probe set that yielded a P value for the expression call (present, absent and marginal) and the expression change between treated and control samples. Expression data and the expression and change P values were imported into the GeneSpring 4.2 microarray data analysis program (SiliconGenetics, Redwood City, CA). For normalization, the 50th percentile of all measurements was used as a positive control for each sample, each measurement for each gene was divided by this synthetic positive control, assuming that this was at least 10. The bottom 10th percentile was used as a test for correct background subtraction. This was never less than the negative of the synthetic positive control. Each gene was normalized to itself by making a synthetic positive control for that gene, and dividing all measurements for that gene by this positive control, assuming it was at least 0.01. The synthetic control was the median of the gene's expression values over all the samples. Lastly, normalized values below 0 were set to 0. The comparison of treated and mock-treated samples was limited to genes that were expressed above a threshold level of 20 with a detection P value < 0.005 in both arrays in at least one condition. Genes that showed an at least 1.6-fold expression change in both arrays of the drug-treated versus the mock-treated sample with a change P value < 0.05 were considered as consistently changed. Gene lists for functional annotations were created using the NetAffx (Affymetrix) annotation tool.
Real-time PCR time-lapse
Total RNAs were isolated from control and LA-treated KS-Imm and HUVE cells, grown in complete medium, using the RNeasy Mini Kit (Qiagen, Milano, Italy). Each sample was amplified in triplicate. Reverse transcription was performed with oligo-dT primers and mRNA expression for selected genes was analyzed by quantitative real-time reverse transcriptionPCR by using the following specific primers: interleukin 8forward: gacaagagccaggaagaaac and reverse: gctcgtaggtcagaaagatgtg; TRAILforward: tcagagagtagcagctcac and reverse: ccttgatgattcccaggagt; PIM-2hforward: ctcacagatcgactccaggtg and reverse: actttccatagcagtgcgactt; GPCR-kinase 5forward: aactgggagagaaagggaagg and reverse: gttctttgcacggcttctgtag; thioredoxin reductase 1forward: atggaagaacatggcatcaagt and reverse: cctcactattggtggactgagc; thioredoxin-interacting proteinforward:taattggcagcagatcaggtc and reverse: acatccatatagcagggagga; heregulin-ß2forward: tcagtatccacagaaggagcaa and reverse: gtctttcaccatgaagcactcc; ephrin-B2forward: cagacaagagccatgaagatc and reverse: caaagggacttgttgtcgaact; heme oxygenase-1forward: tgatagaagaggccaagactgc and reverse: ggcagaatcttgcactttgttg; inhibin-ßa/activin-Aforward: aacgggtatgtggagatagagga and reverse: aaatctcgaagtgcagcgtct.
cDNAs were amplified as described previously (21). Housekeeping gene RPII was used for data normalization, and relative expression values with standard errors and statistical comparisons (unpaired two-tailed t-test) were obtained using Qgene software (http://www.qgene.org).
Real-time PCR was also used to analyze the effect of 200 µM LA, on VEGF-A mRNA expression in KS-Imm treated for 24 h, 48 h or 4 days.
Fluorescence microscopy
HUVECs seeded on gelatin-coated multi-well chamber slides (LabTek, Nunc, Naperville, IL) were cultured at 37°C, pre-treated for 24 h, 48 h or 4 days with LA at the indicated doses. At the end of the incubation, mitochondria polarization was stained for 30 min at 37°C with the fluorescent probe MitoTrackerRed CMX ROS (Molecular Probes, Invitrogen, Milan, Italy) diluted in culture medium at 50 nM. Cells were then fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 5 min, and counterstained with 1 µg/ml 4',6-diamidino-2-phenylindole (DAPI) (SigmaAldrich) in PBS.
For immunofluorescence detection of thioredoxin reductase, a monoclonal antibody (Lab-Frontier, Seoul, Korea) at 1:100 dilution in PBS1% horse serum was incubated for 1 h with HUVE cells that had been treated with LA as above and fixed and permeabilized with cold methanol for 4 min at 20°C and blocked in PBS10% horse serum for 10 min. Cells were washed three times with PBS and incubated with fluoresceinated secondary anti-mouse antibody (Amersham-Pharmacia Biotech, Milano, Italy) at 1:200 dilution in PBS1% horse serum for 30 min. Cells were then counterstained with DAPI (1 µg/ml) for 5 min and washed in PBS. The slides were mounted with ProLong antifade reagent (Molecular Probes) and viewed in a Leica DM L epifluorescence microscope at 40x or 100x magnification. Simple DAPI staining was used to show the accumulation of the auto-fluorescent LA in HUVE cells.
Western blot analysis of proteins and cell signaling
HUVECs were cultured in standard conditions or treated with 250 µM LA, for 24 h, 48 h or 4 days in complete medium without further medium/LA addition. Cell samples were prepared and blotted as described previously (15). The membranes were then incubated with antibodies at the appropriate dilutions in 5% powdered skim milk dissolved in 25 mM Tris-buffered saline (TBS) containing 0.15 M NaCl, 0.05% Tween-20, if not otherwise stated. The following anti-human antibodies were used at the indicated dilutions: mouse monoclonal anti-inhibin-ßa (Serotec Ltd, Oxford, UK) and mouse monoclonal anti-thioredoxin reductase 1 (Lab-Frontier) 1:200 diluted in 5% skimmed milk, TBSTween 0.05%; rabbit anti-p-Akt and anti-Akt, rabbit anti-p-p38 and p-38 MAPK, rabbit anti-p-Fak and Fak and rabbit anti-p44/42 MAPK (Cell Signaling, Beverly, MA) 1:1000 diluted in 5% bovine serum albumin, TBSTween 0.1%; rabbit anti-p-Erk1/2 (Cell Signaling) 1:1000 diluted in 5% skimmed milk, TBSTween 0.1%; rabbit anti-GAPDH horseradish peroxidase conjugated, Novus, Littleton, CO) 1:2500 diluted in 5% skimmed milk, TBSTween 0.05%. The antibodies were reacted with the membranes for 1 h (anti-GAPDH), or 2 h (anti-inhibin), at room temperature, or overnight at 4°C (others). Secondary horseradish peroxidase-labeled anti-rabbit or anti-mouse antibodies (Amersham-Pharmacia Biotech) were used at 1:5000 dilution in 5% skim milk powder, TBSTween 0.05%. The immune reaction was revealed by the ECL-Plus detection system (Amersham-Pharmacia Biotech). The test was repeated three times on three different HUVEC preparations (experimental replicates).
| Results |
|---|
|
|
|---|
In vivo angiogenesis
Since previous data indicated that LA inhibited TNF-alpha-induced IkB kinase activation and nuclear translocation of NF-kB (9), and that studies by our group (14,15,21) and others (22) indicate that this is a common and key effect of many angioprevention agents, we studied the effect of LA on angiogenesis in vivo. KS-CM in a matrigel sponge was injected subcutaneously in c57/black mice (syngenic to matrigel components). In this condition, a rapid angiogenic response was observed within 4 days: quantification of the angiogenic response by hemoglobin content detection demonstrated that LA-treated implants contained
1/12 of hemoglobin as compared with untreated controls (Figure 1a), a significant reduction in hemoglobin content was confirmed in the histology observations, where control matrigel + KS-CM became filled with infiltrating cells, and large vascular lacunae lined by endothelium (Figure 1b). Whereas, when mice were treated with LA (86 µg per mouse per day, corresponding to
150 mg per man per day, one-fourth of the standard 600 mg dosage used for standard therapy or body building), a dramatic block of infiltration and angiogenesis was observed. The histology of these samples shows an almost empty matrix with few cells scattered in it (Figure 1c). Statistical significance of the angiogenic status found in treated versus untreated mice was assessed by Student's t-test (P = 0.0016).
|
In vivo tumor growth
When KS-Imm cells were injected in nude mice, they formed large, non-metastatic, tumors, characterized by evident vascularization, similar to human KS lesions. The daily administration of LA (86 µg per mouse per day, as in the angiogenesis assay) in drinking water caused a significant reduction in the KS tumor growth rate (Figure 2a). The differences in tumor growth between LA-treated and -untreated controls were always statistically significant (P
0.05, Student's t-test) starting from the ninth day of the experiment, except for the time point at the sixteenth day (P = 0.078). In our experience, this growth repression would be consistent with an inhibitory effect linked to the reduced recruitment of endothelial cells seen in the matrigel plug assays. This hypothesis was reinforced by the histological analysis of collected KS-Imm tumors; in the presence of LA, vessels were less frequent and degenerating tumor cells with picnotic nuclei were often observed (Figure 2b). Direct vessel quantification showed a 56% reduction when controls were compared with LA-treated tumors (14.9 ± 1.3 versus 8.3 ± 1.8 per field, respectively; P = 0.0013, Student's t-test). It is important to notice that a putative anti-angiogenic agent able to block endothelial recruitment without any toxic effect on the endothelium itself would be the best choice for any long-lasting treatment of angiogenesis-sustained pathologies. To gain insights on the effects of LA directly on endothelial and KS cells, we tested the effects of this molecule in vitro.
|
Growth assays
LA was tested for its ability to modulate KS-Imm and HUVE cells growth. Interestingly, LA showed a dual effect according to the different concentrations used, the time and the cell type (Figure 3). On KS-Imm cells, LA showed no inhibitory effect after 48 h of culture at any of the doses tested (10, 50, 250, 500 and 1000 µM), whereas a surprising growth-inducing activity was observed at 4 days with doses ranging from 10 to 250 µM. The growth-promoting activity was higher at the lower dose of LA tested (10 µM). High LA doses (500 and 1000 µM) showed, respectively, not significant or clear inhibitory activity as compared with untreated controls. Student's t-test was used to weigh the differences between untreated and LA-treated KS-Imm cells: the statistical significance was obtained both at 2 and 4 days for almost all the experimental points (P values
0.0149), except for 500 µM LA, at the fourth day (P = 0.3919). In HUVE cells, LA showed significant modulation of cell growth, although with longer incubation times than those observed with KS-Imm (Figure 3). In these cells, the growth-promoting activity of LA was weak, whereas high doses (5001000 µM) reduced HUVEC proliferation, but only after 5 days of culture. In HUVECs, at the third day no statistically significant variations were found, whereas at the fifth day, only 50 µM LA did not reach significance (P = 0.119). For the other doses of LA, the P value was
0.019 (Student's t-test).
|
Taken together, these observations show a null or positive effects of low-dose LA on cell growth, whereas only high-dose LA can exert some inhibitory potential after several days of treatment.
The same experimental setting was applied to other tumor cell lines of different histotypes (prostate: PC3; breast: MDA435; retina: Y79; myeloid: K562) to test if the inhibiting/promoting activity of LA is linked to particular cells or is a common feature of this molecule. Only one (MDA435) among these cell lines was affected by LA treatment, with a partial inhibition of growth at high doses, but no promotion was observed at low doses of LA (data not shown). According to these results, we can deduce that a therapeutic effect of LA against in vivo tumor growth was not mediated by cytotoxicity on the tumor cells; in contrast, it was able to repress KS-Imm tumor growth in vivo even though it stimulated growth of these cells in vitro.
Chemotaxis
Both tumor metastasis and angiogenesis imply cell migration, the first to spread tumor cells out of primary site and the second to make endothelial cell cross basement membrane and move towards an angiogenic stimulus. When LA was tested treating KS-Imm for 24 h, only a weak inhibition of migration was observed using the highest dose (1000 µM). In this case, the migration was
65% of controls (Figure 4a). When KS-Imm cells were exposed to LA for 4 days, a clear doseresponse curve was observed (Figure 4a), with LA acting as an inhibitor at all doses tested. Even in this experimental setting, the highest inhibitory activity was observed with 1000 µM LA. Student's t-test was used to weigh the differences between untreated and LA-treated KS-Imm cells: statistical significance at 24 h was obtained only with 1000 µM LA (P = 0.04), and at 4 days, all the doses of LA gained significance (P values
0.04).
|
When endothelial cells were treated for 24 h, 48 h or 4 days with LA, a different response was observed (Figure 4b). At 24 h, LA caused a dose-dependent inhibition of cell migration. After 48 h treatment, LA was apparently less able to inhibit HUVEC migration at the lower, non-cytotoxic, doses; in fact, only 500 and 1000 µM LA, induce significant reductions of cell chemotaxis. After 4 days of LA treatment, HUVEC response is even more altered: 10 µM LA induced a significant increase in the chemotactic ability of HUVECs, and the same increasing trendthough not statistically significantwas observed for 50 µM LA. Higher doses of LA (2501000 µM) were clear inhibitors of HUVEC migration, the higher dose leading to the complete inhibition of cell response. In HUVECs, statistical significance at 24 h was obtained with 50, 500 and 1000 µM LA (P values
0.041), at 48 h with 500 and 1000 µM LA (P values
0.029), and at 4 days with 10, 250, 500 and 1000 µM LA (P values
0.010). These data suggest that LA exerts a short-term dose-dependent inhibitory effect on endothelial cell migration, whereas a long-term treatment can cause opposite effects according to the dose used. The activity on KS-Imm cell migration seems almost subverted, with no inhibition by short incubation and a dose-dependent inhibition after 4 days of LA treatment.
Adhesion
An altered adhesion to the substrate could explain the reduced migration of LA-treated cells. To check this hypothesis, we tested both HUVE and KS-Imm cells for their ability to adhere to a gelatin substrate in the presence or absence of LA. No positive or negative effect was observed at any dose of LA tested on both cell lines if LA was used during the test without cell pretreatment (data not shown). This observation excludes a possible physical, direct, interference played by LA on adhesion molecules or matrix coating.
When KS-Imm were treated for 24 h with LA at 10, 250 and 1000 µM, their adhesive properties on gelatin appeared unaffected (Figure 5a). The same concentrations of LA acted as dose-dependent inhibitors after 4 days of treatment. Student's t-test was used to weigh the differences between untreated and LA-treated KS-Imm cells: no statistical significance was obtained at 24 h, and at 4 days, all LA treatments produced significant data (P values
0.012). The effect of LA on HUVEC adhesion after 24 h of treatment was weak, with a slight increase of adhesion with 10 and 250 µM LA, and a decrease with 1000 µM LA. After 4 days of treatment with 10 µM LA, the adhesion on gelatin was further increased (132%), whereas the 1000 µM dose almost completely abolished cell adhesion (Figure 5b). Statistical significance was obtained already at 24 h for all LA treatments (P values
0.041), and at 4 days for 10 and 1000 µM LA (P values
0.004).
|
These observations suggest a possible contribution of adhesive pathways or cytoskeleton assembly to the inhibitory effects of LA on HUVECs, though the apparently opposite effects observed on HUVECs with 10 µM LA, in adhesion and chemotaxis experiments at 24 h and 4 days suggest a non-univocal linkage between adhesivechemotactic properties and LA inhibition.
Apoptosis
The growth assays showed that LA, depending on the doses tested, can either promote cell growth or act as a cytostatic agent. Accordingly, we examined the effects of LA on apoptosis. LA used alone on KS-Imm at the dose of 250 or 1000 µM for 24 h did not modulate apoptosis, whereas 4 days of treatment induced a statistically significant increase of the apoptotic rate with 1000 µM LA (Figure 6a). When KS-Imm cells were treated with 0.5 µM vincristine, a strong apoptotic rate was observed. LA did not show any protective effect at 250 and 1000 µM, when the cells were treated 24 h or 4 days before vincristine challenge (Figure 6b). Student's t-test was used to weigh the differences between untreated and LA-treated KS-Imm cells: no statistical significance was obtained at 24 h, and at 4 days, 1000 µM LA produced a significant variation (P value = 0.010). No significant variation was found in KS-Imm samples treated with vincristine.
|
HUVE cells were almost unaffected after 24 h of treatment with 10, 50, 250, 500 or 1000 µM LA (Figure 6c), with a minor, but statistically relevant, reduction of the basal apoptotic rate with LA doses at or over 50 µM. When HUVECs were treated with 1 µM vincristine in complete medium, a slight increase of apoptosis was observed (1.2-fold as compared with untreated controls). Again, LA acted as a suppressor of apoptosis with doses over 50 µM. In HUVECs, statistical significance was achieved with LA doses
50 µM, both with (P values
0.045) or without (P values
0.036) vincristine treatment.
Gene chip microarray analysis
Although LA appeared to be an efficacious anti-angiogenic agent in vivo and to inhibit endothelial cell migration in vitro, the contrasting effects observed with diverse doses in vitro led us to further investigate the mechanisms underlying these effects. Microarray-based analysis of early genes, expressed in HUVE cells treated for 5 h with LA and showing at least 1.6-fold expression change during LA (200 µM/5 h) treatment, produced a list of 51 genes whose expression was significantly altered, where 30 appeared to be up-regulated by LA and 21 down-regulated. Using a 2-fold increase or decrease threshold, the number of modulated genes counted only nine and six records, respectively, indicating that LA, at low dose for short periods, has no drastic effects on gene expression in endothelial cells. This would be consistent with limited toxicity of LA.
Most of the genes modulated by LA can be categorized as being implicated in cell cycle/proliferation/apoptosis or oxidative stress/inflammation. These two groups account at least for 61% (31 of 51) of the genes affected by LA. As some of the genes regulated by LA have an unknown function, this percentage could be underestimated.
Among the 18 genes involved in cell cycle/proliferation/apoptosis, we found up-regulated proliferation inducers like heregulin-ß2/neuregulin, PIM-2h, Ki-67 and neuropilin, accompanied by modulators/effectors of cell differentiation such as estrogen-responsive B box protein, inhibin-ßa/activin-A, protein kinase C-alpha and neural cell adhesion molecule (Table I). On the other hand, cell cycle inhibitors and apoptosis inducers including Fas/APO-1, Rb-1, G protein-coupled receptor (GPCR)-kinase 5, CCR4-NOT, ephrin-B2 and TRAIL/APO-2L appeared to be down-regulated (Table I). This gene regulation profile would suggest a commitment of short-term LA-treated endothelial cell towards a healthy, differentiating/proliferating phenotype.
|
We attributed 13 genes to the oxidative stress/inflammation list (Table II), most of these RNAs were up-regulated. Heme oxygenase-1 (HO-1), protecting from oxidative damage, appears as the most intensely regulated gene by LA, with a 6.4-fold increase, followed by thioredoxin reductase 1 (2.3x), whose gene product is involved in LA reduction to the active form dihydrolipoic acid. The modulation of genes in this group would apparently indicate a cellular response induced by inflammation/oxidative stress with production of protective proteins (HO-1, C/Ebp-homologous protein, nicotinamide adenosine dinucleotide phosphate (NADPH) dehydrogenase, human mineralocorticoid receptor) and inflammatory cytokines/receptors (IL-8 and IL-6 signal transducer gp130). Interestingly, unlike that previously observed for NAC and to a lesser extent EGCG (21), we did not observe obvious modulation of genes related to the NF-kB pathway.
|
LA-induced gene expression quantified by real-time PCR
We selected 10 representative genes among those found modulated in the microarray analysis and used them to confirm the microarray data and execute more detailed analyses of the effects of LA over time on cells in vitro. The genes chosen were as followsfor cell cycle/proliferation/apoptosis: TRAIL, heregulin-ß2, PIM-2h, inhibin-ßa/activin-A, ephrin-B2 and GPCR-kinase 5; for oxidative stress/inflammation: thioredoxin reductase 1, thioredoxin-interacting protein, HO-1 and IL-8. A short-term exposure to LA does not seem to strongly influence RNA expression in microarray analysis, and in vitro tests described above on KS-Imm and HUVECs show significant modulatory activity by LA only in a time- and dose-dependent mode. We consequently used LA at 200 and 1000 µM concentrations and treatment times of 24 h, 48 h and 4 days. Statistical analysis of each time point compared with the basal level of gene expression was performed by Student's t-test, and the complete list of P values is shown in Table III.
|
Cell cycle/proliferation/apoptosis
TRAIL.
This gene was found weakly down-regulated in KS-Imm treated with 200 µM LA for 24 h, and a longer treatment caused this gene to revert to basal levels of expression (Figure 7); on the contrary, 1000 µM LA induced a time-dependent increase of TRAIL mRNA reaching 9.85-fold levels as compared with controls after 4 days. In HUVECs, TRAIL was always down-regulated at 24 h and, as observed for KS-Imm, a longer treatment caused this gene to revert to basal levels, though this modulation was similar for both LA doses.
|
Heregulin ß 2.
In KS-Imm, this gene was weakly up-regulated only with 200 µM LA (2.35 fold at 24 h), maintaining similar expression levels in the following days. High-dose LA did not affect the expression of this gene. In HUVECs, heregulin ß 2 was not modulated consistently in the long term, despite the up-regulation observed in the microarray screening at 5 h treatment with 200 µM LA.
PIM-2h.
Although KS-Imm did not show any modulation of this mRNA, in HUVE cells, PIM-2h was significantly up-regulated after 48 h (maximum value 3-fold at 4 days with 1000 µM LA).
Inhibin-ßa/activin-A.
In KS-Imm, both 200 and 1000 µM LA were able to induce a significant increase of this mRNA after 48 h, with high-dose LA being more active (8.62-fold at 4 days). In HUVECs, 200 µM LA induced the down-regulation of this mRNA after 24 h that was maintained at lower levels (0.28-, 0.29- and 0.26-folds at 24 h, 48 h and 4 days). On the contrary, high-dose LA caused a partial up-regulation of inhibin-ßa/activin-A, with a 2.7-fold increase after 4 days of LA treatment.
Ephrin B 2.
This gene was poorly affected in KS-Imm, whereas it was down-regulated in HUVECs treated with 200 µM LA (0.14-fold at 4 days). High-dose LA was able to cause a weaker down-regulation (0.27-fold at 4 days).
GPCR-kinase 5.
This gene was unaffected in KS-Imm, whereas it reached significant modulation in HUVECs, where it appeared to be consistently up-regulated after 4 days (2.77- and 8.00-fold for 200 and 1000 µM LA, respectively).
Oxidative stress/inflammation
The first interesting observation was obtained by observing the expression levels of thioredoxin reductase, the enzyme directly acting on LA (reducing it to the dihydrolipoic acid (DHLA) form). This gene was not only up-regulated upon LA treatment but also represented the most intensely expressed gene in both KS-Imm and HUVECs among the 10 selected genes (the mean normalized expression of thioredoxin reductase 1 in untreated HUVECs and KS-Imm was 2 to 3 log higher as compared with the levels of the other genes, data not shown).
Thioredoxin reductase 1.
This gene was always up-regulated both in KS-Imm and HUVECs upon LA treatment (Figure 7), and the effect of LA appeared dose and time dependent indicating the strong correlation between LA and the enzyme used for its conversion to the reduced form, DHLA. Maximal modulating values ranged from 4.47-fold in KS-Imm (at 48 h) to 18.02-fold for HUVECs (at 4 days).
Thioredoxin-interacting protein.
Although a short exposition to 200 µM LA down-regulated this enzyme in the microarray analyses, after 48 h of high-dose LA, this mRNA was strongly up-regulated in HUVECs as a probable attempt to preserve NADPH reserves from complete consumption through LA reduction to DHLA by thioredoxin reductase 1. The response to 200 µM LA was weaker, whereas in KS-Imm, this dose of LA sustained a strong down-regulation of this gene.
IL-8.
In KS-Imm, IL-8 was time dependently up-regulated by LA, the 200 µM dose being more effective (17.22-fold at 4 days). In HUVECs, the up-regulation was less powerful and more rapid when using high-dose LA (maximum 5.48-fold at 4 days).
Heme oxygenase 1.
Unaffected in KS-Imm cells, this gene was up-regulated in HUVECs, with higher and more rapid modulation at 200 µM LA (7.64-fold at 24 h).
These data show that LA activity is directly linked to the dose and time of cell exposition, possibly causing opposite effects on cell behavior. These data led us to further investigate specific aspects of LA effects in cells in vitro.
VEGF-A expression in KS-Imm cells treated with LA
In endothelial cells, thioredoxin reductase 1 acts as an inducer of HO-1 (23) and this molecule was described to induce VEGF expression (24,25); therefore, we decided to verify if this induction could also be active in KS-Imm. In vitro, control KS-Imm samples showed a comparable expression of VEGF-A at 24 and 48 h of culture (mean normalized expressions were 1.15-02 and 1.13-02, respectively), whereas a doubling was observed after 4 days of culture (mean normalized expression was 2.28-02). In the presence of 200 µM LA, the mRNA of VEGF-A showed a weak and not statistically significant time-dependent increase, reachingat 4 dayslevels almost identical to untreated controls (mean normalized expressions at 24 h, 48 h and 4 days were, 1.63-02, 1.97-02 and 2.32-02, respectively), suggesting that LA in KS-Imm does not act as a significant inducer of VEGF. This observation can be linked to the lack of HO-1 induction described, for KS-Imm, in the previous paragraph.
Fluorescence microscopy
LA has already been described to be able to induce mitochondrial permeabilization and oxygen consumption both in its oxidized and reduced (DHLA) form; this activity was accompanied by the production of reactive oxygen species able to induce mitochondrial damage and selective tumor cell death (26,27). These observations would be consistent with the possible induction of genes linked to oxidative stress in HUVECs. To verify if LA is able to trigger mitochondrial activation, we treated HUVECs with different doses of LA, imaging at different times the effective mitochondrial uptake of cationic, lipophilic fluorochrome chloromethyl-Xrosamine. LA (tested at 10, 250 and 1000 µM) elicited a similar activation of mitochondria, persistent for days (Figure 8, 48 h treatment). At 1000 µM, LA partially accumulated inside the cells, forming insoluble auto-fluorescent granular aggregates (data not shown), probably participating to the toxic effects of the molecule seen after 4 days. At this time point, the chloromethyl-Xrosamine uptake was reduced.
|
Thioredoxin reductase gene showed high levels of expression and modulation in HUVECs, and most likely represents a key mediator of LA activity and toxicity as it is involved in LA/DHLA conversion. We stained HUVE cells with fluorescein isothiocyanateanti-thioredoxin reductase 1 monoclonal antibody to verify modulation of thioredoxin reductase at the protein level. The expression of thioredoxin reductase was found up-regulated in dose- and time-dependent manner upon LA treatment (Figure 9).
|
Western blot analysis of proteins and cell signaling
The modulation of thioredoxin reductase 1 protein expression in HUVECs was confirmed by western blotting, showing its time-dependent up-regulation upon LA (250 µM) treatment (Figure 10). Inhibin-ßa/activin-A protein expression was also found up-regulated in a time-dependent fashion.
|
The up-regulation of mitochondrial activity together with the expression of well-known markers of oxidative stress is suggestive of an altered endothelial phenotype. In vitro data have shown that LA exerts modulatory effects on HUVE cell behavior; accordingly, we have verified if central transduction pathways were affected by LA.
To reproduce the experimental conditions of the growth assays, we prepared both untreated and LA-treated HUVEC samples at 24 h, 48 h and 4 days, in complete medium analyzing the phosphorylation of FAK, Erk1/2, Akt and p38-MAPK as compared with their amount of total protein and GAPDH expression (Figure 11). The western blot shows that phosphorylation of FAK is apparently down-regulated at 24 h and 4 days, whereas it is similar to untreated cells at 48 h. The phosphorylation status shown by Erk1/2 is weak as compared with untreated controls and, at 48 h, little p-Erk is detectable. Akt shows a generally weak phosphorylation signal at 24 and 48 h and does not appear to be substantially modulated by LA. Phospho-P38 is detectable only at the fourth day and it is strongly induced by LA treatment.
|
These biochemical data are in agreement with the in vitro observations, showing that LA influences key transduction pathways involved in cell growth, migration and adhesion.
Anti-angiogenic effects of TRAIL and inhibin-ßa/activin-A in vivo
Among the potential anti-angiogenic molecules induced by LA in KS-Imm, we find inhibin-ßa/activin-A and TRAIL; accordingly, we decided to test these proteins in the matrigel sponge model to evaluate their possible contribution to the anti-angiogenic effects of LA observed in vivo.
Both molecules showed a significant anti-angiogenic potential explaining why LA can limit KS-Imm tumor growth in vivo at doses not exerting a direct effect on the tumor cell itself (Figure 12).
|
| Discussion |
|---|
|
|
|---|
Anti-angiogenic therapy through VEGF inhibition has significantly increased lifespan for several tumors in clinical trials when combined to chemotherapy. These data suggest that further improvement in this approach has the potential to substantially extend patient lifespan. A gap in the phase III trials of anti-angiogenic molecules is linked to the recruitment of patients with advanced malignant tumors, where vascularization is at an advanced stage. How anti-VEGF therapy has attained these results is a matter of discussion. Tumor endothelial cells frequently skip final differentiation steps, showing poor pericyte covering and VEGF dependence (28,29); however, it is possible that tumor vessels under anti-VEGF therapy become normalized and deliver chemotherapy more effectively (30). An alternative targeting of tumor vessels could be obtained with a chemopreventive setting, where anti-angiogenic moleculeswithout side effectscould be administered to patients with low-stage/-grade tumors, or after surgical eradication or simply to people with increased risk of developing cancer. We are testing several angiopreventive drugs selected among the antioxidants: these molecules have high tolerability and their chronic use in humans often already approved or are common dietary practice.
We have shown previously that NAC and EGCG (a main constituent of green tea extract) exert a true anti-invasive activity inhibiting tumor and endothelial cell invasion by matrix metalloproteinase-2 neutralization (11,14,21,31,32). In addition, EGCG at high doses is also able to block the cell cycle (33). Several of these antioxidant angioprevention agents have the common effects of blocking the NF-kB and Akt pathways (11,14,21,31,32); since LA has been suggested to inhibit the NF-kB pathway (9), here we tested LA for possible angioprevention activity. Our data show that LA can exert different stimulatory/inhibitory activities on tumor and endothelial cells according to the dose and persistence of administration.
An ideal antioxidant should be efficiently adsorbed from diet, convertedif necessaryinto a usable form, helpful to establish/restore other antioxidants and to be able to work in both lipidic and aqueous phases. In addition, it also needs to exert low toxicity. LA fulfills all these requirements (34). It is not yet clear if LA is synthesized in mammals; whereas one study found LA synthase in mouse cells (35), in humans it is usually assumed with food (particularly red meat, liver, spinach and yeast). Our body does not need large amounts of LA coenzyme; on the contrary, a constant additional supply is needed for antioxidant or therapeutic activity. However, very little is known about the consequences of a long-term high-dose LA regimens and nothing is known about the activity of LA on most tumors.
Unlike other antioxidants, low, non-toxic doses of LA did not show any growth inhibitory effect on endothelial or tumor cells. This result is supported by the observation of the almost unaffected phosphorylation of Akt in LA-treated HUVECs, the lack of apoptosis induction and the partial protective effects LA exerts on endothelial cell survival in the presence of vincristine. In contrast to LA, angiopreventive antioxidants, such as EGCG and Xanthohumol, inhibited Akt phosphorylation and activation (14,15). In agreement with our data, Kowluru and Odenbach (36) have recently shown in a rat diabetic retinopathy model that LA administration inhibited capillary endothelial cell apoptosis in the retina. Further, Marsh et al. (37) observed that LA administered with vitamin E can induce bcl-2 in endothelial cells, though this effect was not evident with LA alone. In a different cell model, Byun et al. (38) showed that LA inhibits TNF-alpha-induced apoptosis in bone marrow stromal cells blocking c-jun N-terminal kinase and NF-kappaB. These data suggest that LA has a protective effect on endothelial and other cell types.
On the other hand, we observed a cytostatic effect at the higher doses of LA tested (0.51 mM); this effect was increased with time of incubation, and after 4 days of treatment at 1 mM, most endothelial cells were damaged, showing a cytoplasmatic auto-fluorescent granulation due to the accumulation of LA precipitates. When we tested tumor cells of different origins, the low-dose growth-promoting and high-dose inhibitory effect of LA was evident only in KS-Imm cells.
The null or promoting activity of LA on tumor cells is apparently in contrast with the results of van de Mark et al. (39) who reported a tumor-specific apoptosis-inducing activity for LA on FaDu and Jurkat tumor cell lines as well as on Ki-v-Ras-transformed Balb/c-3T3 as compared with normal cells. Our data show that diverse cell type can exhibit different levels of toleration or response to LA according to the dose and schedule of exposure, indicating that no general rule can be made.
The prevalent inhibitory effect of LA on HUVE cell migration could be linked to the reduced phosphorylation of Fak, though this pathway cannot completely clarify why long-term exposition to low-dose LA can cause a slight increase of cell motility.
The microarray-based screening suggested a selective clustering of cellular responses to low-dose LA in the oxidative stress/inflammation and growth/survival pathways. We selected a small group of genes to investigate further. KS-Imm and HUVECs showed substantial differences in the regulation of these mRNAs upon LA exposition: using an arbitrary cut-off of a ±3-fold gene modulation, in KS-Imm, PIM-2h, ephrin-B2, G-protein coupled receptor and HO-1 were not affected. Low-dose LA in KS-Imm was able to influence only IL-8 (strong up-regulation) and TrxIP (down-regulation), whereas high-dose LA up-regulated TRAIL, inhibin-ßa/activin-A, TrxR1 and IL-8. These findings are consistent with the lack of inhibitory activity of low-dose LA on KS-Imm in vitro, whereas high-dose LA for 4 days induces KS-Imm apoptosis and blocks the adhesive and chemotactic responses of these cells. Several published data indicate that stress-related mediators like HO-1 and TrxR1 can act as tumor promoters, also inducing angiogenic responses (24,25,4042); indeed, in endothelial cells themselves, this process is apparently active with complex regulations as both VEGF and TrxR1 are able to induce HO-1, which in turn can switch on several pro-angiogenic factors (23,4345). Several stress stimuli are able to induce HO-1 in endothelium, among which these in vitro infection by Kaposi's sarcoma-associated herpesvirus 8 (KSHV/HHV-8) (46); this activation is apparently mediated by the HHV-8 gene product GPCR, codifying for a constitutively active chemokine-like receptor (47). Of course, the induction of HO-1 by LA constitutes a possible bias for its translation to clinic, though, in our hands, LA fails to activate HO-1 transcription in KS cells and VEGF production is consequently unaffected. In addition, it is important to note that, although in vitro endothelial cells are permanently exposed to LA, in vivo, this drug is rapidly cleared from circulation, so the endothelial cell is exposed to it for very short periods reducing the stress activity.
Inhibin-ßa/activin-A is released early in the cascade of circulatory cytokines during systemic inflammatory episodes, generally coincident with TNF-alpha (48). Its up-regulation, along with IL-8, in a long-term high-dose LA regimen suggests a pro-inflammatory activity of LA. These data are in contrast to the inhibition of the NF-kB pathway reported previously (9). Inhibin-ßa/activin-A has been shown to inhibit both endothelial cell proliferation in vitro and angiogenesis in vivo (49), observations we confirmed by in vivo analyses, thus LA could push KS-Imm towards an anti-angiogenic phenotype.
LA mimics an oxidative signal in HUVECs even at subtoxic doses, triggering a form of cell resistance based on the down-regulation of anti-angiogenic and pro-apoptotic mediators, and the up-regulation of stress-induced proteins and phosphorylation of stress-related kinases [i.e. p38 (50)], induced by oxidative injury. These in vitro observations are in agreement with the genomic/protein data as the inhibitory effects of LA on KS-Imm are observed only after a long-term/high-dose treatment, whereas low-dose LA is already active on HUVECs after 24 h.
According to our observations, LA is able to limit KS tumor growth in vivo even without directly reducing KS cell survival/proliferation. This inhibition is probably, but not univocally, due to an anti-angiogenic mechanism as LA inhibits endothelial cell migration and induces the expression of the anti-angiogenic factor inhibin-ßa/activin-A both in HUVECs and in KS-Imm. In addition, LA-induced expression of TRAIL in KS-Imm could act as an additional anti-angiogenic factor as shown by the anti-angiogenic effect of TRAIL in vivo.
At low doses, LA did not effect endothelial cell survival or growth, suggesting that it is a safe drug for a long-term treatment of cancer patients. The pro-/anti-antioxidant activities of LA, observed in our tests and in other studies (5154), are usually linked to the different concentrations of the drug tested, suggesting the necessity of a more pointed choice of the therapeutic regimen according to pathology, possibly excluding the actual abuse of self-prescribed LA as a high-dose dietary supplement.
Taken together, our data show that LA represents a promising angiopreventive drug whose action appears to be quite different from that of other antioxidant angiopreventive molecules. The current application for diabetes-associated neuropathies could, in the near future, be extended to cancer and other angiogenesis-sustained pathologies. Further studies are needed to identify the plethora of possible cellular targets of this molecule, exclude those malignancies where LA could act as a tumor promoter (i.e. inducing HO-1 and/or TrxR1 transcription) and distinguish other anti-angiogenic mechanisms it might trigger, including inflammation itself.
| Acknowledgments |
|---|
We wish to acknowledge Anna Buffa, Sebastiano Carlone and Luca Anfosso for helpful starting experiments, and Dr Anna Maria Colacci for helpful discussion and suggestions. This study has been supported by grants from the Compagnia di San Paolo, the AIRC (Associazione Italiana per la Ricerca sul Cancro), the MIUR Progetto FIRB and Ricerca Finalizzata, the PNR-Oncologia and the Comitato Interministeriale per la Programmazione Economica (CIPE).
Conflict of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Bustamante J, et al. (1998) Alpha-lipoic acid in liver metabolism and disease. Free. Radic. Biol. Med. 24:10231039.[CrossRef][Web of Science][Medline]
- Estrada DE, et al. (1996) Stimulation of glucose uptake by the natural coenzyme alpha-lipoic acid/thioctic acid: participation of elements of the insulin signaling pathway. Diabetes 45:17981804.[Abstract]
- Konrad D, et al. (2001) The antihyperglycemic drug alpha-lipoic acid stimulates glucose uptake via both GLUT4 translocation and GLUT4 activation: potential role of p38 mitogen-activated protein kinase in GLUT4 activation. Diabetes 50:14641471.
[Abstract/Free Full Text] - Jacob S, et al. (1995) Enhancement of glucose disposal in patients with type 2 diabetes by alpha-lipoic acid. Arzneimittelforschung 45:872874.[Medline]
- Da Ros R, et al. (2005) Molecular targets of diabetic vascular complications and potential new drugs. Curr. Drug Targets 6:503509.[CrossRef][Web of Science][Medline]
- Ziegler D. (2004) Thioctic acid for patients with symptomatic diabetic polyneuropathy: a critical review. Treat Endocrinol. 3:173189.[CrossRef][Medline]
- Haak E, et al. (2000) Effects of alpha-lipoic acid on microcirculation in patients with peripheral diabetic neuropathy. Exp. Clin. Endocrinol. Diabetes 108:168174.[CrossRef][Web of Science][Medline]
- Teichert J, et al. (2003) Plasma kinetics, metabolism, and urinary excretion of alpha-lipoic acid following oral administration in healthy volunteers. J. Clin. Pharmacol. 43:12571267.
[Abstract/Free Full Text] - Zhang WJ, et al. (2001) Alpha-lipoic acid inhibits TNF-alpha-induced NF-kappaB activation and adhesion molecule expression in human aortic endothelial cells. FASEB J. 15:24232432.
[Abstract/Free Full Text] - Bergers G, et al. (2003) Tumorigenesis and the angiogenic switch. Nat. Rev. Cancer 3:401410.[CrossRef][Web of Science][Medline]
- Tosetti F, et al. (2002) Angioprevention': angiogenesis is a common and key target for cancer chemopreventive agents. FASEB J. 16:214.
[Abstract/Free Full Text] - Albini A, et al. (2001) Inhibition of angiogenesis-driven Kaposi's sarcoma tumor growth in nude mice by oral N-acetylcysteine. Cancer Res. 61:81718178.
[Abstract/Free Full Text] - Cai T, et al. (1999) N-acetylcysteine inhibits endothelial cell invasion and angiogenesis. Lab Invest 79:11511159.[Web of Science][Medline]
- Fassina G, et al. (2004) Mechanisms of inhibition of tumor angiogenesis and vascular tumor growth by epigallocatechin-3-gallate. Clin. Cancer Res. 10:48654873.
[Abstract/Free Full Text] - Albini A, et al. (2006) Mechanisms of the antiangiogenic activity by the hop flavonoid xanthohumol: NF-kappaB and Akt as targets. FASEB J. 20:527529.
[Abstract/Free Full Text] - Albini A, et al. (2004) The "chemoinvasion assay": a tool to study tumor and endothelial cell invasion of basement membranes. Int. J. Dev. Biol. 48:563571.[CrossRef][Web of Science][Medline]
- Benelli R, et al. (1999) In vitro models of angiogenesis: the use of Matrigel. Int. J. Biol. Markers 14:243246.[Web of Science][Medline]
- Albini A, et al. (1997) The beta-core fragment of human chorionic gonadotrophin inhibits growth of Kaposi's sarcoma-derived cells and a new immortalized Kaposi's sarcoma cell line. AIDS 11:713721.[CrossRef][Web of Science][Medline]
- Passaniti A, et al. (1992) A simple, quantitative method for assessing angiogenesis and antiangiogenic agents using reconstituted basement membrane, heparin, and fibroblast growth factor. Lab Invest 67:519528.[Web of Science][Medline]
- Albini A, et al. (1994) Angiogenic potential in vivo by Kaposi's sarcoma cell-free supernatants and HIV-1 tat product: inhibition of KS-like lesions by tissue inhibitor of metalloproteinase-2. AIDS 8:12371244.[Web of Science][Medline]
- Pfeffer U, et al. (2005) Molecular mechanisms of action of angiopreventive anti-oxidants on endothelial cells: microarray gene expression analyses. Mutat. Res. 591:198211.[Web of Science][Medline]
- Singh RP, et al. (2005) Silibinin strongly inhibits growth and survival of human endothelial cells via cell cycle arrest and downregulation of survivin, Akt and NF-kappaB: implications for angioprevention and antiangiogenic therapy. Oncogene 24:11881202.[CrossRef][Web of Science][Medline]
- Trigona WL, et al. (2006) Thioredoxin reductase regulates the induction of haem oxygenase-1 expression in aortic endothelial cells. Biochem. J. 394:207216.[CrossRef][Web of Science][Medline]
- Kaga S, et al. (2005) Resveratrol enhances neovascularization in the infarcted rat myocardium through the induction of thioredoxin-1, heme oxygenase-1 and vascular endothelial growth factor. J. Mol. Cell. Cardiol. 39:813822.[CrossRef][Web of Science][Medline]
- Dulak J, et al. (2004) Complex role of heme oxygenase-1 in angiogenesis. Antioxid. Redox Signal. 6:858866.[Web of Science][Medline]
- Morkunaite S, et al. (2000) Mechanism of dihydrolipoate stimulation of the mitochondrial permeability transition: effect of different respiratory substrates. IUBMB Life 49:211216.[CrossRef][Web of Science][Medline]
- Wenzel U, et al. (2005) Alpha-lipoic acid induces apoptosis in human colon cancer cells by increasing mitochondrial respiration with a concomitant O2-.-generation. Apoptosis 10:359368.[CrossRef][Web of Science][Medline]
- Yonenaga Y, et al. (2005) Absence of smooth muscle actin-positive pericyte coverage of tumor vessels correlates with hematogenous metastasis and prognosis of colorectal cancer patients. Oncology 69:159166.[CrossRef][Web of Science][Medline]
- Hellstrom M, et al. (2001) Lack of pericytes leads to endothelial hyperplasia and abnormal vascular morphogenesis. J. Cell Biol. 153:543553.
[Abstract/Free Full Text] - Jain RK. (2005) Normalization of tumor vasculature: an emerging concept in antiangiogenic therapy. Science 307:5862.
[Abstract/Free Full Text] - Morini M, et al. (1999) The role of the thiol N-acetylcysteine in the prevention of tumor invasion and angiogenesis. Int. J. Biol. Markers 14:268271.[Web of Science][Medline]
- Garbisa S, et al. (1999) Tumor invasion: molecular shears blunted by green tea. Nat. Med. 5:1216.[CrossRef][Web of Science][Medline]
- Gupta S, et al. (2003) Molecular pathway for (-)-epigallocatechin-3-gallate-induced cell cycle arrest and apoptosis of human prostate carcinoma cells. Arch. Biochem. Biophys. 410:177185.[CrossRef][Web of Science][Medline]
- Packer L, et al. (1996) Alpha-lipoic acid: the metabolic antioxidant. Free Radic. Biol. Med. 20:625626.[CrossRef][Web of Science][Medline]
- Morikawa T, et al. (2001) Do mammalian cells synthesize lipoic acid? Identification of a mouse cDNA encoding a lipoic acid synthase located in mitochondria. FEBS Lett. 498:1621.[CrossRef][Web of Science][Medline]
- Kowluru RA, et al. (2004) Effect of long-term administration of alpha-lipoic acid on retinal capillary cell death and the development of retinopathy in diabetic rats. Diabetes 53:32333238.
[Abstract/Free Full Text] - Marsh SA, et al. (2005) Bcl-2 in endothelial cells is increased by vitamin E and alpha-lipoic acid supplementation but not exercise training. J. Mol. Cell. Cardiol. 38:445451.[CrossRef][Web of Science][Medline]
- Byun CH, et al. (2005) Alpha-lipoic acid inhibits TNF-alpha-induced apoptosis in human bone marrow stromal cells. J. Bone Miner. Res. 20:11251135.[CrossRef][Web of Science][Medline]
- van de Mark K, et al. (2003) Alpha-lipoic acid induces p27Kip-dependent cell cycle arrest in non-transformed cell lines and apoptosis in tumor cell lines. J. Cell. Physiol. 194:325340.[CrossRef][Web of Science][Medline]
- Nowis D, et al. (2006) Heme oxygenase-1 protects tumor cells against photodynamic therapy-mediated cytotoxicity. Oncogene 25:33653374.[CrossRef][Web of Science][Medline]
- Jazwa A, et al. (2006) Effect of heme and heme oxygenase-1 on vascular endothelial growth factor synthesis and angiogenic potency of human keratinocytes. Free Radic. Biol. Med. 40:12501263.[CrossRef][Web of Science][Medline]
- Yoo MH, et al. (2006) Thioredoxin reductase 1 deficiency reverses tumor phenotype and tumorigenicity of lung carcinoma cells. J. Biol. Chem. 281:1300513008.
[Abstract/Free Full Text] - Loboda A, et al. (2005) Heme oxygenase-1-dependent and -independent regulation of angiogenic genes expression: effect of cobalt protoporphyrin and cobalt chloride on VEGF and IL-8 synthesis in human microvascular endothelial cells. Cell. Mol. Biol. (Noisy-le-grand) 51:347355.[Medline]
- Bussolati B, et al. (2004) Bifunctional role for VEGF-induced heme oxygenase-1 in vivo: induction of angiogenesis and inhibition of leukocytic infiltration. Blood 103:761766.
[Abstract/Free Full Text] - Deramaudt BM, et al. (1998) Gene transfer of human heme oxygenase into coronary endothelial cells potentially promotes angiogenesis. J. Cell. Biochem. 68:121127.[CrossRef][Web of Science][Medline]
- McAllister SC, et al. (2004) Kaposi sarcoma-associated herpesvirus (KSHV) induces heme oxygenase-1 expression and activity in KSHV-infected endothelial cells. Blood 103:34653473.
[Abstract/Free Full Text] - Marinissen MJ, et al. (2006) Inhibition of heme oxygenase-1 interferes with the transforming activity of the Kaposi sarcoma herpesvirus-encoded G protein-coupled receptor. J. Biol. Chem. 281:1133211346.
[Abstract/Free Full Text] - Phillips DJ, et al. (2001) Evidence for activin A and follistatin involvement in the systemic inflammatory response. Mol. Cell. Endocrinol. 180:155162.[CrossRef][Web of Science][Medline]
- Breit S, et al. (2000) The N-myc oncogene in human neuroblastoma cells: down-regulation of an angiogenesis inhibitor identified as activin A. Cancer Res. 60:45964601.
[Abstract/Free Full Text] - Griendling KK, et al. (2000) Modulation of protein kinase activity and gene expression by reactive oxygen species and their role in vascular physiology and pathophysiology. Arterioscler. Thromb. Vasc. Biol. 20:21752183.
[Abstract/Free Full Text] - Alleva R, et al. (2005) Alpha-lipoic acid supplementation inhibits oxidative damage, accelerating chronic wound healing in patients undergoing hyperbaric oxygen therapy. Biochem. Biophys. Res. Commun. 333:404410.[CrossRef][Web of Science][Medline]
- Savitha S, et al. (2005) Oxidative stress on mitochondrial antioxidant defense system in the aging process: role of DL-alpha-lipoic acid and L-carnitine. Clin. Chim. Acta 355:173180.[CrossRef][Web of Science][Medline]
- Cakatay U, et al. (2005) Prooxidant activities of alpha-lipoic acid on oxidative protein damage in the aging rat heart muscle. Arch. Gerontol. Geriatr. 40:231240.[CrossRef][Web of Science][Medline]
- Bhatti F, et al. (2005) Mechanisms of antioxidant and pro-oxidant effects of alpha-lipoic acid in the diabetic and nondiabetic kidney. Kidney Int. 67:13711380.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
L. A. O'Brien, M. A. Richardson, D. T. Berg, B. Gerlitz, A. Gupta, and B. W. Grinnell The Puzzling Role of TRAIL in Endothelial Cell Biology Arterioscler Thromb Vasc Biol, February 1, 2008; 28(2): e5 - e6. [Full Text] [PDF] |
||||
![]() |
A. Albini, D. M. Noonan, and N. Ferrari Molecular Pathways for Cancer Angioprevention Clin. Cancer Res., August 1, 2007; 13(15): 4320 - 4325. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||













