Carcinogenesis Advance Access originally published online on November 17, 2006
Carcinogenesis 2007 28(5):1094-1103; doi:10.1093/carcin/bgl215
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Up-regulation of DLK1 as an imprinted gene could contribute to human hepatocellular carcinoma




1 Shanghai-Ministry Key Laboratory of Disease and Health Genomics, Chinese National Human Genome Center at Shanghai, 351 Guo Shou-Jing Road, Shanghai 201203, China
2 The State-Key Laboratory for Oncogenes and Related Genes, Shanghai Cancer Institute, Shanghai Jiaotong University, LN 2200/25, Xietu Road, Shanghai 200032, China
3 Department of Pathology, The First Affiliated Hospital of Xuzhou Medical College, 99 Huaihai Road, Xuzhou, Jiangsu 221002, China
4 Affiliated Cancer Hospital of Guangxi Medical College, 71 Heti Road, Nanning, Guangxi 530021, China
5 Department of Chemistry, Fudan University, 220 Handan Road, Shanghai 200433, China
* To whom correspondence should be addressed. Tel: +86 21 50801325; Fax: +86 21 50800402; Email: hanzg{at}chgc.sh.cn
| Abstract |
|---|
|
|
|---|
Dysregulation of a genomic imprinting gene can contribute to carcinogenesis. Here, delta-like 1 homolog (Drosophila) (DLK1), a paternally expressed gene, was found to be significantly up-regulated in 60 (73.2%) of a total of 82 hepatocellular carcinoma (HCC) specimens using reverse transcriptionpolymerase chain reaction. In addition, immunohistochemistry staining was performed in another 88 HCC specimens, of which 50 (56.8%) cancerous tissues were considered as positive. The expression of DLK1 was obviously induced in HCC cells, Bel-7402 and MHCC-H, by a demethylation agent, 5-aza-2'-deoxycytidine. Furthermore, both demethylation of the DLK1 promoter (565 to 362) and hypermethylation of the imprinting control domain in the region upstream of maternally expressed gene 3 were identified in a few HCC specimens. This implies that deregulation of genomic DNA methylation of the imprinted domain could be attributed to the up-regulation of DLK1 in HCC, although the undoubtedly complex mechanisms involved in the epigenetic event should be further investigated in HCC. Surprisingly, the expression of DLK1 in HCC was confirmed to be monoallelic specific, not biallelic, in three HCC specimens with a single nucleotide polymorphism as at T852C (rs2295660). Importantly, the exogenous DLK1 can significantly promote the cell proliferation of SMMC-7721 cells, a HCC cell line, whereas the suppression of endogenetic DLK1 through RNA interference can markedly inhibit cell growth, colony formation and tumorigenicity of HepG2, Hep3B and HuH-7 cells. These data suggest that DLK1 as an imprinted gene could be significantly up-regulated in HCC due to certain epigenetic events and contribute to the oncogenesis of this tumor.
Abbreviations: AFP, alpha-fetoprotein; DAC, 5-aza-2'-deoxycytidine; DIO3, deiodinase, iodothyronine, type III; DLK1, delta-like 1 homolog (Drosophila); HCC, hepatocellular carcinoma; ICR, imprinting control region; IGF2, insulin-like growth factor-2; LOI, loss of imprinting; MEG3, maternally expressed gene 3; miR, microRNA; mRNA, messenger RNA; PCR, polymerase chain reaction; RNAi, RNA interference; RT, reverse transcription; RTL1, retrotransposon-like 1; shRNA, short hairpin RNA; siRNA, small interference RNA; SNP, single nucleotide polymorphism; TSA, trichostatin A
| Introduction |
|---|
|
|
|---|
Convincing evidence of deregulated expression or silencing of some genes, due to the epigenetic events, has been reported to be involved in cancer cells (1). Moreover, some genomic imprinting genes contribute to the oncogenesis. Among them, insulin-like growth factor-2 (IGF2) as both an autocrine and paracrine growth factor undergoes pathological biallelic expression in a wide variety of malignancies, including Wilms' tumor and adult cancers such as colorectal cancer, due to the loss of imprinting (LOI) (2). Among over 70 imprinted genes that have been identified in mammals, both IGF2H19 and the delta-like 1 homolog (Drosophila) (DLK1)maternally expressed gene 3 (MEG3) imprinted domains are found to share common features, where DLK1 and MEG3 were reciprocally expressed and differentially methylated in the imprinted regions through a similar manner found in the IGF2H19 domain (3).
DLK1, also named as pre-adipocyte factor 1, fetal antigen-1 or pG2, is reported to inhibit adipocyte differentiation (4). In normal tissues, the expression of DLK1 is restricted to placenta embryonic tissues, a few adult endocrine glands and a subset of neurons (5,6). Also, DLK1 is strongly expressed in mouse fetal liver until the E18.5 stage, but not in the adult liver, implying that DLK1 is involved in liver development (7). DLK1 is also expressed in several tumors including skin neurofibromas (8), Wilms' tumor with myogenic differentiation (9) and a subset of myelodysplastic syndrome cases with rich blasts (10). Interestingly, it is also found that the overexpression of DLK1 can lead to the inhibition of hematopoietic cell differentiation and proliferation (11). Recently, Yin et al. (12) indicated that the overexpression of DLK1 in glioblastoma multiforme cell lines can enhance the transformed phenotype. In the present work, we found that DLK1, the paternally expressed gene, was significantly up-regulated in hepatocellular carcinoma (HCC) due to certain epigenetic events, and could be involved in the oncogenesis of this tumor.
| Materials and methods |
|---|
|
|
|---|
Patients, specimens and cell lines
All HCC specimens were obtained from patients who underwent surgical resection. Two healthy adult human livers were obtained from those patients with hemangioma, where the unaffected liver tissues were resected surgically during removal of the hemangioma. Moreover, two fetal human livers tissues were obtained from 3-month aborted fetus. Informed consent was obtained from all participants or parents for all the specimens investigated here. The project and protocol for the investigation involving humans and animals were approved by the ethics committee of the Chinese National Human Genome Center at Shanghai. All samples were immediately frozen at 80°C. Both cancerous and adjacent non-cancerous tissues were examined for pathogenic changes. All HCC samples displayed differentiation grades II and III according to the Edmondson grading system. Fifteen HCC cell lines (HepG2, Hep3B, HuH-7, Bel-7402, Bel-7404, Bel-7405, PLC, MHCC-H, MHCC-L, QGY-7703, YY-8103, QGY-7701, SK-HEP, SMMC-7721 and Focus) and the fetal liver-derived cell line L02 were employed in this study, where MHCC-H and MHCC-L cells were kindly provided by the Cancer Institute affiliated to Zhongshan Hospital, Fudan University. All mouse samples, including prenatal and post-natal livers, were kindly provided by Shanghai Slac Laboratory Animal CO. Ltd (Shanghai, China).
Genomic DNA and RNA
Genomic DNA and total RNAs were obtained using the Qiagen's DNA Extraction Kit (Qiagen, Valencia, CA) and the TRIZOL Reagent (Invitrogen, Carlsbad, CA), respectively. Isolation of poly+(A) RNA from total RNA was accomplished by oligo (dT) chromatography (Qiagen). Nucleic acid concentration and purity were assessed at 260 nm using a spectrophotometer (DU 530, Beckman-Coulter, Fullerton, CA).
Reverse transcriptionPCR and real-time PCR
Reverse transcription (RT) was performed in 20 µl reactions using 2 µg total RNA. Each polymerase chain reaction (PCR) was generally performed in 35 thermal cycles and then the PCR products were observed by electrophoresis on 2% agarose gel, where ß-actin was employed as loading control. Moreover, to evaluate the effect of RNA interference (RNAi) on DLK1, the relative messenger RNA (mRNA) level of DLK1 was measured by a quantitative real-time RTPCR using the ABI Prism 7700 Sequence Detection System and TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster, CA) according to the manufacturer's recommendation. The relative mRNA level of DLK1 was calculated through the comparative cycle threshold method and then normalized by ß-actin as internal control in each sample. DLK1 primers (forward: 5'-GTACTCGGGAAAGGACTGCC-3', reverse: 5'-CTCGCAGAAATTGCCTGAGA-3' and probe: 5'-FAM-AGGCACCCGTGGATGATGAG-TAMRA-3') were used in this study. To estimate the genomic copy number of DLK1, real-time PCR on the genomic DNA from HCC specimens was likewise carried out in triplicate using the primers (forward: 5'-CCTGAGGCCGTTTACTATGT-3', reverse: 5'-CTGCAGAATTGCCTGAGA-3' and probe: 5'-FAM-AGGACTGCGTGGATGATGAG-TAMRA-3') as described (13). To evaluate the expression of MEG3, retrotransposon-like 1 (RTL1) and deiodinase, iodothyronine, type III (DIO3), total RNA from 10 pairs of HCC and non-HCC specimens with DLK1 expression and 15 HCC cell lines and L02 cell line, two normal livers and two fetal livers were used as templates in RT reactions and then amplified by PCR with primers specific for MEG3, RTL1 and DIO3. The specific primers of MEG3, RTL1 and DIO3 were as follows: MEG3 (forward: 5'-CACTGCTTCCTGACTCGCTCTA-3', reverse: 5'-TGTGCTTTGGAACCGCAT-3'), RTL1 (forward: 5'-AAGGGGTGAAACTGAACAAGAA-3', reverse: 5'-TACTCAACCTCGATA GGGGAGA-3') and DIO3 (forward: 5'-AGCGCCTCAAACCAAGTCA-3', reverse: 5'-ATCCACGACATCACTTCCCCT-3').
Northern blot analysis
Total RNAs (20 µg) from HCC specimens, adjacent non-HCC livers and HCC cell lines were separated by electrophoresis in a 1.0% denatured formaldehyde agarose gel and transferred onto HybondTM-N+ nylon (Amersham Pharmacia Biotech, Ltd, Buckinghamshire, UK). The northern blots were hybridized with DLK1 labeled with [
-32P]deoxycytidine triphosphate using Random Primer DNA Labeling Kit (TaKaRa, Dalian, China) after which the hybridization signals were visualized using a Molecular Dynamics SI phoshorimager. For microRNA (miR) (miR-127, miR-134, miR-136 and miR-154), 20 µg of total RNA was separated by a 15% denaturing polyacrylamide gel and then transferred onto Hybond-N+ nylon membrane by semi-dry transfer (Amersham Pharmacia Biotech, Ltd). The chemically synthesized probes were labeled with [
-32P]adenosine triphosphate by T4 Polynucleotide Kinase (New England Biolabs, Beverly, MA). The nylon membrane was hybridized in QuikHyb Solution (Stratagene, La Jolla, CA) containing 106 c.p.m./ml of probe for 1 h and the hybridization patterns were visualized by phoshorimager, as above.
Western blot analysis
Total proteins from cultured cell lines were subjected to electrophoresis by 10% sodium dodecyl sulfatepolyacrylamide gel electrophoresis and then transferred onto Hybrid-P polyvinylidene difluoride membrane (Amersham Pharmacia Biotech Ltd., Buckinghamshire, UK). After blocking in phosphate-buffered saline containing 5% bovine serum albumin, the membrane was incubated in anti-DLK1 antibody at a dilution of 1:200 at room temperature for 1 h, and then with goat anti-rabbit antibody (1:2000) for 1 h. Signals were detected using the ECL PLUS® System from Amersham Pharmacia Biotech (Piscataway, NJ) and X-ray film.
Immunohistochemistry and immunofluorescence assay
Four micrometer thick sections were deparaffinized and dehydrated, and then treated with methanol containing 0.3% H2O2 to inhibit endogenous peroxidase. The slides were incubated with rabbit anti-DLK1 polyclonal antibody (1:100 dilution, homemade) or anti-alpha-fetoprotein (AFP) monoclonal antibodies (1:100 dilution, Santa Cruz Biotechnology, Santa Cruz, CA) at 37°C for 2 h, and then at 4°C overnight, followed by incubation with a horseradish peroxidase-conjugated anti-rabbit antibody (Dako Japan Ltd, Kyoto, Japan) at 37°C for 1 h. The signals were detected using Diaminobenzidine Substrate Kit (Vector Laboratories, Burlingame, CA). Counterstaining was performed with hematoxylin. Those samples incubated with phosphate-buffered saline buffer instead of the primary rabbit antibody were used as negative controls, whereas HCC specimens, where DLK1 was known to be strongly positive, were used as positive controls in every experiment. In addition, the slides with HCC specimens and the corresponding adjacent non-HCC livers were simultaneously used in the immunohistochemistry staining, and then were assessed by visual inspection and the estimation of the percentage of immunopositive cells. The HCC specimens with <10% immunopositive cells were considered as negative. Immunofluorescence assay was performed to detect endogenetic DLK1 in HepG2, Hep3B and HuH-7 cells. These cells were plated on polylysine-treated slides and then incubated at 37°C for 60 h. The fixed cells were blocked with phosphate-buffered saline buffer containing 5% bovine serum albumin and then stained with goat anti-DLK1 antibody (C-19, SC8624, Santa Cruz Biotechnology) against the intracellular domain of DLK1 at 4°C overnight, followed by incubation with fluorescein isothiocyanate-conjugated anti-mouse IgG antibody (Gibco BRL, Grand Island, NY) at 4°C for 2 h. After rinsing, the slides were analyzed using immunofluorescence microscopy. To evaluate the specificity of the rabbit anti-DLK1 polyclonal antibody, an immunoblot assay was performed to analyze the expression of exogenous DLK1 by transient transfection with pcDNA3.0-DLK1 of SMMC-7721 without endogenous DLK1 expression, whereas parental SMMC-7721 cells transfected with an empty vector were used as control. Total proteins (30 µg per sample) were separated by 10% sodium dodecyl sulfatepolyacrylamide gel electrophoresis and then transferred to nitrocellulose membrane. Western blotting assay was first performed using rabbit polyclonal anti-DLK1 antibody (or homemade) at 1:500 or 1:200, respectively, and secondary goat anti-rabbit IgGhorseradish peroxidase antibody (Sigma, St. Louis, MO) at 1:2000 dilution. After stripping, the membrane was probed with commercial antibody H-118 (Santa Cruz Biotechnology).
Analysis of allele-specific expression
To evaluate whether the expression of DLK1 was monoallelic or biallelic, DNA sequencing on PCR products by amplifying all genomic exons of DLK1 were first performed for the identification of single nucleotide polymorphisms (SNPs). Among 35 HCC specimens and all 15 HCC cell lines examined, heterozygous SNPs were found only in three HCC cases. Subsequently, the DLK1 transcript spanning the SNP site was amplified by RTPCR and then DNA sequenced, where the parallel PCR was carried out in the absence of RT to avoid DNA contamination.
Treatment of 5-aza-2'-deoxycytidine and trichostatin A
To identify whether the status of genomic DNA methylation can effect the up-regulation of DLK1, both 5-aza-2'-deoxycytidine (DAC) (200 nM) (Sigma), a demethylating agent, and trichostatin A (TSA) (300 nM) (Wako BioProducts, Richmond, VA), an inhibitor of histone deacetylases, were employed to treat the Bel-7402 and MHCC-H cells without endogenetic DLK1, respectively, as described previously (14).
Bisulfite-treated genomic DNA sequencing
Bisulfite-treated genomic DNA sequencing was performed as described (15) to evaluate the methylation status of CpG sites in the DLK1 promoter, including R1 (940 to 706), R2 (565 to 362), R3 (13 to +170) and R4 (1544 to 1329) of the imprinting control region (ICR) prior to MEG3 (Figure 5B) in six pairs of HCC, adjacent non-tumor livers and the HCC cell lines, Bel-7402 and MHCC-H. PCR products were subcloned into plasmid pMD19-T (TaKaRa). Eight to 12 clones were selected randomly for DNA sequencing. [Primer sequences for these regions (R14) are available from the corresponding author.]
|
Loss of heterozygosity analysis
Loss of heterozygosity analysis were performed here using DNA sequencing in 30 pairs of HCC and adjacent non-cancerous livers with the polymorphic microsatellite markers D14S1426 and D14S985 located close to the DLK1 locus, as described (15).
Small interference RNA and plasmid
Two small interference RNAs (siRNAs) against DLK1 were designed and chemically synthesized (Shanghai GenePharma Co., Shanghai, China) for targeting different coding regions of the gene as follows: siRNADLK874 (5'-GGUCUCACCUGUGUCAAGAtt-3' and 3'-ttCCAGAGUGGACACAGUUCU-5') for nt 872894 of DLK1 and siRNADLK1011 (5'-GGUGUCCAUGAAAGAGCUCtt-3' and 3'-ttCCACGGAUACUUUCUCGAG-5') for nt 10091031 of DLK1. In addition, siRNAs against Photinus pyralis luciferase (nucleotides 153175, U47296
[GenBank]
) were also synthesized and used as controls. For the construction of RNAi plasmid, the oligonucleotides for the double-strand short hairpin RNA (shRNA) were inserted into the expression plasmid pSUPER containing the polymerase-III H1-RNA gene promoter (16); pSUPER was kindly provided by Dr Agami, The Netherlands Cancer Institute. The oligonucleotides for shRNA were synthesized as follows: GATCCCCGGTCTCACCTGTGTCAAGATTCAAGAGATCTTGACACAGGTGAGACCTTTTTGGAAA for pSUPER DLK874, GATCCCCGGTGTCCATGAAAGAGCTCTTCAAGAGAGAGCTCTTTCATAGGCACCTTTTTGGAAA for pSUPER DLK1011 and GATCCCCCTTACGCTGAGTACTTCGATTCAAGAGATCGAAGTACTCAGCGTAAGTTTTTGGAAA for luciferase as control (17). To observe the effect of DLK1 on cell proliferation, the entire open reading frame of human DLK1 was subcloned into the mammalian cell expression vectors pcDNA3.0 and pcDNA3.1-cMyc-his (Invitrogen).
Cell proliferation, colony formation assay and stable knockdown of endogenous DLK1
To observe the effect of DLK1 on cell proliferation, SMMC-7721 cells were transfected with recombinant plasmids pcDNA3.0 and pcDNA3.1 containing DLK1 using LipofectamineTM 2000 Transfection Reagent (Invitrogen). The number of viable cells was determined by using the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfonyl)-2H-tetrazolium assay (CellTiter 96AQueous One Solution Cell Proliferation Assay; Promega Corp., Madison, WI) according to the instructions of the manufacturer. To evaluate colony formation, Hep3B, HepG2, HuH-7 and Bel-7402 cells in 100 mm dishes were transfected with pSUPERs containing shRNAs targeting DLK1 or luciferase as control, along with the pcDNA3.0 (10:1) in Lipofectamine 2000 (Invitrogen) or jetPEI for 24 h, respectively, and were subsequently selected on G418 (0.61.0 mg/ml) (Invitrogen) for 34 weeks. Subsequently, the cells were fixed and stained, and the colonies were counted. To establish the stably transfected subclones with a DLK1 knockdown phenotype, HuH-7 cells were transfected with the shRNA against DLK1, as above, and cultured and selected on G418. An immunoblot assay was employed to evaluate the expression of DLK1 in individual clones, where p874-C2 and p1011-A4 subclones with the knockdown of endogenous DLK1 were randomly selected from seven subclones of the pools, while subclone p1011-B3 was used as a reference control in which DLK1 expression was not knocked down. In addition, the subclone pSUPER C5 with empty vector was used as control in this study. To investigate cell proliferation of the HuH-7 subclones with knockdown of endogenous DLK1, HuH-7 cells were seeded in 96-well plates at 5 x 103 cells per well and cultured for 7 days. Cell viability was measured using Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). All experiments for observing cell proliferation analysis and colony formation were independently repeated at least three times.
Tumorigenicity in nude mice
Female athymic BLAB/cA nude mice, 56 weeks of age, were obtained from SIPPR-BK Experimental Animal Co. (Shanghai, China) and housed in a pathogen-free facility. A total of 2x106 offspring HuH-7 cells with stable knockdown of DLK1 were injected subcutaneously into the right flank of the nude mice, with eight mice in each treatment group. Tumor growth was monitored daily for at least 4 weeks.
| Results |
|---|
|
|
|---|
DLK1 was frequently up-regulated in HCC
DLK1 was found to be significantly up-regulated in 60 (73.2%) of 82 HCC specimens, whereas the transcript of the gene was rarely detected in adjacent non-cancerous livers, using a semi-quantitative RTPCR assay (Figure 1A for the representative results from 40 pairs of HCC samples). To confirm the up-regulation of the gene, DLK1 was also evaluated in these 40 pairs of HCC and non-HCC livers through real-time PCR. The resulting data showed that mRNA levels encoding DLK1 were obviously increased in HCC as compared with adjacent non-cancerous livers (Figure 1B). The up-regulation of DLK1 was confirmed in four of five pairs of HCC specimens by northern hybridization (Figure 1C). DLK1 transcripts were detected in fetal human livers, but not in adult livers, using RTPCR (Figure 1D) and by northern blot analysis (Figure 1E), which was similar to the expression pattern of the gene in mouse liver development (7). In addition, DLK1 was also strongly expressed in several HCC cell lines including HepG2, Hep3B and HuH-7 cells (Figure 1E), where the expression of the gene in these HCC cell lines was confirmed by immunofluorescence assay (Figure 2A). Together, these findings indicated that the up-regulation of DLK1 could be an important event in the oncogenesis of HCC.
|
|
DLK1 and AFP were complementary
To further evaluate the significance of DLK1 in clinical HCC samples, immunohistochemical staining was performed on an additional 88 HCC specimens and 10 non-HCC tumors, including seven cholangiocarcinoma, one liver sarcoma and two metastasic tumors. At the outset, we evaluated the specificity of the rabbit anti-DLK1 polyclonal antibody used in this study by immunoblot investigation of the expression of exogenous DLK1 in SMMC-7721 cells. The western blotting revealed that a specific band was detectable with our in-house polyclonal antibody after plasmid pcDNA3.0-DLK1 was transiently transfected into SMMC-7721 cells without endogenous DLK1 expression, and that the same band also was specifically recognized by the commercial antibody H-118 (Figure 2B), indicating that this polyclonal antibody would be appropriate for the immunohistochemistry study of the HCC specimens. Immunohistochemical staining intensity was scored on a scale of 1+ to 3+. According to the criteria, in which specimens with >10% immunopositive cells were scored as positive, DLK1 was found to be significantly up-regulated in 50 (56.8%) of 88 HCC specimens as compared with adjacent non-cancerous livers, and where DLK1 was not expressed in non-HCC tumors. The resulting data showed that 20 (40%), 9 (18%) and 21 (42%) of the 50 HCC specimens were marked as staining intensity of 1+, 2+ and 3+, respectively. DLK1 was mostly anchored on cell membrane or extracellular matrix (Figure 2C), in conformity with what was seen in Hep3B, HuH-7 and HepG2 cells (Figure 2A).
Overexpression of DLK1 did not appear to be correlated with the gender, hepatitis B virus infection or tumor size (P > 0.05) (Table I). Significantly, the expression of DLK1 and AFP, a well-characterized marker for HCC diagnosis, did not completely overlap in the 88 HCC specimens examined by the immunohistochemistry assay. DLK1 and AFP were simultaneously expressed in 28 (31.8%) of 88 only HCC specimens. Moreover, DLK1 was not significantly expressed in 33 (37.5%) of 88 cases with the overexpression of AFP (Figure 2D). Surprisingly, overexpression of DLK1, but not AFP, was evident in 25% (22 of 88) of HCC specimens, pointing to the potential of DLK1 as a novel biomarker for HCC pathologenesis.
|
Expression pattern of other genes on DLK1MEG3 imprinted domain
Among the genomic imprinting genes, LOI of IGF2 or activation of the maternally inherited allele was recently considered to be one mechanism that affects cancer risk through the altered maturation of non-neoplastic tissue, such as intestine (18). It is known that DLK1 is expressed exclusively from the paternal allele in both embryo and placenta, whereas the reciprocally expressed MEG3, a non-protein-encoding gene, is expressed from the maternal allele on human chromosome 14q32 (19). DLK1MEG3 locus shares many of the imprinting properties of the well-characterized IGF2H19 domain, and it has been proposed that both imprinted domains may be regulated in the same way (20). In addition to DLK1 and MEG3, the paternally expressed genes DIO3 and RTL1 and some maternally expressed miRs were also localized within the DLK1MEG3 imprinted domain (Figure 3A). To explore whether other genes in the imprinted domain were also dysregulated in hepatocarcinogenesis, RTPCR was employed to assess the transcription of these genes in 10 pairs of HCC specimens with DLK1 expression, several HCC cell lines and adult and fetal livers. The RTPCRs suggested that MEG3 and DLK1 were not simultaneously dysregulated in these HCC specimens and cell lines (Figure 3B and C); further, the expression of MEG3 and RTL1 did not exhibit a significantly different display among these paired samples, adult and fetal livers (Figure 3C). However, DIO3, which was expressed in fetal liver but not in adult liver (Figure 3C), was also dysregulated in three (30%) of these 10 pairs of HCC and non-HCC samples, with the up-regulation of one (10%) HCC specimen and the down-regulation of two (20%) samples (Figure 3B). In addition, northern hybridization assay employed to investigate miR-127, -134, -136, and -154 in HCC specimens with the overexpression of DLK1 did not detect significant differential transcription of these genes among the various samples. The results suggest that the dysregulation of the paternally, but not maternally, expressed genes within the imprinted domain could be important events in hepatocarcinogenesis.
|
Monoallelic expression of DLK1 in HCC
To investigate whether the LOI of DLK1 occurred in HCC, genomic DNA sequencing for all six exons of the gene was first performed to identify the genetic polymorphisms in 35 HCC specimens and all available HCC cell lines. Herein, only one known SNP at T852C of DLK1 (rs2295660) was found in three of 35 specimens (Figure 4, left). No additional polymorphisms or somatic mutations were observed in these samples. Subsequently, DNA sequencing on RTPCR products from all three samples was performed (Figure 4, right). Interestingly, the resulting data revealed that the transcript of DLK1 was generated from a monoallele, not both alleles, through comparing with the genomic DNA sequences, implying that the dysregulation of DLK1 in hepatocarcinogenesis could not be ascribable to an LOI mechanism.
|
DNA methylation status on the regulatory elements of DLK1
To address whether genetic alteration could contribute to the dysregulation of DLK1, genomic imbalance of the DLK1 locus was evaluated in 30 pairs of HCC specimens with or without DLK1 expression, using the microsatellite markers D14S1426 and D14S985 that are proximal to the DLK1 locus (15). However, no genomic imbalance or loss of heterozygosity was identified (data not shown), which indicates that genetic events are not critical for up-regulation of DLK1.
To investigate whether epigenetic events could be associated with the dysregulation of DLK1, both the demethylation agent DAC and the histone deacetylase inhibitor TSA were employed to treat Bel-7402 and MHCC-H cells, which normally do not express DLK1. DLK1 was significantly activated by DAC, not by TSA (Figure 5A), suggesting that the genomic DNA hypomethylation contributes to the up-regulation of DLK1. To further assess whether the up-regulation of DLK1 in HCC may be associated with methylation level of the CpG islands in the DLK1 promoter (R1R3 regions) and ICR (R4 region) prior to MEG3 in clinical HCC samples, bisulfite-treated genomic DNA sequencing was employed to characterize the methylation status of these regions in six pairs of HCC specimens displaying the up-regulated DLK1 phenotype (Figure 5B). The sequencing revealed that the methylation levels of the DLK1 promoter (R2) was significantly reduced in two (33.3%), C250 and C208, of the six HCC specimens (P < 0.01 for C250, P < 0.05 for C208) as compared with non-cancerous livers (Figure 5C), whereas the methylation status of ICR (R4) was significantly increased in two (33.3%), C250 and C262, of the six HCC samples (P < 0.01 for both cases) (Table II and Figure 5D). In accord with these results, the methylation level of the DLK1 promoter (R2) was significantly reduced in Bel-7402 and MHCC-H cells (P < 0.05), along with the reactivation of DLK1, after DAC treatment (Table II and Figure 5E). However, it should be pointed out that the methylation level of R1 and R3 regions of DLK1 promoter was not significantly different between the paired HCC and adjacent non-cancerous livers. Together, these findings suggested that hypomethylation of DLK1 promoter and/or hypermethylation of ICR partially contribute to the up-regulation of DLK1 in some HCC specimens, but also they caution that the fundamental mechanisms of hepatocarcinogenesis require continued investigation.
|
The effect of DLK1 on cell proliferation and tumorigenicity of HCC
To reveal whether the dysregulated DLK1 could contribute to hepatocarcinogenesis, SMMC-7721 cells (which do not express DLK1) were transfected with pcDNA encoding DLK1 (Figure 6A). Exogenous DLK1 promoted significant cell proliferation of the HCC cells (P < 0.05, one-way analysis of variance) (Figure 6B). Furthermore, both shRNAs (pSUPER DLK874 and pSUPER DLK1011) were designed to interfere with endogenetic DLK1 in HepG2, Hep3B and HuH-7 cells, where the relative mRNA levels of the gene were indeed significantly reduced by the shRNA-mediated RNAi (Figure 6C). Surprisingly, the shRNAs can obviously inhibit the colony formation of HepG2, Hep3B and HuH-7 cells (Figure 6D), but not in Bel-7402 without expression of DLK1, when compared with that of the shRNA against luciferase and empty pSUPER used as controls. The data suggested that the up-regulation of DLK1 could contribute to the hepatocarcinogenesis.
|
To further evaluate the hypothesis, stable subclones of HuH-7 cells carrying knockdown of endogenous DLK1 were then screened out after those plasmids containing shRNAs were transfected into the cells. The resulting data showed that DLK1 was markedly deceased in both the subclones p874-C2 and p1011-A4, but not in the subclone p1011-B3 as a mock and pSUPER C5 with empty vector (Figure 6E). Interestingly, the cell growth of both p874-C2 and p1011-A4 with the knockdown of endogenous DLK1 was significantly suppressed, as compared with that of pSUPER C5 as control and p1011-B3 as a mock (P < 0.05, one-way analysis of variance) (Figure 6F). Subsequently, the cells of these stable subclones were injected subcutaneously into athymic mice to assess their tumorigenicity. Unexpectedly, the tumorigenicity of both p874-C2 and p1011-A4 cells was weak, where p874-C2 cells formed the detectable tumors only in two of eight mice, and transfer of p1011-A4 cells induced no tumors in any of the eight mice within 6 weeks. In contrast, both pSUPER C5 and p1011-B3 exhibited strong tumorigenicity in all eight mice (Figure 6G). These data suggested that the up-regulation of DLK1 could indeed contribute to hepatocarcinogenesis, and serve as a potential therapeutic target for HCC.
| Discussion |
|---|
|
|
|---|
Genomic imprinting is a parent-of-origin gene-silencing mechanism thought to be important in growth regulation. In contrast to most genes, the expression of genomic imprinting genes is subject to monoallelism and based on the sex of the transmitting parent. Imprinted genes are normally involved in embryonic growth and behavioral development, but occasionally they also inappropriately function as oncogenes and tumor suppressor genes. Expression of DLK1 is known to be restricted to placenta embryonic tissues, several adult endocrine glands (5,6) and a subset of neurons (7). DLK1 is strongly expressed in mouse fetal liver until the E16.5 stage, but not expressed in adult liver (21), implying that the DLK1 is involved in liver development. In contrast, DLK1 was clearly expressed in regenerating rat liver in the acetylaminofluorene or hepatectomy (AAF/PHx) model, where DLK1 was localized in the atypical ductal structures composed of oval cells that share some phenotypic characteristics with bipotential fetal hepatoblasts (18). Here, DLK1 was found to be frequently overexpressed in human HCC specimens, a common cancer worldwide, implying that HCC could originate from primitive hepatoblasts or even hepatic stem cells.
LOI of IGF2 or activation of the normally silent maternally inherited allele is considered an important mechanism affecting cancer risk, e.g. in colon cancer (19,22,23). Both DLK1MEG3 and IGF2H19 imprinted domains share many of the conserved genomic imprinting properties related to genetic and epigenetic regulation (24). In this study, no significantly genetic aberrations, including amplification and mutations of DLK1 locus, could be suspected to be involved in the up-regulation of the paternally expressed gene in HCC specimens. However, unlike the IGF2H19 imprinted domain, the dysregulation of DLK1 expression does not appear to be ascribable to LOI; the expression pattern of DLK1 is similar to that in Wilms' tumor (9). Although the monoallelic, not biallelic, expression of DLK1 was found here only in few patients with an SNP site, this suggests that LOI of the normally silent maternally inherited allele, such as IGF2H19 at chromosome 11p15.5, could not be a common epigenetic disruption in hepatocarcinogenesis. Indeed our data supported the notion that the demethylation of paternally allelic CpG islands around the transcription site of DLK1 and/or the hypermethylation of ICR could partially contribute to the up-regulation of the DLK1 gene. Whether the transcriptional expression of DLK1 in HCC originated from the paternal allele warrants further investigation involving additional HCC specimens, in combination with the cognate parental DNA samples.
DLK1/pre-adipocyte factor 1-null mice display growth retardation, obesity, blepharophimosis, skeletal malformation and increased serum lipid metabolites (25), whereas exogenous DLK1 can inhibit adipocyte differentiation in vitro (4). Moreover, transgenic mice with the full ectodomain of DLK1/pre-adipocyte factor 1 exclusively expressed in liver under the control of the albumin promoter also show a decrease in adipose mass and the expression of adipocyte markers (26). Unlike that in pre-adipocytes, the extracellular domain of DLK1 was not required for the inhibition of hematopoietic cell differentiation (11). In addition to the physiological activity, DLK1 was recently found to be dysregulated in some tumors. Kawakami et al. (15) reported that DLK1 was significantly down-regulated in human renal cell carcinoma and could inhibit the cell growth of renal cell carcinoma cells as a candidate tumor suppressor gene. In contrast, the overexpression of DLK1 promoted cell proliferation of glioblastoma multiforme cell lines (12). Our current findings supported the view that DLK1 may be oncogenic in HCC. The data were conflicting but challenging, and depended on tumor type, but they are worthy of further investigation to enhance our understanding of oncogenesis. As established previously, DLK1 is involved in the Notch signaling pathway as a negative regulator (27) and in extracellular-regulated kinase/mitogen-activated protein kinase signaling in the cell differentiation (26). Notch signaling plays a critical role in maintaining the balance among cell proliferation, differentiation and apoptosis. Interestingly, the effect, inhibition or promotion, of Notch signaling on cell proliferation is dependent on the environmental niche. Notch1 signaling can inhibit the cell growth of human HCC cells (SMMC-7721) through the induction of cell cycle arrest and apoptosis (28). Nonetheless, other studies have identified the requirement for Notch signaling during kidney organogenesis and tissue repair (29). Presumably, as a negative regulator of Notch signaling, the up-regulation of DLK1 could promote the cell proliferation of HCC cells (SMMC-7721) via the inhibition of Notch1 signaling, whereas the down-regulation of DLK1 could contribute to the oncogenesis of renal cell carcinoma, as in kidney organogenesis, through the reactivation of Notch1 signaling.
Our data suggested that the up-regulation of DLK1 plays a crucial role in maintenance of cancerous stem or progenitor cells with malignant characteristics, because the colony formation, cell growth and tumorigenicity of HCC cell lines were significantly decreased as the knockdown of endogenetic DLK1. The up-regulation of DLK1 in HCC is worthy of consideration as a potential therapeutic target for this tumor, perhaps through treatment with antibodies against the secreted ectodomain of the protein or chemicals targeting signaling pathways activated by DLK1.
| Footnotes |
|---|
These authors contributed equally to this work. | Acknowledgments |
|---|
We gratefully acknowledge support from the National Natural Science Foundation for Outstanding Youth (30425019), Chinese High-Tech Research and Development Program (863), Chinese National Key Program on Basic Research (973, 2004CB518605), National Foundation for Excellence Doctoral Project and Shanghai Commission for Science and Technology (04XD14014, 03DZ14024 and 06ZR14069). We also thank Professor Paul J. Brindley at Tulane University Health Sciences Center for the revision of this paper.
Conflict of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Feinberg AP, et al. (2004) The history of cancer epigenetics. Nat. Rev. Cancer 4:143153.[Web of Science][Medline]
- Rainier S, et al. (1993) Relaxation of imprinted genes in human cancer. Nature 362:747749.[CrossRef][Medline]
- Schmidt JV, et al. (2000) The Dlk1 and Gtl2 genes are linked and reciprocally imprinted. Genes Dev. 14:19972002.
[Abstract/Free Full Text] - Smas CM, et al. (1993) Pref-1, a protein containing EGF-like repeats, inhibits adipocyte differentiation. Cell 73:725734.[CrossRef][Web of Science][Medline]
- Larsen JB, et al. (1996) Fetal antigen 1 and growth hormone in pituitary somatotroph cells. Lancet 347:191.[Web of Science][Medline]
- Jensen CH, et al. (2001) Neurons in the monoaminergic nuclei of the rat and human central nervous system express FA1/dlk. Neuroreport 12:39593963.[CrossRef][Web of Science][Medline]
- Tanimizu N, et al. (2003) Isolation of hepatoblasts based on the expression of Dlk/Pref-1. J. Cell Sci. 116:17751786.
[Abstract/Free Full Text] - Van Limpt VA, et al. (2003) High delta-like 1 expression in a subset of neuroblastoma cell lines corresponds to a differentiated chromaffin cell type. Int. J. Cancer 105:6169.[CrossRef][Web of Science][Medline]
- Fukuzawa R, et al. (2005) Imprinting, expression, and localisation of DLK1 in Wilms tumours. J. Clin. Pathol. 58:145150.
[Abstract/Free Full Text] - Langer F, et al. (2004) Overexpression of delta-like (Dlk) in a subset of myelodysplastic syndrome bone marrow trephines. Leuk. Res. 28:10811083.[CrossRef][Web of Science][Medline]
- Li L, et al. (2005) Expression of DLK1 in hematopoietic cells results in inhibition of differentiation and proliferation. Oncogene 24:44724476.[CrossRef][Web of Science][Medline]
- Yin D, et al. (2006) DLK1: increased expression in gliomas and associated with oncogenic activities. Oncogene 25:18521861.[CrossRef][Web of Science][Medline]
- De Preter K, et al. (2002) Quantification of MYCN, DDX1, and NAG gene copy number in neuroblastoma using a real-time quantitative PCR assay. Mod. Pathol. 15:159166.[CrossRef][Web of Science]
- Cameron EE, et al. (1999) Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat. Genet. 21:103107.[CrossRef][Web of Science][Medline]
- Kawakami T, et al. (2006) Imprinted DLK1 is a putative tumor suppressor gene and inactivated by epimutation at the region upstream of GTL2 in human renal cell carcinoma. Hum. Mol. Genet. 15:821830.
[Abstract/Free Full Text] - Brummelkamp TR, et al. (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550553.
[Abstract/Free Full Text] - Lewis DL, et al. (2002) Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nat. Genet. 32:107108.[CrossRef][Web of Science][Medline]
- Sakatani T, et al. (2005) Loss of imprinting of Igf2 alters intestinal maturation and tumorigenesis in mice. Science 307:19761978.
[Abstract/Free Full Text] - Wylie AA, et al. (2000) Novel imprinted DLK1/GTL2 domain on human chromosome 14 contains motifs that mimic those implicated in IGF2/H19 regulation. Genome Res. 10:17111718.
[Abstract/Free Full Text] - Paulsen M, et al. (2001) Comparative sequence analysis of the imprinted Dlk1-Gtl2 locus in three mammalian species reveals highly conserved genomic elements and refines comparison with the Igf2-H19 region. Genome Res. 11:20852094.
[Abstract/Free Full Text] - Jensen CH, et al. (2004) Transit-amplifying ductular (oval) cells and their hepatocytic progeny are characterized by a novel and distinctive expression of delta-like protein/preadipocyte factor 1/fetal antigen 1. Am. J. Pathol. 164:13471359.
[Abstract/Free Full Text] - Cruz-Correa M, et al. (2004) Loss of imprinting of insulin growth factor II gene: a potential heritable biomarker for colon neoplasia predisposition. Gastroenterology 126:964970.[CrossRef][Web of Science]
- Cui H, et al. (2003) Loss of IGF2 imprinting: a potential marker of colorectal cancer risk. Science 299:17531755.
[Abstract/Free Full Text] - Moon YS, et al. (2003) Mice lacking paternally expressed Pref-1/Dlk1 display growth retardation and accelerated adiposity. Mol. Cell. Biol. 22:55855592.[CrossRef][Web of Science]
- Lee K, et al. (2003) Inhibition of adipogenesis and development of glucose intolerance by soluble preadipocyte factor-1 (Pref-1). J. Clin. Invest. 111:453461.[CrossRef][Web of Science][Medline]
- Ruiz-Hidalgo MJ, et al. (2002) dlk modulates mitogen-activated protein kinase signaling to allow or prevent differentiation. Exp. Cell Res. 274:178188.[CrossRef][Web of Science][Medline]
- Baladron V, et al. (2005) dlk acts as a negative regulator of Notch1 activation through interactions with specific EGF-like repeats. Exp. Cell Res. 303:343359.[CrossRef][Web of Science][Medline]
- Qi R, et al. (2003) Notch1 signaling inhibits growth of human hepatocellular carcinoma through induction of cell cycle arrest and apoptosis. Cancer Res. 63:83238329.
[Abstract/Free Full Text] - McCright B. (2003) Notch signaling in kidney development. Curr. Opin. Nephrol. Hypertens. 12:510.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. Yu, T. Zhu, Z. Wang, H. Zhang, Z. Qian, H. Xu, B. Gao, W. Wang, L. Gu, J. Meng, et al. A Novel Set of DNA Methylation Markers in Urine Sediments for Sensitive/Specific Detection of Bladder Cancer Clin. Cancer Res., December 15, 2007; 13(24): 7296 - 7304. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Ctvalue; the upper and lower edges of each box represent the 75th and 25th percentile, respectively; the upper and lower bars indicate the highest and lowest values determined, respectively. (C) Total RNA from five pairs of HCC (C) and their adjacent non-cancerous tissues (N) was further analyzed by northern hybridization. The 28S/18S RNAs were used as loading control. (D) Representative results of semi-quantitative RTPCR of DLK1 from two adult livers (NL1 and NL2) and two fetal livers (FL1 and FL2). (E) Expression of DLK1 in some HCC cell lines, healthy adult liver and fetal liver was evaluated by northern hybridization.




