Carcinogenesis Advance Access originally published online on November 24, 2006
Carcinogenesis 2007 28(5):932-939; doi:10.1093/carcin/bgl231
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Published by Oxford University Press 2006.
The pituitary tumor-transforming gene promotes angiogenesis in a mouse model of follicular thyroid cancer
Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, 37 Convent Drive, Room 5128, Bethesda, MD 20892-4264, USA
1 Department of Pathology, Wake Forest University, Winston-Salem, NC 27157-3001, USA
* To whom correspondence should be addressed. Tel: +301 496 4280; Fax: +301 402 8262; Email: chengs{at}mail.nih.gov
| Abstract |
|---|
|
|
|---|
Overexpression of the pituitary tumor-transforming gene (PTTG) has been associated with tumorigenesis. In a mouse model that spontaneously develops follicular thyroid cancer (FTC) with distant metastasis (TRßPV mouse), PTTG is overexpressed, similar to human thyroid cancer. To evaluate the role of PTTG in thyroid carcinogenesis, we studied the offspring of TRßPV mice with mice lacking PTTG (PTTG/ mice). The thyroids of TRßPV/PV PTTG/ mice were significantly smaller than TRßPV/PV mice. Ki-67 staining showed a decrease in thyroid proliferation in TRßPV/PV PTTG/ mice. Our evaluation of the RbE2F pathway, a central mediator of cell growth, found that TRßPV/PV PTTG/ mice exhibited a decrease in protein levels of phosphorylated Rb along with an elevation of the cdk inhibitor p21. Histological examination documented no difference in FTC occurrence between TRßPV/PV and TRßPV/PV PTTG/ mice, which indicates that PTTG removal does not prevent the initiation of FTC. However, TRßPV/PV PTTG/ mice had a significant decrease in vascular invasion and less development of lung metastasis as they progressively aged. CD31 staining also showed a decrease in vessel density in TRßPV/PV PTTG/ versus TRßPV/PV thyroids. Given the decreased vascular invasion in the PTTG knockout mice, we studied genes involved in angiogenesis. Real-time reverse transcriptionpolymerase chain reaction showed a consistent decrease in pro-angiogenic factors, fibroblast growth factor (FGF2), its receptor FGFR1 and vascular endothelial growth factor. Our results highlight the dual roles of PTTG as a regulator of thyroid growth and contributor to tumor progression. The separation of the pathways regulating cell proliferation, tumor initiation and tumor progression should direct future therapeutic options.
Abbreviations: FGF, fibroblast growth factor; FTC, follicular thyroid cancer; PTTG, pituitary tumor-transforming gene; PBS, phosphate-buffered saline; RTH, resistance to thyroid hormone; TSH, thyroid-stimulating hormone; VEGF, vascular endothelial growth factor
| Introduction |
|---|
|
|
|---|
The pituitary tumor-transforming gene (PTTG) is a human securin protein and has a central role in maintaining sister chromatid cohesiveness during mitosis. The transition from metaphase to anaphase in mitosis is characterized by sister chromatid separation. The protein cohesin binds to the sister chromatids to prevent premature separation in metaphase. During anaphase, the protein separase degrades cohesin, which facilitates the progression from metaphase to anaphase. PTTG binds to separase to inhibit its function. Degradation of PTTG by the anaphase-promoting complex leads to an active separase and ultimately to the separation of sister chromatids. Alteration of normal levels of PTTG may disrupt this orderly process of chromatid segregation with subsequent aneuploidy in the daughter cells (1). PTTG's known role in maintenance of chromosomal stability along with its roles as a transcription factor and in DNA repair suggest that it could also contribute to tumorigenesis. One group found that PTTG expression was 1 of 17 genes that could be used to profile the metastatic potential of solid primary tumors (2).
PTTG was first isolated from a rat pituitary tumor cell line (3) and its overexpression has been described in a variety of human tumors, including pituitary, thyroid, lung and colon cancer (46). Moreover, PTTG overexpression is able to transform NIH-3T3 cells to form tumors in nude mice (3). Some of PTTG's oncogenic properties are via induction of angiogenic genes fibroblast growth factor (FGF-2) and vascular endothelial growth factor (VEGF), respectively (4,7), along with its transcriptional properties on p53 (8,9). Other groups report that up-regulation of PTTG results in an increase of the oncogene ß-catenin (10). Although PTTG is considered an oncogene, there was also a report that overexpression of PTTG in the human cancer cell lines HeLa and A549 results in a decrease in cell growth along with up-regulation of the cdk inhibitor p21 (11). In addition, PTTG has been found by some to induce apoptosis through both p53-dependent and -independent pathways (12,13).
Elucidation of PTTG's role in tumorigenesis has been advanced through study of PTTG knockout mice. There exists at least three human isoforms of PTTG (PTTG 13) with various levels of abundance (14). PTTG1 is most often studied and associated with tumorigenesis. PTTG1 is normally found in testis and thymus, PTTG2 is considered to have a broader tissue distribution in organs such as the heart, pituitary and liver and PTTG3 is found in the kidneys and prostate (15). PTTG does not have significant homology to other classes of proteins, and given its role in mitosis, it was surprising to find that PTTG1 knockout mice (PTTG1/) are viable and fertile (15). PTTG1/ mice had smaller testes and spleens than wild-type mice, whereas mouse embryo fibroblasts from these mice had increased chromosomal instability with premature division of the centromeres (15). Both the under- and overexpression of PTTG may adversely affect chromosomal stability; however, PTTG1 alone is not necessary for maintenance of sister chromatid binding. Interestingly, when these knockout mice were crossed with the Rb+/ mouse that develops pituitary tumors, the Rb+/PTTG1/ mice had decreased incidence of pituitary tumor development compared with Rb+/ mice (16).
Further observations on these mice showed that deficiency of PTTG1 resulted in an increase of the cdk inhibitor p21 and that there was a reduction in cell proliferation. Donangelo et al. (17) have also recently studied transgenic mice that overexpress PTTG1 in the pituitary (
-GSU.PTTG) and found that these mice can develop pituitary microadenomas. In addition, crossing the
-GSU.PTTG mice with Rb+/ mice resulted in the double-mutant mice developing greater pituitary tumors than Rb+/ mice. These studies suggest that PTTG1 is a proto-oncogene in the pituitary and deletion of PTTG1 may delay or prevent tumor development.
PTTG has also been associated with thyroid cancer. Thyroid cancer is the most common endocrine malignancy and the two most common types are papillary and follicular thyroid cancer (FTC). Although derived from the same epithelial follicular cell, these two types of thyroid cancer are distinct from each other in appearance, biological behavior and genetic causes. However, both papillary and FTC have been found to have elevated levels of PTTG at the mRNA level (18). One mechanism for PTTG's role in thyroid tumorigenesis may be through promotion of genetic instability (5). In addition, microarray analysis comparing overexpression of PTTG in thyroid cell lines compared with the original line found that PTTG results in an increase in the angiogenic factors Id3 and a decrease in the anti-angiogenic marker TSP-1 (19).
Given the association of PTTG overexpression and thyroid cancer along with studies showing a reduction in tumor incidence when PTTG1 is ablated in mice, we focused on whether PTTG1 deletion would prevent thyroid tumorigenesis in a mouse model that develops thyroid cancer similar to human FTC (TRßPV mouse). Hereafter, the remainder of the paper will refer to PTTG1 as PTTG. The TRßPV mouse model expresses a dominant-negative mutation in the thyroid hormone receptor ß. Human mutations in TRß are known to cause the syndrome resistance to thyroid hormone (RTH) where there is decreased tissue responsiveness to thyroid hormone. Interestingly, homozygous TRßPV mice spontaneously develop FTC with progression from capsular and vascular invasion to distant metastasis and anaplastic transformation (20). The similarities in FTC progression between this model and humans provide unique opportunities to evaluate the changes required for metastasis. Previous microarray analysis comparing the thyroids of TRßPV/PV versus wild-type mice identified genes differentially expressed in the mutant mice and found that PTTG was overexpressed over 5-fold (21). This study examines the in vivo effects of PTTG deletion in TRßPV mice. We found that the TRßPV/PV PTTG/ mice still developed FTC at the same rate as TRßPV/PV mice; however, there was less aggressive disease as seen by a reduction in vascular invasion and enhanced survival rate. Histological examination showed a reduction in thyroid size when PTTG was ablated and immunohistochemistry revealed that there was less cell proliferation in the thyroids of TRßPV/PV PTTG/ mice. We found that an up-regulation of p21 in the thyroids of TRßPV/PV PTTG/ mice may also contribute to a reduction in thyroid size along with a decrease in invasion. There was also less neovascularization in TRßPV/PV mice lacking PTTG that may be attributed to a decrease in the angiogenic factors FGF2, FGFR1 and VEGF. Given that PTTG deletion did not prevent FTC development, PTTG may be considered a contributor to thyroid tumorigenesis and tumor progression versus an initiating factor.
| Materials and methods |
|---|
|
|
|---|
Mouse strains
All aspects regarding the care and handling of the animals used in this study were approved by the National Cancer Institute Animal Care and Use Committee. TRßPV mice were generated via homologous recombination, as described previously (22). Genotyping was performed using the primers and method as described previously (22). PTTG knockout mice were graciously provided by Dr Shlomo Melmed and the origin of these mice is described previously (15).
Quantitative reverse transcriptionpolymerase chain reaction
Total RNA was isolated from thyroid tissue as described previously using TRIzol (Invitrogen, Carlsbad, CA) as per manufacturer's instructions. The LightCycler RNA amplification kit SYBR Green I (Roche, Indianopolis, IN) was used as per manufacturer's instructions. Results were normalized to glyceraldehyde-3-phosphate dehydrogenase and analysis carried out as described previously (21). Primer sequences are as follows: FGF2F 170190: CACACGTCAAACTACAACTCC and R 390372: CCCAGTTCGTTTCAGTGCC; FGFR1F: GTAGCTCCCTACTGGACATCC and R: GAGGCTACAAGGTTCGCTATGC; VEGFF 909928: AGGCGAGGCAGCTTGAGTTA and R 12451224: CTTGGCGATTTAGCAGCAGAT.
Western blot
Immunoblotting was performed as described previously with adjustments as described below (23). Thyroid lysate was prepared from age- and gender-matched mice using a final concentration of 50 mM Tris, 100 mM NaCl, 0.1% Triton X-100 and protease inhibitors (1 mM phenylmethylsulphonylfluoride, 0.3 µM aprotinin and 0.4 mM leupeptin = Complete Mini tab). A total of 50 µg of protein was loaded for each sample. Experiments were repeated three times using different mice. Primary antibodies used included Rb (sc-50, Santa Cruz Biotechnology, Santa Cruz, CA) and p21 (sc-6246, Santa Cruz Biotechnology). Valosin-containing protein (p97) antibody was a generous gift from Dr Lawrence Samelson (National Cancer Institute, Bethesda, MD).
Secondary antibodies used included horseradish peroxidase-conjugated goat anti-mouse or anti-rabbit IgG (Amersham Biosciences, Piscataway, NJ) and visualized with the Western Lightning chemiluminescence reagent plus system (PerkinElmer Life Sciences, Boston, MA). The blots were stripped with Re-Blot Plus (Chemicon, Temacula, CA) and normalized to
-Tubulin (1:6000 dilution; SigmaAldrich, St. Louis, MO).
Immunohistochemistry
Ki-67 staining was done as described previously (24). Briefly, thyroids were dissected and fixed in 10% neutral buffered formalin, and then embedded in paraffin. For immunohistochemistry, after antigen retrieval using antigen unmasking solution (Vector Laboratories, Burlingame, CA) and incubation at 95°C for 20 min, 5 µm thick sections were blocked with 1% bovine serum albumin in phosphate-buffered saline (PBS) for 30 min followed by sequential incubations in rabbit anti-Ki-67 (NeoMarkers, Fremont, CA) or anti-CD31 (PharMingen/BD Biosciences). This was followed by indirect labeling with horseradish peroxidase-labeled goat anti-IgG (Jackson, ImmunoResearch, West Grove, PA) according to standard methods with counterstain using light green (Biomeda, Foster City, CA).
Flow cytometry analysis of thyroid tissue
Preparation of cells from frozen thyroid tissue for cell cycle analysis was adapted from a protocol described previously (25). Briefly, thyroids were dissected from mice and frozen in liquid nitrogen. About 30 mg of thyroid tissue was thawed on ice. Afterwards, the thyroid sample was placed in a 40 µm cell strainer on top of a 50 ml tube (BD Falcon, Bedford, MA) and gently pushed against the strainer in
0.5 ml of PBS. Afterwards, the strainer was rinsed with
4 ml of additional PBS. The suspension was counted using a cell counter (Beckman Coulter, Fullerton, CA). Afterwards, the sample was centrifuged at
400g and re-suspended to a concentration of 1 x 107 to 2 x 107 cell/ml in PBS. Approximately 1 x 106 cells were aliquoted into a 12 x 75 mm Falcon tube (BD Falcon) and incubated in an ice bath for 15 min. Cells were fixed with 70% ethanol and kept at 4°C overnight. The next day, cells were centrifuged and the ethanol was decanted. The samples were incubated for 20 min at room temperature with 100 U DNAse-inactivated RNAse (SigmaAldrich). Propidium iodide was added at a concentration of 40 µg/ml (Molecular Probes, Eugene, OR) and incubated at 4°C for 30 min. Cell cycle analysis was performed using a FACSCalibur system (BD Biosciences). Data from 10 000 to 20 000 single-cell events per sample were collected. Cell cycle histograms were analyzed using the ModFit LT program (Verity Software House, Topsham, ME). All samples had low coefficient variation of the G0/G1 peak (coefficient variation between 3 and 6%).
Primary cell culture
Primary thyroid cell lines were grown at 37°C, 5% CO2 atmosphere in primary cell media as described previously (23). Cells were then used for either western blot analysis or cell motility assay (see below).
Cell motility assay
As described previously with the following adaptation (23), cells were incubated at 37°C for 8 h. Experiments were performed in duplicate. Data expressed are from combined experiments. Fold of increase or decrease in motility was calculated by dividing experimental % motility by control % motility.
Hormone assays
Determination of serum total T4 and total T3 (TT4 and TT3, respectively) were performed as described previously (26) using a Gamma Coat T4 and T3 Radioimmunoassay kit (Dia-Sorin, Stillwater, MN) according to the manufacturer's instructions. Serum thyroid-stimulating hormone (TSH) levels were obtained using a method described previously (24).
Statistical analysis
KaplanMeier cumulative survival analysis was determined for TRßPV/PV and TRßPV/PV PTTG/ mice using GraphPad PRISM 4.0a (GraphPad Software, San Diego, CA). Thyroid function tests were determined using analysis of variance followed by Tukey's multiple comparison test using GraphPad PRISM 4.0a software. Cell cycle differences were determined using analysis of variance and cell motility results were analyzed using the Student's t-test where P < 0.05 was considered significant. One-sided analysis of variance was used to analyze the histological progression and thyroid weights.
| Results |
|---|
|
|
|---|
Lack of PTTG does not significantly alter the pituitarythyroid dysregulation in TRßPV/PV mice
TRßPV/PV mice model the human syndrome RTH, which comprised decreased tissue responsiveness to thyroid hormone. The typical biochemical abnormalities in RTH patients include elevation of the thyroid hormones (T3 and T4) with a non-suppressed TSH. TRßPV/PV mice recapitulate the thyroid function test abnormalities of RTH patients, but the overall magnitude of difference compared with wild-type mice is magnified given the presence of two mutant TRß alleles (22,20). With the creation of a new double-mutant mouse (i.e. TRßPV/PV PTTG/ mouse), we proceeded to evaluate whether PTTG plays a significant role in the modulation of the pituitarythyroid axis. Thyroid function tests were obtained for the different genotypes of mice at various ages (Figure 1). In Figure 1A, there is no appreciable difference in serum total T4 levels between wild-type and PTTG/ mice. Similar to prior studies, TRßPV/PV mice have extremely high levels of T4 compared with mice with wild-type TRß; this finding is not influenced by the presence or absence of PTTG (Figure 1A). The levels of the biologically active thyroid hormone, T3, are determined by both the direct production in the thyroid and conversion of T4 to T3 (27). Similar to T4, the total T3 levels between wild-type mice and PTTG/ mice, in either age group, were not different from each other (Figure 1B). However, in the older age group, the TRßPV/PV mice had higher levels of T3 than TRßPV/PV PTTG/ mice by 2-fold (Figure 1B). Despite the elevated T3 levels in the older age group, the TSH levels were not different between the TRßPV/PV and TRßPV/PV PTTG/ mice (Figure 1C). As similar serum levels of TSH exist in mice with or without PTTG, this suggests that the thyrotrope population in the pituitaries of PTTG-null mice is not significantly altered. Figure 2A-a supports this hypothesis, as there is no significant reduction in pituitary size in the pituitaries of TRßPV/PV PTTG/ mice compared with TRßPV/PV mice. These results suggest that deletion of PTTG does not significantly influence the pituitarythyroid axis. However, consistent with that reported for PTTG/ mice (15), we found that in TRß wild-type mice, pituitary size of female wild-type mice was significantly reduced by the lack of PTTG (Figure 2A-b). Taken together, these results suggest that the mutation of the TRß gene could affect the action of PTTG in pituitary growth.
|
|
Deficiency of PTTG affects thyroid growth
As TSH is a major stimulus for thyrocyte growth and could confound the interpretation of FTC biology in TRßPV/PV mice, we next determined the thyroid weights in mice with or without PTTG. Given that no differences in TSH levels and pituitary size were found in our mice, we might also expect there to be no difference in thyroid size. Indeed, there was no difference in thyroid weights between wild-type TRß mice that express or do not express PTTG (TRß+/+ PTTG+/+ versus TRß+/+ PTTG/, Figure 2B). We further evaluated the thyroid weights at different ages of TRßPV/PV and TRßPV/PV PTTG/ mice. Consistent with prior published studies, compared with the thyroid weights of wild-type mice (lanes 2 and 4), we see in Figure 2B that TRßPV/PV mice develop very large goiters that increase as the mice age (26,28; lanes 6, 8 and 10, Figure 2B). However, Figure 2B shows that across all ages, TRßPV/PV mice exhibit significantly larger thyroids compared with TRßPV/PV mice lacking PTTG (lanes 5, 7, 9 compared with lanes 6, 8 and 10, respectively). Since there were no significant differences in TSH levels between TRßPV/PV PTTG+/+ and TRßPV/PV PTTG/ mice, these findings suggest that PTTG may be critical in times of active thyroid growth, for example, in response to increased levels of TSH, whereas PTTG may not be crucial for maintenance of physiologic thyrocyte growth.
PTTG ablation decreases thyrocyte proliferation
To understand the mechanism for the reduced thyroid size in TRßPV/PV PTTG/ versus TRßPV/PV mice when TSH levels are comparable, we evaluated thyrocyte proliferation status using Ki-67 staining. Figure 3A shows representative slides of thyroid tissues from the two groups. Panel A shows the negative control and panel B represents the amount of Ki-67 staining in normal thyroid tissue. As can be seen in panels C and D, there is an increase in Ki-67 in TRßPV/PV thyroids compared with wild type as represented by the arrows. However, there is a decrease in Ki-67 staining in TRßPV/PV PTTG/ thyroids compared with TRßPV/PV thyroids, which indicates a lower rate of proliferation in the absence of PTTG (panels E and F). Reduction in the rate of thyrocyte proliferation supports the findings of the decrease in gross thyroid weight.
|
TRßPV/PV PTTG/ thyroids exhibit altered cell cycle parameters with up-regulation of p21
To assess whether there are any differences in the cell cycle of TRßPV/PV versus TRßPV/PV PTTG/ thyroids, we performed flow cytometry of frozen thyroid tissue samples. Cell cycle analysis using frozen tissue specimens is advantageous in that it may provide a more representative picture of the thyroid in vivo. Figure 3B shows that there is a decrease of TRßPV/PV PTTG/ cells in G0/G1 with an increased percentage of thyrocytes in G2/M. The increase of PTTG-null cells in G2/M is consistent with other cell cycle studies of PTTG-null cell lines (15) and may correspond with the smaller thyroid weights seen in Figure 2B. We next examined known cell cycle regulators that may contribute to alteration of the cell cycle. PTTG has been shown to modulate p21 expression in the pituitary (16). Our western blot analysis of thyroid lysate from TRßPV/PV PTTG/ and TRßPV/PV PTTG+/+ mice also showed an up-regulation of p21 in PTTG-deficient mice (lanes 46 compared with lanes 13; Figure 3C-a). One consequence of elevated p21 is inhibition of cdk (i.e. cdk2) and decreased phosphorylation of Rb, ultimately leading to impairment of transition from the G0/G1 phase to the S phase of the cell cycle. Indeed, we found a reduction of phosphorylated Rb in the thyroids of TRßPV/PV PTTG/ mice (lanes 46, Figure 3C-b) compared with TRßPV/PV thyroid (lanes 13, Figure 3C-b). A slight reduction in the unphosphorylated Rb was also observed in TRßPV/PV PTTG/ mice.
The reduced phosphorylation of Rb may lead to a decrease in thyrocyte proliferation. Thus, the reduction in thyroid growth may be mediated in part by the up-regulation of p21.
Ablation of PTTG does not reduce FTC occurrence but alters FTC aggressiveness
Although PTTG deletion negatively affects thyroid proliferation in TRßPV/PV mice, these mice still develop goiters. With prior reports describing a protective effect of PTTG ablation on pituitary tumor development, we next focused on FTC tumorigenesis in TRßPV/PV PTTG/ mice. The criteria for a diagnosis of FTC includes capsular or vascular invasion present in the thyroid. The histopathological analysis of the thyroids and of the heart and lungs from mice that were killed due to moribund status, beginning at 45 months of age in both groups, show that both TRßPV/PV and TRßPV/PV PTTG/ mice develop hyperplasia at a young age (Figure 4A). Hyperplasia is consistent with the increased thyroid weights and elevated TSH levels, but this is not a criterion for FTC. Figure 4A shows that there is no difference in the occurrence of capsular invasion, which signifies that both groups of mice develop FTC. These findings suggest that PTTG ablation is not protective against the development of FTC which is in contrast to prior reports of PTTG deletion preventing pituitary tumor development (16). Interestingly, there is a significant decrease in vascular invasion seen in TRßPV/PV PTTG/ mice. As FTC spreads hematogenously, the reduced vascular invasion may lead to decreased metastasis. Figure 4A shows that there is a trend toward decreased lung metastasis. Additional analysis of the survival rates comparing these groups support the premise that PTTG may influence the metastatic potential of FTC. That thyroid tumor progression is delayed is further supported by the survival curve in which a significant reduction in mortality in TRßPV/PV PTTG/ mice (median age 367 versus 267 days, P < 0.05) was observed (Figure 4B) at the age when thyroid growth was significantly rapid (
9 months of age; Figure 2B) as compared with that of TRßPV/PV PTTG+/+ mice.
|
PTTG deficiency decreases neovascularization in the thyroid
The decrease in vascular invasion and reduction in lung metastasis in TRßPV/PV PTTG/ mice suggests that PTTG may alter the balance of angiogenic factors in the thyroid. The thyroid is a very vascular organ and to evaluate whether any differences in the vascular pattern exist in PTTG-deficient thyroids, we performed immunohistochemistry using the endothelial marker CD31. Figure 5A shows that TRßPV/PV PTTG/ have less staining for CD31, compared with TRßPV/PV PTTG+/+ thyroids. These results may help to explain the observed decrease in vascular invasion. To understand which angiogenic factors may be influential in the thyroid, we performed real-time reverse transcriptionpolymerase chain reaction analysis on downstream targets of PTTG, FGF2, its receptor FGFR1 and VEGF that are known to contribute to angiogenesis. Figure 5B shows that in the thyroids of the mice lacking PTTG have reduced levels of FGF2 (Figure 5B-a), FGFR1 (Figure 5B-b) and VEGF (Figure 5B-c). Another marker for vascular invasion in human FTC is the valosin-containing protein, which is known as p97 (29). It is also decreased in the thyroids of TRßPV/PV PTTG/ mice compared with TRßPV/PV thyroids (Figure 5C) and corroborates the hypothesis that deletion of PTTG in FTC tumors may reduce its invasive ability.
|
PTTG may alter cell motility
The significant reduction in vascular invasion suggests that PTTG could be involved in cell migration. Our histology showed that there was a trend toward decreased lung metastasis (Figure 4A). The downstream effectors of PTTG are being investigated, but given PTTG's multifunctional properties, it may also regulate cell motility. To investigate whether PTTG ablation could be a disadvantage for cell migration, we performed in vitro motility assays using cultured primary thyroid tumor cells derived from both TRßPV/PV PTTG/ and TRßPV/PV mice. Figure 6 shows that the cell line from TRßPV/PV PTTG/ mice moved at a slower rate than those derived from TRßPV/PV mice, indicating that PTTG has effects on cell motility independent of angiogenesis and cell proliferation.
|
| Discussion |
|---|
|
|
|---|
PTTG is considered a proto-oncogene and its overexpression is associated with many tumors, including human thyroid cancer. There are many mechanisms through which PTTG contributes as an oncogene, including the areas of cell proliferation and angiogenesis. Previous reports found that in pituitary tumorigenesis in the mouse, PTTG is a critical factor as the ablation of PTTG was protective against pituitary tumor development (16). In addition, PTTG overexpression was sufficient to promote pituitary microadenomas in mice, suggesting an initiating role for PTTG in pituitary tumor development (30).
To understand the molecular basis of thyroid cancer, we have utilized the TRßPV/PV mouse model that spontaneously develops FTC similar to humans. The genetic changes responsible for FTC development and behavior are not well known and mutations such as the fusion Pax8PPAR
rearrangement are not entirely specific for FTC (31). Elevation of PTTG in human thyroid cancers has been associated with an increase in pro-angiogenic genes and chromosomal instability (19). As these studies suggest that PTTG may have an important role in FTC tumorigenesis, we proceeded to determine the effects of PTTG ablation in the TRßPV/PV mouse model.
Our results show that TRßPV/PV PTTG/ mice are viable. As it is not known whether PTTG has a direct effect on TRß signaling pathways, we evaluated the thyroid function tests of TRßPV/PV and TRßPV/PV PTTG/ mice to determine if there is any significant alteration in the regulation of the pituitarythyroid axis. We found that both groups of mice had similarly elevated thyroid hormone levels along with a non-suppressed TSH. There was no statistically significant difference in serum total T4 or TSH levels at two different time points suggesting that PTTG may not directly contribute to the negative regulation of TSH by TRß. There are no prior reports on the thyroid function tests of PTTG/ mice, although they were found to have smaller pituitaries compared with wild-type mice (16). Recent creation of mice expressing human PTTG under the control of the
-subunit glycoprotein hormone (
-GSU) promoter resulted in PTTG overexpression in the pituitary (
-GSU.PTTG mouse). The
-GSU.PTTG mice developed pituitary hyperplasia and microadenomas (30). Interestingly, some of these transgenic mice overexpressed PTTG in pituitary cells that co-stained for TSH, but there was no elevation of serum TSH or total T4 levels (30). These findings suggest that PTTG may not have a prominent role in TSH secretion. Similar levels of TSH in TRßPV/PV and TRßPV/PV PTTG/ mice also suggest that TSH is not sufficient to account for any observed differences in the thyroid, but that PTTG may have more direct effects on the thyroid. There is currently no data suggesting that PTTG may act as a co-regulatory protein for nuclear receptors. Our studies do reveal a difference in serum T3 levels in the older TRßPV/PV versus TRßPV/PV PTTG/ mice. It is unclear as to the cause as TSH levels are not significantly different in TRßPV/PV with or without PTTG. This may be due to the larger thyroid size in the TRßPV/PV mice that may coincide with increased T3 production or increased conversion of T4 to T3 by tumor. One group found increased T4 to T3 conversion in human FTC patients due to overexpression of type 2 deiodinase (32). Future investigation into whether PTTG affects deiodinase activity may clarify this issue, but the important point for our studies is that TSH is not significantly different between the two groups.
The decrease in thyroid size in the TRßPV/PV PTTG/ mice was seen at an early age and is unlikely to be attributed to the serum TSH levels. PTTG's effects on cell cycle regulation are more likely to impact thyroid growth. We found on evaluation of cell cycle regulators that thyroids without PTTG have an increase in p21 levels with concomitant decrease in phosphorylated Rb. The present study therefore identified PTTG as a novel regulator for thyroid growth. It is important to note that although the thyroids of TRßPV/PV PTTG/ mice grew slower, the reduced proliferation did not prevent the development of FTC. These observations suggest that PTTG-mediated proliferation may not directly contribute to the development of thyroid carcinogenesis in TRßPV/PV mice.
PTTG removal did result in a decrease in vascular invasion and eventually to reduced lung metastasis. Recent studies showed that prevention of goiter development could be accomplished by inhibiting the VEGF, angiopoietin, and fibroblast growth signaling pathways (31). There is also growing evidence that PTTG may activate pro-angiogenic factors such as FGF2 and VEGF (19). Consistent with these observations, our TRßPV/PV PTTG/ mice also showed a significant reduction of FGF2, its receptor FGFR1 and VEGF at the mRNA level. The protein p97 is being evaluated as a marker for FTC recurrence as it is another angiogenic marker that is decreased in the TRßPV/PV PTTG/ mice. P97 is well known to regulate endoplasmic reticulum-associated degradation of proteins by removing substrates from the endoplasmic reticulum and transferring them to the cytosol for proteasomal degradation. Although p97 can interact with multiple proteins, there is no current data showing an interaction between p97 and PTTG. Future study on how PTTG may alter p97 expression with resultant alteration of the vascular micro-environment may aid in understanding FTC pathogenesis. The phenotype of a decrease in vessel density seen by immunohistochemistry along with a reduction in vascular invasion and metastasis in PTTG-null mice suggests that PTTG removal may impede the ability for FTC to escape outside the thyroid. The multifunctional properties of PTTG in contributing to tumorigenesis may also include its ability to affect cell motility. Our cell motility experiments show that the ablation of PTTG impaired motility. Identification of the downstream targets of PTTG that may directly influence cell motility may also help our understanding of PTTG's role in modulating the metastatic potential of FTC.
Our in vivo study of PTTG ablation in the thyroids of TRßPV/PV mice, which are predisposed to develop thyroid cancer, found a decrease in thyrocyte growth and increase in p21 and alteration of the RbE2F pathway. These findings are similar to another group that studied the effects of PTTG removal in the Rb+/ mouse that develops pituitary tumors (16). However, there are also tissue-specific effects of PTTG ablation in the thyroid with the most striking being that deletion of PTTG was not protective against FTC tumorigenesis. Our findings are in contrast to the prior study showing that PTTG reduces the occurrence of pituitary tumors. Part of these findings may be attributed to the other mutation present in each respective strain (i.e. Rb heterozygous versus dominant-negative TRß). Our results suggest that deletion of PTTG in TRßPV/PV mouse thyroids decreases cell proliferation, up-regulates p21, reduces angiogenic factors such as FGF2 and leads to an overall improvement in survival. Our findings suggest that PTTG may be a valid target for retarding both thyrocyte growth and FTC progression. The TRßPV mouse provides a valuable preclinical model to investigate the initiators and contributors to FTC tumorigenesis.
| Acknowledgments |
|---|
We thank Dr Shlomo Melmed for the PTTG/ mice and Dr Lawrence Samelson for his p97 antibody. This research was supported, in part, by the Intramural Research Program of the National Institutes of Health, National Cancer Institute, Center for Cancer Research.
| References |
|---|
|
|
|---|
- Zou H, et al. (1999) Identification of a vertebrate sister-chromatid separation inhibitor involved in transformation and tumorigenesis. Science 285:418422.
[Abstract/Free Full Text] - Ramaswamy S, et al. (2003) A molecular signature of metastasis in primary solid tumors. Nat. Genet. 33:4954.[CrossRef][Web of Science][Medline]
- Pei L, et al. (1997) Isolation and characterization of a pituitary tumor-transforming gene (PTTG). Mol. Endocrinol. 11:433441.
[Abstract/Free Full Text] - Zhang X, et al. (1999) Structure, expression and function of human pituitary tumor transforming gene (PTTG). Mol. Endocrinol. 13:156166.
[Abstract/Free Full Text] - Kim D, et al. (2005) Pituitary tumor transforming gene (PTTG) induces genetic instability in thyroid cells. Oncogene 24:48614866.[CrossRef][Web of Science][Medline]
- Heaney AP, et al. (2000) Expression of pituitary-tumour transforming gene in colorectal tumours. Lancet 355:716719.[CrossRef][Web of Science][Medline]
- Ishikawa H, et al. (2001) Human pituitary tumor-transforming gene induces angiogenesis. J. Clin. Endocrinol. Metab. 86:867874.
[Abstract/Free Full Text] - Jallepalli PV, et al. (2001) Securin is required for chromosomal stability in human cells. Cell 105:445457.[CrossRef][Web of Science][Medline]
- Hamid T, et al. (2004) PTTG/securin activates expression of p53 and modulates its function. Mol. Cancer 3:18.[CrossRef][Medline]
- Zhou C, et al. (2005) Overexpression of human pituitary tumor transforming gene (hPTTG) is regulated by beta-catenin/TCF pathway in human esophageal squamous cell carcinoma. Int. J. Cancer 113:891898.[CrossRef][Web of Science][Medline]
- Mu YM, et al. (2003) Human pituitary tumor transforming gene (hPTTG) inhibits human lung cancer A549 cell growth through activation of p21 (WAF1/CIO1). Endocr. J. 50:771781.[CrossRef][Web of Science][Medline]
- Bernal JA, et al. (2002) Human securin interacts with p53 and modulates p53-mediated transcriptional activity and apoptosis. Nat. Genet. 32:306311.[CrossRef][Web of Science][Medline]
- Yu R, et al. (2000) Pituitary tumor transforming gene (PTTG) regulates placental JEG-3 cell division and survival: evidence from live cell imaging. Mol. Endocrinol. 14:11371146.
[Abstract/Free Full Text] - Chen L, et al. (2000) Identification of the human pituitary tumor transforming gene (hPTTG) family: molecular structure, expression and chromosomal localization. Gene 248:4150.[CrossRef][Web of Science][Medline]
- Wang Z, et al. (2001) Mice lacking pituitary tumor transforming gene show testicular and splenic hypoplasia, thymic hyperplasia, thrombocytopenia, aberrant cell cycle progression, and premature centromere division. Mol. Endocrinol. 15:18701879.
[Abstract/Free Full Text] - Chesnokova V, et al. (2005) Pituitary hypoplasia in PTTG/ mice is protective for Rb+/ pituitary tumorigenesis. Mol. Endocrinol. 19:23712379.
[Abstract/Free Full Text] - Donangelo I, et al. (2006) PTTG over-expression facilitates pituitary tumor development. Endocrinology 147:47814791.
[Abstract/Free Full Text] - Heaney AP, et al. (2001) Transforming events in thyroid tumorigenesis and their association with follicular lesions. J. Clin. Endocrinol. Metab. 86:50255032.
[Abstract/Free Full Text] - Kim DS, et al. (2006) Pituitary tumor transforming gene (PTTG) regulates multiple downstream angiogenic genes in thyroid cancer. J. Clin. Endocrinol. Metab. 91:11191128.
[Abstract/Free Full Text] - Suzuki H, et al. (2003) Compensatory role of thyroid hormone receptor (TR)
1 in resistance to thyroid hormone: study in mice with a targeted mutation in the TRß gene and deficient in TR
1. Mol. Endocrinol. 17:16471655.[Abstract/Free Full Text] - Ying H, et al. (2003) Alterations in genomic profiles during tumor progression in a mouse model of follicular thyroid carcinoma. Carcinogenesis 24:14671479.
[Abstract/Free Full Text] - Kaneshige M, et al. (2000) Mice with a targeted mutation in the thyroid hormone ß receptor gene exhibit impaired growth and resistance to thyroid hormone. Proc. Natl Acad. Sci. USA 97:1320913214.
[Abstract/Free Full Text] - Kim CS, et al. (2005) AKT activation promotes metastasis in a mouse model of follicular thyroid carcinoma. Endocrinology 146:44564464.
[Abstract/Free Full Text] - Furumoto H, et al. (2005) An unliganded thyroid hormone ß receptor activates the cyclin D1/cyclin-dependent kinase/retinoblastoma/E2F pathway and induces pituitary tumorigenesis. Mol. Cell. Biol. 25:124135.
[Abstract/Free Full Text] - Zitzmann S, et al. (2002) Arginine-glycine-aspartic acid (RGD)-peptide binds to both tumor and tumor-endothelial cells in vivo. Cancer Res. 62:51395143.
[Abstract/Free Full Text] - Ying H, et al. (2005) Dual functions of the steroid hormone receptor coactivator 3 in modulating resistance to thyroid hormone. Mol. Cell. Biol. 25:76877695.
[Abstract/Free Full Text] - Zavacki AM, et al. (2005) Type 1 iodothyronine deiodinase is a sensitive marker of peripheral thyroid status in the mouse. Endocrinology 146:15681575.
[Abstract/Free Full Text] - Suzuki H, et al. (2002) Mice with a mutation in the thyroid hormone receptor ß gene spontaneously develop thyroid carcinoma: a mouse model of thyroid carcinogenesis. Thyroid 12:963969.[CrossRef][Web of Science][Medline]
- Yamamoto S, et al. (2005) Increased expression of valosin-containing protein (p97) is correlated with disease recurrence in follicular thyroid cancer. Ann. Surg. Oncol. 12:925934.
[Abstract/Free Full Text] - Abbud RA, et al. (2005) Early multipotential pituitary focal hyperplasia in the alpha-subunit of glycoprotein hormone-driven pituitary tumor-transforming gene transgenic mice. Mol. Endocrinol. 19:13831391.
[Abstract/Free Full Text] - Ramsden JD, et al. (2005) Complete inhibition of goiter in mice requires combined gene therapy modification of angiopoietin, vascular endothelial growth factor, and fibroblast growth factor signaling. Endocrinology 146:28952902.
[Abstract/Free Full Text] - Kim BW, et al. (2003) Overexpression of type 2 iodothyronine deiodinase in follicular carcinoma as a cause of low circulating free thyroxine levels. J. Clin. Endocrinol. Metab. 88:594598.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Yan, C. Zhou, X. Lou, Z. Xiao, H. Zhu, Q. Wang, Y. Wang, N. Lu, S. He, Q. Zhan, et al. PTTG Overexpression Promotes Lymph Node Metastasis in Human Esophageal Squamous Cell Carcinoma Cancer Res., April 15, 2009; 69(8): 3283 - 3290. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Salehi, K. Kovacs, B. W Scheithauer, R. V Lloyd, and M. Cusimano Pituitary tumor-transforming gene in endocrine and other neoplasms: a review and update Endocr. Relat. Cancer, September 1, 2008; 15(3): 721 - 743. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhou, Y. Tong, K. Wawrowsky, S. Bannykh, I. Donangelo, and S. Melmed Oct-1 induces pituitary tumor transforming gene expression in endocrine tumors Endocr. Relat. Cancer, September 1, 2008; 15(3): 817 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Guigon, L. Zhao, C. Lu, M. C. Willingham, and S.-y. Cheng Regulation of {beta}-Catenin by a Novel Nongenomic Action of Thyroid Hormone {beta} Receptor Mol. Cell. Biol., July 15, 2008; 28(14): 4598 - 4608. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, C. Lu, M. C. Willingham, and S.-y. Cheng Inhibition of phosphatidylinositol 3-kinase delays tumor progression and blocks metastatic spread in a mouse model of thyroid cancer Carcinogenesis, December 1, 2007; 28(12): 2451 - 2458. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









