Skip Navigation


Carcinogenesis Advance Access originally published online on April 21, 2007
Carcinogenesis 2007 28(8):1692-1696; doi:10.1093/carcin/bgm095
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/8/1692    most recent
bgm095v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Takeuchi, Y.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takeuchi, Y.
Right arrow Articles by Wakabayashi, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Suppression of N-nitrosobis(2-oxopropyl)amine-induced pancreatic carcinogenesis in hamsters by pioglitazone, a ligand of peroxisome proliferator-activated receptor {gamma}

Yoshito Takeuchi, Mami Takahashi, Katsuhisa Sakano, Michihiro Mutoh, Naoko Niho, Masafumi Yamamoto, Hidetaka Sato1, Takashi Sugimura and Keiji Wakabayashi*

Cancer Prevention Basic Research Project, National Cancer Center Research Institute, 1-1 Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan
1 Department of Biological Safety Research, Japan Food Research Laboratories, Bunkyo 2-3, Chitose-shi, Hokkaido 066-0052, Japan

* To whom correspondence should be addressed. Tel: +81-3-3542-2511 ext.4350; Fax: +81-3-3543-9305;Email: kwakabay{at}gan2.res.ncc.go.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Fat intake and obesity are positively correlated with pancreatic cancer in humans. N-nitrosobis(2-oxopropyl)amine (BOP) induces pancreatic ductal adenocarcinomas limited to Syrian golden hamsters, other rodents not being susceptible. In the present study, we found markedly high levels of serum triglycerides (TGs) and total cholesterol (TC) in Syrian golden hamsters, but not C57BL/6 mice, ICR mice, F344 rats and Wistar rats. Consistent with this, lipoprotein lipase (LPL) activities in the liver were lower in hamsters compared with mice and rats. To examine effects of pioglitazone, a peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) ligand, on LPL expression, serum lipid levels and pancreatic cancer development, 6-week-old female Syrian golden hamsters were subcutaneously injected with BOP (10 mg/kg body wt) four times in a week and thereafter fed a diet containing 800 p.p.m. pioglitazone for 22 weeks. The treatment elevated LPL mRNA expression in the liver and significantly improved hyperlipidemia with serum levels of TG and TC being decreased to 62 and 71%, respectively, of the control values. Concurrently, the incidence and multiplicity of pancreatic ductal adenocarcinomas were significantly decreased by pioglitazone in comparison with the controls (38 versus 80%, P < 0.01 and 0.55 ± 0.15 versus 1.37 ± 0.22, P < 0.01, respectively). The suppression rates were grater in invasive adenocarcinomas than non-invasive ones. The incidence of cholangiocellular carcinomas was also reduced. Thus, suppression of pancreatic adenocarcinoma development by pioglitazone is possibly associated with improvement in the serum lipid profile, and hyperlipidemia could be an enhancing factor for development of pancreatic cancer in hamsters.

Abbreviations: Apc, adenomatous polyposis coli; BOP, N-nitrosobis(2-oxopropyl)amine; IL, interleukin; LPL, lipoprotein lipase; MMP, matrix metalloproteinase; PCR, polymerase chain reaction; PPAR{gamma}, peroxisome proliferator-activated receptor {gamma}; RT, reverse transcription; TC, total cholesterol; TG, triglyceride; TZD, thiazolidinedione


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
It was estimated that ~220 000 people die of pancreatic cancer worldwide every year (1), this being the fourth leading cause of cancer-related mortality in the USA (2) and the fifth in Japan (3), where pancreatic cancer is steadily increasing in incidence and a 5-year survival rate is extremely low (4). From epidemiological studies, environmental factors like cigarette smoking and dietary habits are risk factors (5), one report implicating a high intake of saturated fat (6). Likewise, cohort studies have indicated that obese individuals are at increased risk of pancreatic cancer (7,8). Generally, progress of pancreatic cancer is very silent, so early detection is extremely difficult. In addition, effective chemotherapeutic and chemopreventive agents against pancreatic cancer have yet to be identified. Therefore, elucidation of causative factors and mechanisms underlying pancreatic carcinogenesis is a high priority.

The Syrian golden hamster is a unique model animal for development of ductal pancreatic cancer with subcutaneous injections of N-nitrosobis(2-oxopropyl)amine (BOP) (9), the induced lesions having close similarities to the major form of pancreatic cancer in humans. Point mutations in codon 12 of the K-ras gene are frequently observed (10), and expression of the fragile histidine triad gene, a tumor suppression gene, is generally abnormal in hamsters (11) as in human cases (12,13). Interestingly, BOP does not induce pancreatic ductal cancers in mice (14) or rats (15) and the reason for the species specificity is not clear. Incidentally, we found the age-dependent hyperlipidemic state in hamsters even when the animals were fed a low-fat standard diet, but not in mice and rats.

Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}), one of the nuclear receptor superfamily of ligand-activated nuclear transcription factors (16,17), is prominently expressed in adipose tissue, and also in other tissues at lower levels (18). One of its biological functions is to regulate adipocyte differentiation (19). Thiazolidinediones (TZDs) are ligands for PPAR{gamma}, and one of the TZD derivatives, pioglitazone, has been clinically accepted as an anti-diabetic drug. It is well established that administration of TZDs improves hyperlipidemia and hyperglycemia in animal models (20,21). Furthermore, TZDs have been shown to inhibit the proliferation of various cancers (2225). We have previously reported that adenomatous polyposis coli (Apc) gene-deficient mice, Apc1309 and Min mice, develop hyperlipidemia with down-regulation of lipoprotein lipase (LPL) mRNA and pioglitazone as well as a LPL selective inducer, NO-1886, improves this hyperlipidemia with up-regulation of LPL mRNA and suppresses intestinal polyp formation (2628).

In the present study, we examined serum lipid levels and LPL activity in the livers of hamsters, mice and rats on a 5% fat standard diet, and showed the hyperlipidemic state and lowered hepatic LPL activity in the hamsters. Moreover, pancreatic cancer development was significantly suppressed with improvement of hyperlipidemia by pioglitazone. Based on these data, the role of hyperlipidemia in pancreatic carcinogenesis is discussed.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Animals and chemicals
Female Syrian golden hamsters were obtained from Japan SLC (Shizuoka, Japan) when 5 weeks old and weighing ~80 g and acclimated to laboratory conditions for a week. They were housed two or three per plastic cage, with sterilized softwood chips as bedding, in an air-conditioned animal room, on a 12-h light–dark cycle. Powdered CE-2 (CLEA Japan, Shizuoka, Japan) was employed as a standard basal diet, in which fat is contained at ~5%. Body weights were measured weekly and food consumption twice a week. Food and water were available ad libitum. Female C57BL/6 mice, female F344 rats, female ICR mice and female Wistar rats were obtained from Japan SLC, and their care and food administration conformed to the hamster case. The experimental protocols were approved by the Institutional Ethics Review Committee for Animal Experimentation. BOP was obtained from Nacalai Tesque (Kyoto, Japan) and pioglitazone, (±)-5-[4-[2-(5-ethyl-2-pyridyl)ethoxy]benzyl]thiazolidine-2,4-dione monohydrochloride, was kindly provided by Takeda Pharmaceutical Co., Ltd (Osaka, Japan), and well mixed with powdered CE-2 at a concentration of 800 p.p.m.

Measurement of serum lipid levels in animals
Subgroups of 5–13 hamsters were killed at 6 and 30 weeks of age, and blood samples were collected from the heart under diethyl ether anesthesia after overnight fasting. C57BL/6 mice and F344 rats (five to eight animals per group) were also killed at 6 and 30 weeks of age and blood samples similarly obtained. Blood samples from ICR mice and Wistar rats at 6 and 25 weeks of age were also used. The levels of triglyceride (TG) and total cholesterol (TC) in the serum were measured as reported previously (29).

Measurement of LPL activity in the liver
Liver samples from 6-week-old Syrian golden hamsters, C57BL/6 and ICR mice and F344 and Wistar rats were used. LPL activity was determined using a triolein-tri[1-14C]oleoyl glycerol emulsion substrate as previously reported (30).

Analysis of LPL expression in the livers of hamsters by reverse transcription–polymerase chain reaction
Primers for LPL in hamsters were designed from cDNA sequences that matched perfectly between the mouse (accession number, NM_008509 [GenBank] ) and rat (NM_012598 [GenBank] ), and the cDNA sequence of hamster LPL in the open reading frame was analyzed by reverse transcription (RT)–polymerase chain reaction (PCR) and direct sequencing using an ABI310 PRIZM DNA Sequencer (Applied Biosystems, Foster City, CA). A high degree of sequence similarity was observed with mouse and rat, homologies being 91% and >95% for the nucleotide and amino acid sequences, respectively. The analyzed cDNA sequence was registered at the DNA Data Bank of Japan; accession number, AB194713 [GenBank] . Liver samples were taken from 6-week-old Syrian golden hamsters and stored at –80°C. Total RNA was extracted from the liver samples using Trizol reagent (Invitrogen, Co., Carlsbad, CA). After RNA purification and subsequent DNase I treatment, aliquots of total RNA (2.5 µg) were subjected to the RT reaction with nonamer random primers in a final volume of 50 µl using an Omniscript RT kit (Qiagen, Hilden, Germany). PCR amplification was performed in a final volume of 50 µl with aliquots of cDNA (150 ng) and iTaq DNA polymerase (Bio-Rad Laboratories, Hercules, CA) using a PTC-200 Peltier thermal cycler (MJ Research, Waltham, MA). The primers used were selected from the common sequences among hamster, mouse, rat and human cDNA of LPL and ß-actin—5'-primer: ATTTGCCCTAAGGACCCCTG and 3'-primer: GCACCCAACTCTCATACATTCC (product size, 157 bp) for LPL and 5'-primer: ACGAGGCCCAGAGCAAGAGA and 3'-primer: TGGCTGGGGTGTTGAAGGTC (product size, 228 bp) for ß-actin. The cycling conditions were as follows: 95°C for 3 min, 33 cycles (for LPL) and 28 cycles (for ß-actin) of 94°C for 5 s, 60°C for 20 s and 72°C for 30 s and a 10-min cycle at 72°C. The products were analyzed by 3% agarose gel electrophoresis with ethidium bromide staining. Quantitative real-time RT–PCR was performed using a PTC-200 DNA engine cycler equipped with a CFD-3220 Opticon 2 detector (MJ Research) for fluorescence detection, and SYBR Green I (BioWhittaker Molecular Applications, Rockland, ME) was used as a fluorescence dye. The primers employed were as described above, with cycling conditions as follows: 95°C for 3 min, 45 cycles of 94°C for 5 s, 60°C for 20 s, 72°C for 30 s and 79°C for 2 s. The fluorescence intensity of SYBR Green I was measured at 79°C with every cycle. Each PCR product was subcloned into the TA cloning plasmid vector using the pTARGET mammalian expression system (Promega Co., Madison, WI) and a JM109 Transformation kit (Nippon Gene, Co., Ltd, Toyama, Japan). To determine the copy numbers of cDNA for LPL and ß-actin, their plasmids were cumulatively added to PCR samples as templates in the range of 102–108 copies. Finally, the PCR products were analyzed by 3% agarose gel electrophoresis with ethidium bromide staining to confirm the correct sizes.

Carcinogenicity study and histopathological examination
Sixty hamsters at 6 weeks old were injected subcutaneously with BOP four times (on days 1, 3, 5 and 7) at a dose of 10 mg/kg body wt, a further 20 hamsters receiving saline as vehicle controls. From 1 week after the last BOP treatment, one half of each group was given basal diet and the other diet containing 800 p.p.m. of pioglitazone for 22 weeks. The dose was chosen from our previous study in mice (27) and preliminary study in hamsters (data not shown). At the killing time point at 30 weeks of age, all surviving animals were anesthetized with diethyl ether and blood samples were collected from the heart. At autopsy, the pancreas, heart, lungs, kidneys, liver and bile duct were carefully examined macroscopically. The heart, lungs, kidneys, liver and bile duct were fixed in 10% phosphate-buffered formalin (pH 7.4). Each pancreas was carefully dissected from surrounding tissue and fixed after spreading on filter paper. All paraffinized organs were sectioned and stained with hematoxylin and eosin for assessment of histopathological features, as described previously (31,32).

Statistical analysis
The significance of differences in the incidences of tumors was analyzed by the {chi}2 test. Variation in other data was evaluated by the Student’s t-test. A P value of <0.05 was regarded as significant.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Hyperlipidemic state in hamsters
Serum lipid levels of hamsters were compared with those of mice and rats. As shown in Table I, levels of TG in the serum of Syrian golden hamsters fed a standard diet were markedly high, being 322 ± 41 mg/dl at 6 weeks old, which were 7-fold of those in C57BL mice and 2.8-fold of those in F344 rats. Serum TC levels were also high in Syrian golden hamsters, being 179 ± 6 mg/dl at 6 weeks old, which were 2.1-fold of those in C57BL mice and 1.6-fold of those in F344 rats. The serum TG and TC in 30-week-old hamsters were also in the levels of hyperlipidemia being similar or higher than those in 6-week-old hamsters. On the other hand, serum TG and TC in C57BL mice and F344 rats were not increased at 30 weeks of age. Similarly to C57BL mice and F344 rats, low levels of TG and TC were observed in other strains of rats and mice, such as ICR mice and Wistar rats.


View this table:
[in this window]
[in a new window]

 
Table I. Serum lipid levels of hamsters, mice and rats

 
In addition to the hyperlipidemic state in blood, histopathological evaluation revealed that all hamsters at 30 weeks of age suffered from steatosis in the livers (Figure 1).


Figure 1
View larger version (172K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Liver steatosis in hamster. Histopathological appearanceof tissue sections stained with hematoxylin and eosin—note liver steatosis at 30 weeks of age.

 
Low activity of LPL in hamsters
LPL is a key enzyme to decompose TGs. A low activity of LPL could be one of the causes of hyperlipidemia. LPL activity in the liver of hamsters was then compared with those of mice and rats (Table II). LPL activities in Syrian golden hamsters at 6 weeks of age were 119 ± 36 nmole/min/wet g tissue, whereas those in C57BL mice and F344 rats were significantly higher being 5.1-fold and 3.1-fold, respectively, of the value in hamsters. LPL activities in ICR mice and Wistar rats at 6 weeks of age were also significantly higher than those in hamsters.


View this table:
[in this window]
[in a new window]

 
Table II. LPL activities in the liver of 6-week-old hamsters, mice and rats

 
Effects of pioglitazone on the hyperlipidemic state and cancer development in BOP-treated hamsters
To examine the effect of improvement of hyperlipidemia on pancreatic carcinogenesis in hamsters, hamsters were treated with a pancreatic carcinogen, BOP, and then fed a diet containing 800 p.p.m. pioglitazone. Administration of pioglitazone for 22 weeks after treatment with BOP did not affect the behavior of hamsters, but pioglitazone brought about a slight increase of food intake: the average food intake (g/day/animal) was 10.4 ± 1.2 in the BOP + 800 p.p.m. pioglitazone group and 9.6 ± 0.7 in the BOP + basal diet group (P < 0.005). The final body weight was statistically higher in the BOP + 800 p.p.m. pioglitazone group compared with in the BOP + basal diet group (219.5 ± 20.9 versus 202.3 ± 19.9, n = 29 each, P < 0.005). As shown in Figure 2A and B, serum levels of TG and TC in 30-week-old hamsters were significantly decreased by pioglitazone to 62% (P < 0.001) and 71% (P < 0.001), respectively, of the values of the basal diet group. Severe hepatic steatosis observed in the entire liver in the basal diet group was also ameliorated by the pioglitazone treatment to mild (data not shown). Furthermore, as shown in Figure 3A, expression levels of LPL mRNA in the liver were elevated by treatment with 800 p.p.m. of pioglitazone, quantitative real-time RT–PCR assays demonstrating ~1.7-fold higher values than for the group without pioglitazone (Figure 3B).


Figure 2
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Decrease in serum lipid concentrations by pioglitazone in hamsters. Levels of serum TG and TC in BOP-treated hamsters at 30 weeks of age given diet with or without 800 p.p.m. of pioglitazone for 22 weeks are shown in (A and B), respectively (n = 30). Data are mean ± SE values. Asterisks indicate a significant difference from the controls at P < 0.001.

 


Figure 3
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Elevated expression of LPL mRNA by pioglitazone in hamsters. (A) RT–PCR analysis of LPL mRNA in the livers of hamsters at 30 weeks of age given diet with or without 800 p.p.m. of pioglitazone for 22 weeks. Three hamsters each were used for the RT–PCR analysis with and without pioglitazone treatment, respectively. (B) Quantitative results of the LPL mRNA expression levels by real-time RT–PCR. Data are mean ± SE values (n = 15). Asterisks indicate a significant difference from the control at P < 0.05. ß-Actin was used as an internal control. Copy numbers of LPL and ß-actin were determined using plasmids in which the PCR products were inserted as templates.

 
Pancreatic lesions were histopathologically diagnosed as atypical hyperplasias, non-invasive adenocarcinomas and invasive adenocarcinomas, and the incidence and multiplicity data are summarized in Tables III and IV, respectively. The effective number was defined as the number of animals that survived until 30 weeks of age. As shown in Table III, the incidence of the adenocarcinomas induced by BOP was lower in the group treated with 800 p.p.m. pioglitazone than that in the control group: 38 versus 80% (P < 0.01). Multiplicity of the adenocarcinomas was also decreased by pioglitazone: 0.55 ± 0.15 versus 1.37 ± 0.22 (P < 0.01) (Table IV). Especially, the incidence and multiplicity of invasive adenocarcinomas were significantly lower in the pioglitazone-treated group than the control group being 31 versus 73% (P < 0.01) and 0.38 ± 0.12 versus 1.03 ± 0.16 (P < 0.01), respectively, whereas those of non-invasive adenocarcinomas did not significantly differ between the two groups.


View this table:
[in this window]
[in a new window]

 
Table III. Effects of pioglitazone treatment on the incidences of BOP-induced pancreatic lesions in hamstersa

 


View this table:
[in this window]
[in a new window]

 
Table IV. Effects of pioglitazone treatment on the multiplicity of BOP-induced pancreatic lesions in hamstersa

 
In addition to pancreatic ductal tumors, tumors in the bile duct, liver, lungs and kidneys have been reported to be induced by BOP in hamsters (32). In the present study, cholangiocellular adenomas and carcinomas were observed in the BOP-treated group at incidences of 3 and 47%, respectively (Table V). These cholangiocellular tumors were developed both in intra- and extrahepatic bile ducts. With administration of pioglitazone, their development was also markedly suppressed (Table V). In contrast, lung adenomas were not affected, the incidences being 59% (17/29) and 53% (16/30) with and without pioglitazone, respectively. Renal mesenchymal tumors and hepatocellular carcinomas were observed only in the BOP-alone group, at incidences of 10% (3/30) and 3% (1/30), respectively, but their incidences were not significantly different from those in the BOP + pioglitazone group (0/29 and 0/29, respectively). Tumors in the pancreatic duct, bile duct, liver, lungs and kidneys were not observed in the saline vehicle (n = 10) or pioglitazone group hamsters (n = 10) without the BOP treatment. BOP treatment induced lipomatosis in the pancreas with its toxic effects. In addition, lipomatosis in the pancreas was observed in the pioglitazone-treated groups with and without BOP, however, no toxic signs were seen in the pioglitazone-alone group.


View this table:
[in this window]
[in a new window]

 
Table V. Effects of pioglitazone treatment on the incidence of BOP-induced bile duct tumors in hamstersa

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Our present investigation unequivocally demonstrated a hyperlipidemic state in hamsters on a 5% fat standard diet, but not in mice and rats. It was also observed that 30-week-old hamsters suffered from steatosis in the liver. Furthermore, the LPL activity in the liver of hamsters was significantly lower than those of the other rodents. Dietary administration of pioglitazone, a PPAR{gamma} agonist, decreased serum lipid levels of TG and TC, elevated LPL mRNA expression in the liver and simultaneously suppressed pancreatic ductal adenocarcinoma development, especially the incidence and multiplicity of invasive adenocarcinomas, in BOP-treated hamsters. These results suggest that hyperlipidemia in hamsters may be an enhancing factor for pancreatic ductal cancer development.

This study provides an important insight into the etiology of pancreatic cancer, supporting the epidemiological finding that fat intake and obesity might increase pancreatic cancer risk (68). Malfunction of LPL is one reason for hyperlipidemia (33) and several polymorphisms resulting in lowered activity have been reported to cause primary hypertriglyceridemia in humans (34). From the results of cloning hamster LPL, hamster-specific amino acid changes were found for 4 of 474 amino acids, corresponding to the open reading frame of LPL, but not at reported polymorphism positions, and the amino acid sequence at the active site appears fully conserved in hamsters. It has been reported that transcriptional induction of LPL is mediated via binding of a heterodimeric complex, consisting of PPAR and the retinoid X receptor, to the functional peroxisome proliferator response element sequence in the promoter of the LPL gene (33). Our previous investigations demonstrated that administration of pioglitazone can up-regulate expression of LPL mRNA and suppress dose dependently both hyperlipidemia and intestinal polyp formation in Apc-deficient mice (26,27). An increase in expression of LPL mRNA was similarly shown in hamsters after dietary administration of pioglitazone in the present study, with a decrease of serum lipid concentrations and significant suppression of pancreatic cancers in BOP-treated hamsters. Thus, it is probable that these are causally linked. However, it has been reported that pioglitazone inhibits pancreatic cancer cell growth and invasiveness in vitro (35), so that the direct suppressive effects on cancer cell itself might also be involved. There is a LPL selective inducer, NO-1886, that up-regulates LPL mRNA expression without PPAR{gamma} activation, and we have demonstrated the suppressive effect of NO-1886 on intestinal polyp formation in Apc-deficient mice (28). To exclude the effect of PPAR{gamma} activation and clarify the involvement of LPL in suppression of pancreatic cancer development, further investigation using NO-1886 is warranted.

Hibernating animals such as hamsters exhibit an obese state by deposition of adipose tissues (36) and cytokines secreted from adipose tissues could be involved in down-regulation of LPL. Skeletal muscle LPL protein levels are reduced by adipocyte tissue hypertrophy (37) and it is known that interleukin (IL)-6 and leptin are released from adipocytes, levels being elevated in obese subjects (38). The molecular function of IL-1ß is positively correlated with expression of leptin (39) and there have been reports that IL-6 and IL-1ß can reduce LPL activity (40,41). These adipocytokines enhance the invasiveness of pancreatic cancer, and leptin strongly stimulates the secretion of matrix metalloproteinase-2 (42), which has a primary role in pancreatic cancer cell invasion (43) and is significantly activated in metastatic lesions (44). In the present study, the mass of adipose tissues in hamsters was decreased 38% by pioglitazone treatment in comparison with the controls (data not shown). It is thus suggested that the strong suppression of invasive adenocarcinoma might have been caused by reduced secretion of adipocytokines, due to this decrease of adipose tissue.

In addition, our data indicate that pioglitazone also significantly suppresses the development of cholangiocellular carcinomas, but not lung adenomas. Pancreatic ductal adenocarcinomas and cholangiocellular carcinomas in BOP-treated hamsters have certain genetic characteristics in common; for example, aberrant transcription of the fragile histidine triad gene is observed in both (11,45). Thus, the influence of pioglitazone might be similar for the two types of carcinoma, one arising from ducts in the pancreas and the other from bile ducts. Interestingly, it has been reported that 4-phenylbutyl isothiocyanate suppresses pancreatic cancers and lung tumors, but enhances liver tumorigenesis in BOP-treated hamsters (46). Phenethyl isothiocyanate and a cyclooxygenase inhibitor, nimesulide, also suppress BOP-induced hamster pancreatic cancers and lung tumors, but do not affect liver tumors (32). Thus, the inhibitory mechanisms of pioglitazone on pancreatic cancer may be different from those of these agents.

To conclude, the present study demonstrated a hyperlipidemic state in hamsters, and its improvement with pioglitazone accompanied by suppression of the development of invasive pancreatic adenocarcinomas. The inhibitory effects appeared more remarkable than with a cyclooxygenase-2 inhibitor, nimesulide (32), soybean trypsin inhibitor (47) and phenethyl isothiocyanate (48), so that anti-hyperlipidemic drugs may deserve more consideration as candidate chemopreventive agents active against pancreatic cancer.


    Acknowledgments
 
We are grateful to Dr Masahiro Tsutsumi (Saiseikai Chuwa Hospital, Nara, Japan) and Dr Kazuhiro Tsutsumi (Otsuka Pharmaceutical Factory, Tokushima, Japan) for helpful suggestions. This work was supported in part by Grants-in-Aid for Cancer Research, for the Third-Term Comprehensive 10-Year Strategy for Cancer Control and for Research on Advanced Medical Technology from the Ministry of Health, Labour and Welfare of Japan and a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science. Y.T. and K.S. were recipients of the Research Resident Fellowship from the Foundation for Promotion of Cancer Research during the performance of this research.

Conflict of Interest Statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Parkin DM, et al. Estimating the world cancer burden: Globocan 2000. Int. J. Cancer (2001) 94:153–156.[CrossRef][Web of Science][Medline]
  2. Michaud DS, et al. Dietary patterns and pancreatic cancer risk in men and women. J. Natl Cancer Inst. (2005) 97:518–524.[Abstract/Free Full Text]
  3. Matsuno S, et al. Pancreatic cancer: current status of treatment and survival of 16071 patients diagnosed from 1981–1996, using the Japanese National Pancreatic Cancer Database. Int. J. Clin. Oncol. (2000) 5:153–157.[CrossRef]
  4. Yamamoto M, et al. Japan Pancreatic Cancer Registry: current status. Pancreas (1998) 16:238–242.[Web of Science][Medline]
  5. Schuller HM. Mechanisms of smoking-related lung and pancreatic adenocarcinoma development. Nat. Rev. Cancer (2002) 2:455–463.[CrossRef][Web of Science][Medline]
  6. Stolzenberg–Solomon RZ, et al. Prospective study of diet and pancreatic cancer in male smokers. Am. J. Epidemiol. (2002) 155:783–792.[Abstract/Free Full Text]
  7. Michaud DS, et al. Physical activity, obesity, height, and the risk of pancreatic cancer. JAMA (2001) 286:921–929.[Abstract/Free Full Text]
  8. Calle EE, et al. Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults. N. Engl. J. Med. (2003) 348:1625–1638.[Abstract/Free Full Text]
  9. Pour P, et al. A potent pancreatic carcinogen in Syrian hamsters: N-nitrosobis(2-oxopropyl)amine. J. Natl Cancer Inst. (1977) 58:1449–1453.[Web of Science][Medline]
  10. Cerny WL, et al. Activation of K-ras in transplantable pancreatic ductal adenocarcinomas of Syrian golden hamsters. Carcinogenesis (1990) 11:2075–2079.[Abstract/Free Full Text]
  11. Tsujiuchi T, et al. Alterations in the Fhit gene in pancreatic duct adenocarcinomas induced by N-nitrosobis(2-oxopropyl)amine in hamsters. Mol. Carcinog. (2003) 36:60–66.[CrossRef][Web of Science][Medline]
  12. Grunewald K, et al. High frequency of Ki-ras codon 12 mutations in pancreatic adenocarcinomas. Int. J. Cancer (1989) 43:1037–1041.[Web of Science][Medline]
  13. Sorio C, et al. The FHIT gene is expressed in pancreatic ductular cells and is altered in pancreatic cancers. Cancer Res. (1999) 59:1308–1314.[Abstract/Free Full Text]
  14. Rao MS. Animal models of exocrine pancreatic carcinogenesis. Cancer Metastasis Rev. (1987) 6:665–676.[CrossRef][Web of Science][Medline]
  15. Risch HA. Etiology of pancreatic cancer, with a hypothesis concerning the role of N-nitroso compounds and excess gastric acidity. J. Natl Cancer Inst. (2003) 95:948–960.[Abstract/Free Full Text]
  16. Schoonjans K, et al. The peroxisome proliferator activated receptors (PPARS) and their effects on lipid metabolism and adipocyte differentiation. Biochim. Biophys. Acta (1996) 1302:93–109.[Medline]
  17. Rosen ED, et al. PPAR{gamma}. a nuclear regulator of metabolism, differentiation, and cell growth. J. Biol. Chem. (2001) 276:37731–37734.[Free Full Text]
  18. Braissant O, et al. Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-{alpha}, -ß, and -{gamma} in the adult rat. Endocrinology (1996) 137:354–366.[Abstract]
  19. Tontonoz P, et al. Terminal differentiation of human liposarcoma cells induced by ligands for peroxisome proliferator-activated receptor {gamma} and the retinoid X receptor. Proc. Natl Acad. Sci. USA (1997) 94:237–241.[Abstract/Free Full Text]
  20. Leung N, et al. Rosiglitazone improves intestinal lipoprotein overproduction in the fat-fed Syrian Golden hamster, an animal model of nutritionally-induced insulin resistance. Atherosclerosis (2004) 174:235–241.[Web of Science][Medline]
  21. Mukherjee R, et al. Sensitization of diabetic and obese mice to insulin by retinoid X receptor agonists. Nature (1997) 386:407–410.[CrossRef][Medline]
  22. Mueller E, et al. Terminal differentiation of human breast cancer through PPAR{gamma}. Mol. Cell (1998) 1:465–470.[CrossRef][Web of Science][Medline]
  23. Elstner E, et al. Ligands for peroxisome proliferator-activated receptor {gamma} and retinoic acid receptor inhibit growth and induce apoptosis of human breast cancer cells in vitro and in BNX mice. Proc. Natl Acad. Sci. USA (1998) 95:8806–8811.[Abstract/Free Full Text]
  24. Kubota T, et al. Ligand for peroxisome proliferator-activated receptor {gamma} (troglitazone) has potent antitumor effect against human prostate cancer both in vitro and in vivo. Cancer Res. (1998) 58:3344–3352.[Abstract/Free Full Text]
  25. Sarraf P, et al. Differentiation and reversal of malignant changes in colon cancer through PPAR{gamma}. Nat. Med. (1998) 4:1046–1052.[CrossRef][Web of Science][Medline]
  26. Niho N, et al. Concomitant suppression of hyperlipidemia and intestinal polyp formation in Apc-deficient mice by peroxisome proliferator-activated receptor ligands. Cancer Res. (2003) 63:6090–6095.[Abstract/Free Full Text]
  27. Niho N, et al. Dose-dependent suppression of hyperlipidemia and intestinal polyp formation in Min mice by pioglitazone, a PPAR{gamma} ligand. Cancer Sci. (2003) 94:960–964.[CrossRef][Medline]
  28. Niho N, et al. Concurrent suppression of hyperlipidemia and intestinal polyp formation by NO-1886, increasing lipoprotein lipase activity in Min mice. Proc. Natl Acad. Sci. USA (2005) 102:2970–2974.[Abstract/Free Full Text]
  29. Richmond W. Preparation and properties of a cholesterol oxidase from Nocardia sp. and its application to the enzymatic assay of total cholesterol in serum. Clin. Chem. (1973) 19:1350–1356.[Abstract]
  30. Kitajima S, et al. Overexpression of lipoprotein lipase improves insulin resistance induced by a high-fat diet in transgenic rabbits. Diabetologia (2004) 47:1202–1209.[Web of Science][Medline]
  31. Majima T, et al. Inhibitory effects of ß-carotene, palm carotene, and green tea polyphenols on pancreatic carcinogenesis initiated by N-nitrosobis(2-oxopropyl)amine in Syrian golden hamsters. Pancreas (1998) 16:13–18.[Web of Science][Medline]
  32. Furukawa F, et al. A cyclooxygenase-2 inhibitor, nimesulide, inhibits postinitiation phase of N-nitrosobis(2-oxopropyl)amine-induced pancreatic carcinogenesis in hamsters. Int. J. Cancer (2003) 104:269–273.[CrossRef][Web of Science][Medline]
  33. Schoonjans K, et al. PPAR{alpha} and PPAR{gamma} activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J. (1996) 15:5336–5348.[Web of Science][Medline]
  34. Nordestgaard BG, et al. Heterozygous lipoprotein lipase deficiency: frequency in the general population, effect on plasma lipid levels, and risk of ischemic heart disease. Circulation (1997) 96:1737–1744.[Abstract/Free Full Text]
  35. Galli A, et al. Antidiabetic thiazolidines inhibit invasiveness of pancreatic cancer cells via PPAR{gamma} independent mechanisms. Gut (2004) 53:1688–1697.[Abstract/Free Full Text]
  36. Cincotta AH, et al. Bromocriptine redirects metabolism and prevents seasonal onset of obese hyperinsulinemic state in Syrian hamsters. Am. J. Physiol. (1993) 264:E285–E293.[Web of Science][Medline]
  37. Roberts CK, et al. Effect of diet on adipose tissue and skeletal muscle VLDL receptor and LPL: implications for obesity and hyperlipidemia. Atherosclerosis (2002) 161:133–141.[CrossRef][Web of Science][Medline]
  38. Coppack SW. Pro-inflammatory cytokines and adipose tissue. Proc. Nutr. Soc. (2001) 60:349–356.[Web of Science][Medline]
  39. Gonzalez RR, et al. Leptin upregulates ß3-integrin expression and interleukin-1ß, upregulates leptin and leptin receptor expression in human endometrial epithelial cell cultures. Endocrine (2001) 16:21–28.[CrossRef][Web of Science][Medline]
  40. Feingold KR, et al. Endotoxin rapidly induces changes in lipid metabolism that produce hypertriglyceridemia: low doses stimulate hepatic triglyceride production while high doses inhibit clearance. J. Lipid Res. (1992) 33:1765–1776.[Abstract]
  41. Greenberg AS, et al. Interleukin 6 reduces lipoprotein lipase activity in adipose tissue of mice in vivo and in 3T3-L1 adipocytes: a possible role for interleukin 6 in cancer cachexia. Cancer Res. (1992) 52:4113–4116.[Abstract/Free Full Text]
  42. Castellucci M, et al. Leptin modulates extracellular matrix molecules and metalloproteinases: possible implications for trophoblast invasion. Mol. Hum. Reprod. (2000) 6:951–958.[Abstract/Free Full Text]
  43. Ellenrieder V, et al. TGF-ß-induced invasiveness of pancreatic cancer cells is mediated by matrix metalloproteinase-2 and the urokinase plasminogen activator system. Int. J. Cancer (2001) 93:204–211.[CrossRef][Web of Science][Medline]
  44. Koshiba T, et al. Involvement of matrix metalloproteinase-2 activity in invasion and metastasis of pancreatic carcinoma. Cancer (1998) 82:642–650.[CrossRef][Web of Science][Medline]
  45. Kitahashi T, et al. Aberrant transcription of FHIT gene in intrahepatic cholangiocellular carcinomas induced by N-nitrosobis(2-oxopropyl)amine in hamsters. Exp. Toxicol. Pathol. (2004) 56:153–157.[CrossRef][Web of Science][Medline]
  46. Son H-Y, et al. Modifying effects of 4-phenylbutyl isothiocyanate on N-nitrosobis(2-oxopropyl)amine-induced tumorigenesis in hamsters. Cancer Lett. (2000) 160:141–147.[CrossRef][Web of Science][Medline]
  47. Furukawa F, et al. Inhibitory effects of crude soybean trypsin inhibitor on pancreatic ductal carcinogenesis in hamsters after initiation with N-nitrosobis(2-oxopropyl)amine. Carcinogenesis (1992) 13:2133–2135.[Abstract/Free Full Text]
  48. Nishikawa A, et al. Chemopreventive effects of phenethyl isothiocyanate on lung and pancreatic tumorigenesis in N-nitrosobis(2-oxopropyl)amine-treated hamsters. Carcinogenesis (1996) 17:1381–1384.[Abstract/Free Full Text]
Received December 25, 2006; revised March 15, 2007; accepted April 11, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
M. Takahashi, T. Kitahashi, R. Ishigamori, M. Mutoh, M. Komiya, H. Sato, Y. Kamanaka, M. Naka, T. Maruyama, T. Sugimura, et al.
Increased expression of inducible nitric oxide synthase (iNOS) in N-nitrosobis(2-oxopropyl)amine-induced hamster pancreatic carcinogenesis and prevention of cancer development by ONO-1714, an iNOS inhibitor
Carcinogenesis, August 1, 2008; 29(8): 1608 - 1613.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/8/1692    most recent
bgm095v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Takeuchi, Y.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takeuchi, Y.
Right arrow Articles by Wakabayashi, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?