Skip Navigation


Carcinogenesis Advance Access originally published online on April 13, 2007
Carcinogenesis 2007 28(9):1859-1866; doi:10.1093/carcin/bgm079
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/9/1859    most recent
bgm079v2
bgm079v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sun, D.
Right arrow Articles by Zhu, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, D.
Right arrow Articles by Zhu, L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Loss of p27Kip1 enhances tumor progression in chronic hepatocyte injury-induced liver tumorigenesis with widely ranging effects on Cdk2 or Cdc2 activation

Daqian Sun1,2,{dagger}, Hao Ren1,2,4,{dagger}, Michael Oertel2, Rani S. Sellers3 and Liang Zhu1,2,*

1 Department of Developmental and Molecular Biology
2 Department of Medicine
3 Department of Pathology, Marion Bessin Liver Research Center and Albert Einstein Comprehensive Cancer Center, Albert Einstein College of Medicine, Bronx, NY 10461, USA
4 Present address: Hao Ren's present address is Department of Microbiology, Second Military Medical University, Shanghai 200433, China

* To whom correspondence should be addressed. Tel: 718-430-3320; Fax: 718-430-8975; Email: lizhu{at}aecom.yu.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Effects of p27Kip1 inactivation on tumorigenesis vary from promotion to prevention dependent on the mouse models used. When p27 inactivation has a positive effect on tumorigenesis, de-regulated activation of cyclin-dependent kinases (Cdks) is generally believed to be the underlying mechanism since the function of p27 as an inhibitor of Cdks is firmly established. Here, we determined the effects of p27 inactivation on disease progression and Cdk activation in mouse liver tumorigenesis that originates from hepatocyte regenerative proliferation in response to chronic liver injury, an established etiology in most human liver cancer. Our results show that inactivation of p27 did not affect early-stage hepatocyte regenerative proliferation but promoted tumor cell proliferation and progression in the late stage of the disease. Interestingly, Cdc2 over-expression was observed in all and cyclin E1 was over-expressed in half of the late-stage tumors regardless of p27 status; and p27 inactivation led to significant activation of Cdk2 or Cdc2 only in half of the p27-deficient tumors. These results reveal a tumor suppressor role of p27 in chronic hepatocyte injury-induced liver tumorigenesis and, at the same time, the need to further study the mechanisms for tumor promotion by p27 inactivation.

Abbreviations: Cdks, cyclin-dependent kinases; HBV, hepatitis B virus; PCNA, proliferating cell nuclear antigen


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Liver is unique among solid organs in that mature hepatocytes can regeneratively proliferate in response to a deficiency in liver function (1). The cyclin-dependent kinase inhibitor p27Kip1 has been shown to have a role in hepatocyte regenerative proliferation. Hepatocytes from p27 knockout mice proliferated more efficiently than wild-type hepatocytes after transplantation into p27+/+ host livers that were undergoing liver failure (2,3). Combined inactivation of p27 and p18Ink4c led to a near 2-fold increase in actively proliferating hepatocytes at the peak of response to partial hepatectomy (4). Interestingly, p27 did not exhibit a tumor suppressor role in the liver in previous studies. Liver tumor incidence after treatment of 14-day-old mice with chemical carcinogen N-ethyl-N-nitrosourea did not increase in p27 knockout mice (5). p27 inactivation even prevented liver tumorigenesis induced by X-ray radiation of 14-day-old Connexin32 knockout mice (6). These mouse studies suggest an interesting possibility that targeting p27 can be used to improve hepatocyte transplantation therapies without increasing the risk of developing liver cancer. However, decreased p27 expression has been correlated with high-grade hepatocellular carcinoma and poor prognosis in the clinic (79). Further studies with mouse models that more closely mimic clinical liver cancer should provide better insight into the role of p27 in liver cancer.

Besides the ability to regeneratively proliferate, liver is also special in that the majority of clinical liver cancer has an established etiological cause: chronic hepatocyte injury accompanied by compensatory regenerative hepatocyte proliferation (10). The proliferating hepatocytes are gradually transformed by multiple, mostly unidentified, insults that are generated and present in the environment of chronic hepatocyte injury. Here, regenerative proliferation places the dividing hepatocytes at greater risks for acquiring mutations and subsequently selects for those hepatocytes that incurred mutations that impart proliferative and/or survival advantages to the cells. This model of liver tumorigenesis is strongly supported by a well-established link between chronic infection with hepatitis B virus (HBV) and liver cancer in certain parts of the world (10). Experimentally, transgenic mice expressing high levels of HBV envelope polypeptides under the hepatocyte-specific albumin promoter (11,12) provide a unique model that mimics events downstream of hepatocyte injury in the development of liver cancer (see below for more details of this model in the first section in Results). The first goal of this study was to gain a better understanding of p27's role in liver cancer by using this liver tumor model.

Cyclin-dependent kinases (Cdks) are the engine of cell proliferation and therefore are believed to play a major role in tumorigenesis (13). Among them, Cdk2, which is activated by cyclins E and A and repressed by p27, has been a prime focus as a cancer therapy target since over-expression of cyclins E and/or A and down-regulation of p27 are frequently found in various cancers and experimental over-expression of cyclin E or inactivation of p27 can promote tumorigenesis in many studies (14). Recently, however, Cdk2 has been found dispensable in a number of human cancer cell lines (15). Furthermore, pituitary tumorigenesis in p27 knockout mice was not affected by combined knock out of Cdk2 (16,17). These findings called into question the importance of Cdk2 in tumorigenesis and therefore the suitability of it as a therapeutic target. Nevertheless, it has remained unclear why over-expression of cyclin E and reduction of p27 are frequent in cancer specimens and can experimentally promote tumorigenesis if Cdk2 kinase does not play an important role in tumorigenesis (1517). The second goal of this study was to determine whether and to what extent Cdk2 was actually activated in p27-deficient tumors. It has been shown that Cdc2, which generally complexes with cyclins A and B to promote cell cycle progression in G2 and M phases, may compensate for the loss of Cdk2 in Cdk2 knockout mice (16). We therefore determined Cdc2 activation as well.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mouse strains
Transgenic mice expressing high levels of HBV envelope polypeptides under the albumin promoter, official designation Tg (Alb-1HBV) Bri 44 (12), and p27 knockout mice (18), both on C57BL/6J strain background, were purchased from the Jackson Laboratories (Bar Harbor, ME). Mouse genotyping was determined by polymerase chain reaction of tail DNA using the following primers: for the Alb-HBV transgene, 5' primer: AACATGGAGAACATCACATC, 3' primer: AGCGAT AACCAGGACAAGTT; for p27 knockout allele, 5' primer: CCTTCTATCGCCTTCTTG, 3' primer: TGGAACCCTGTGCCATCTCTAT; for p27 wild-type allele, 5' primer: GATGGACGCCAGACAAGC, 3' primer: ACGGGCTTATGATTCTGAAAGTCG. Taq polymerase from Invitrogen (Carlsbad, CA) was used for Alb-HBV and p27 wild-type genotyping and Taq polymerase from QIAGEN (Valencia, CA) was used for p27 mutant genotyping. Polymerase chain reaction reactions were carried out for 35 cycles, each cycle including 94°C for 30 s, 55°C for 30 s and 72°C for 30 s. Mouse breeding and all animal care were according to USA federal guidelines and under protocols approved by the Animal Care Use Committee of Albert Einstein College of Medicine.

Liver harvest and pathological analysis
Mice were killed in three age groups (6 months, 9–11 months, and 15–17 months) and their livers were removed, photographed and weighed. The presence and dimension of surface tumors were evaluated. Liver slices were cut from each lobe (one slice from each lobe). Three slices of liver tissue were then fixed in formalin overnight and embedded in paraffin. Liver sections were hemotoxylin and eosin stained and the presence of hepatocellular foci, adenomas and carcinomas were diagnosed in a blind fashion according to the following criteria. Hepatocellular foci were defined as areas of atypical hepatocellular hyperplasia that were <2 acini in diameter. Hepatocellular adenomas were defined as expansive masses with some degree of compression of adjacent hepatic parenchyma and a loss of normal lobular architecture (absence of portal structures), but with relatively normal nuclear morphology. Hepatocelluar carcinomas had features similar to those of adenomas, but were defined by nuclear and cellular atypia, thickened or poorly differentiated hepatocyte cords with occasional areas of necrosis. The sizes of areas of various analyses were quantified with the NIH Image software. Fractions of surface tumors of sufficient sizes and their adjacent non-tumor liver tissues were snapfrozen on dry ice and stored at –80°C for biochemical analyses.

Immunohistology
To detect expression of HBsAg, paraffin sections were stained with HistomouseTM-plus kit (Invitrogen, Carlsbad, CA), following the protocol provided by the manufacturer. Antibody to HBsAg (08-0023 from Invitrogen, Carlsbad, CA) was used as primary antibody at 1 µg/ml. To detect proliferating hepatocytes, paraffin sections were stained with HistomouseTM-plus kit (Invitrogen, Carlsbad, CA) with mouse monoclonal antibody to proliferating cell nuclear antigen (PCNA) (PC-10 from Santa Cruz Biotechnology, Santa Cruz, CA) as primary antibody (1 µg/ml). Apoptotic cells were detected by ApopTag Peroxidase in Situ Apoptosis detection kit (Chemicon, Temecula, CA).

Western blot and kinase assays
Mouse liver tissues stored at –80°C were homogenized with Dounce glass homogenizer in tissue lysis buffer (50 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 7.2, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 1 mM ethyleneglycol-bis(aminoethylether)-tetraacetic acid, 0.1% Tween-20, 1 mM dithiothreitol with protease inhibitors). Tissue debris was removed by centrifugation for 10 min at 14 000 r.p.m. at 4°C. Protein concentration in the liver extract was determined by Bio-Rad protein assay kit. For western blot analysis, equal amounts of protein samples were loaded on 10% sodium dodecyl sulfate gels, blotted onto polyvinylidene difluoride membrane and probed with antibodies to cyclin E1 (M20), cyclin A2 (H432), cyclin D1 (72-13G), Cdk2 (M2), Cdc2 (17) and p27 (C19, all from Santa Cruz Biotechnology, Santa Cruz, CA).

For kinase assay, 500 µg of protein samples were mixed with 1 µg of antibody to Cdk2 (M2), Cdc2 (17), cyclin E1 (M20) or cyclin A2 (H432) in 400 µl of ELB (50 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 7.0, 250 mM NaCl, 5 mM ethylenediaminetetraacetic acid, 0.1% NP-40, 1 mM dithiothreitol with protease inhibitors) for 1 h on ice. Then, 50 µl Protein A beads (Sigma, St. Louis, MO) were added to the mixture and rocked overnight at 4°C. The beads were washed once with ELB and once with kinase buffer (50 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 7.0, 10 mM MgCl2, 5 mM MnCl2 and 1 mM dithiothreitol). Kinase assays were performed in 40 µl kinase buffer containing 10 µCi 32P-{gamma}-ATP, 1 µg histone H1 for 50 min at room temperature. Kinase assay was stopped by sodium dodecyl sulfate–polyacrylamide gel electrophoresis loading buffer, boiled and loaded on 12% sodium dodecyl sulfate gels. For extract-mixing experiments, two different extracts each containing 250 µg total proteins were mixed with 1 µg of antibody in 400 µl of ELB for 1 h on ice. The kinase activity was measured as described above.

Relative kinase activity and levels of total proteins were quantified by ImageQuant. Kinase activities were then normalized against the relative levels of total proteins and presented in a bar graph.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Inactivation of p27 significantly promoted proliferation of HBsAg-negative hepatocytes in late-stage liver tumorigenesis in HBsAg+ mice
Transgenic mice expressing high levels of HBV large envelope polypeptides under the albumin promoter are called HBsAg+ mice in this study (the official designation is described in Materials and Methods). To determine the effects of p27 inactivation in liver tumorigenesis in this model, we crossed HBsAg+ mice with p27+/– mice, both on C57BL/6J strain background, to generate cohorts of HBsAg+p27+/+, HBsAg+p27–/–and HBsAg+p27+/– mice.

Liver tumorigenesis in the HBsAg+ mouse model has been well described (1117,19). A fundamental difference between this model and other liver tumor models is that tumors developed in HBsAg+ mice actually do not express the HBV transgene. Other liver tumor models artificially over-express various oncoproteins (such as c-myc or activated Ras) in hepatocytes to directly induce their transformation and therefore tumors in these models express high levels of the transgene. In contrast, high-level expression of non-secretable forms of HBsAg causes their accumulation within the endoplasmic reticulum of hepatocytes, which induces cellular injury and eventual death. In this scenario, stochastic loss of the HBV transgene confers a survival advantage. As a consequence, non-HBsAg-expressing hepatocytes could enter regenerative proliferation in response to deficiency in liver function caused by HBsAg-induced chronic injury and death of HBsAg-expressing hepatocytes. Accordingly, a characteristic early event in the livers of HBsAg+ mice is the appearance of clusters of hepatocytes that stain negative for HBsAg against a background of HBsAg-positive hepatocytes. The sizes of HBsAg-negative hepatocyte clusters reflect the extent of the regenerative proliferation of HBsAg-negative hepatocytes and gradually increase with progression in injury and death of HBsAg-expressing hepatocytes.

At 6 months of age, livers of both HBsAg+p27+/+ and HBsAg+p27–/– mice appeared macroscopically normal and showed homogenous HBsAg staining in cross-lobe sections (data not shown and Figure 1A and B) except for the presence of small clusters of HBsAg-negative hepatocytes visible under microscopic examination (Figure 1C and D). There were 1–2 such clusters per cross-lobe sections of both HBsAg+p27+/+ and HBsAg+p27–/– livers. By 9–11 months of age, livers of both HBsAg+p27+/+ and HBsAg+p27–/– mice contained more numerous and larger HBsAg-negative nodules than those found in 6-month-old mice (Figure 1E and F). Quantitative analysis of HBsAg-negative areas revealed no significant difference between HBsAg+p27+/+ and HBsAg+p27–/– livers (Figure 1G). By 15–17 months of age, HBsAg-negative areas further expanded in both HBsAg+p27+/+ and HBsAg+p27–/ livers (Figure 1H and I). At this stage, HBsAg-negative areas were significantly larger in HBsAg+p27–/ livers than in HBsAg+p27+/+ livers (P < 0.01, Figure 1J). In a number of HBsAg+p27–/– livers, an entire lobe stained negative. These results indicate that inactivation of p27 did not affect the extent of proliferation of HBsAg-negative hepatocytes in the early stages (at least to the 9-month time point), but significantly promoted their proliferation in later stages of this model.


Figure 1
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Development of HBsAg-negative nodules in HBsAg+p27+/+ and HBsAg+p27–/– mice. (A, B, E, F, H and I) Cross-lobe liver sections were stained for HBsAg expression. Photographs were generated by scanning the sections using an Epson film scanner. (C and D) Microscopic pictures of the stained liver sections at 200x magnification. Arrows point to the HBsAg-negative hepatocyte clusters. (G and J) Quantification of HBsAg-negative areas in livers of the indicated mice (n = 8 and 7 for 9- to 11-month-old HBsAg+p27+/+ and HBsAg+p27–/– mice, n = 9 and 8 for 15- to 17-month-old HBsAg+p27+/+ and HBsAg+p27–/– mice, respectively). P values are by Student's t-test.

 
Most HBsAg-negative areas contained histologically benign hepatocytes compatible with a diagnosis of regenerative hyperplasia. However, pathologically diagnosable hepatocellular foci, adenomas, and carcinomas were present in HBsAg-negative areas (see below). This was consistent with previous characterizations of the HBsAg+ mice, in which of the 104 diagnosed adenomas and carcinomas, all but one adenoma was found to be HBsAg negative (1117,19). The fact that neoplastic lesions are HBsAg negative has been explained by the hypothesis that dividing regenerative hepatocytes are at greater risk to incur multiple random mutations caused by various mutagens in the environment of chronic hepatocyte injury and to select for outgrowth of cells that have gained proliferative advantages due to transforming mutations. This scenario may more closely mimic most clinical liver cancer than other liver tumor models that over-express oncogenes directly in all hepatocytes.

Inactivation of p27 enhanced liver tumor progression in late-stage HBsAg+ mice
We first observed liver surface nodules in 9- to 11-month-old HBsAg+p27+/+ and HBsAg+p27–/– mice. The numbers and sizes of these liver nodules were similar between the two types of mice (Figure 2A, B and E, and data not shown). At this time point, liver/body weight ratios did not differ from those of HBsAg- livers for both HBsAg+p27+/+ and HBsAg+p27–/– mice (Figure 2G). Histological examination revealed similar numbers of hepatocellular foci in these two types of mice. HBsAg+p27–/– mice contained slightly more adenomas than HBsAg+p27+/+ mice but the difference was not statistically significant (P = 0.64); and no carcinomas were found in both types of mice (Figure 2H). These results indicate that inactivation of p27 did not significantly promote liver tumorigenesis at the early stages in this model.


Figure 2
View larger version (56K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Liver tumor phenotypes of HBsAg+p27+/+ and HBsAg+p27–/– mice at 9–11 and 15–17 months of age. (A–D) Photographs of representative livers as indicated. (E) Quantification of the numbers of liver surface nodules (>1 mm) of the indicated mice (n = 8 and 7 for HBsAg+p27+/+ and HBsAg+p27–/– mice, respectively). (F) Quantification of maximum tumor sizes. The diameter of the largest liver surface nodule for each liver was used to calculate the average and standard deviation as presented (n = 11, 14 and 9 for HBsAg+p27+/+, HBsAg+p27+/– and HBsAg+p27–/– mice, respectively). (G) Quantification of liver/body weight ratios of the indicated mice (n = 8, 11, 10, 3 and 4 for 9- to 11-month old HBsAg+p27+/+, HBsAg+p27+/–, HBsAg+p27–/–, HBsAg-p27+/+ and HBsAg-p27–/– mice; n = 11, 14, 9, 3 and 4 for 15- to 17-month-old HBsAg+p27+/+, HBsAg+p27+/–, HBsAg+p27–/–, HBsAg-p27+/+ and HBsAg-p27–/– mice, respectively). (H) Histological evaluation of hepatic lesions in the indicated mice. Each liver was examined on three cross-lobe sections (one from each lobe) (n = 6 and 10 for 9- to 11-month-old HBsAg+p27+/+ and HBsAg+p27–/– mice; n = 8 and 8 for 15- to 17-month-old HBsAg+p27+/+ and HBsAg+p27–/– mice). P values are by Student's t-test. (I) Survival analysis of mice of the indicated genotypes (n = 29, 32, 19 and 25 for HBsAg+p27+/+, HBsAg+p27+/–, HBsAg+p27–/– and HBsAg-p27–/– mice).

 
By 15–17 months of age, livers of both HBsAg+p27+/+ and HBsAg+p27–/– mice contained many surface nodules that became too numerous to count. However, HBsAg+p27–/– mice demonstrated significantly enhanced tumor phenotypes than HBsAg+p27+/+ mice as evidenced by the appearance of larger tumor nodules on liver surface (P < 0.01, Figure 2C, D and F) and a larger increase in liver/body weight ratios indicative of increased liver tumor burden (P < 0.01, Figure 2G). The tumor-promoting effects of p27 inactivation were p27 dosage dependent since HBsAg+p27+/– mice showed an intermediate degree of tumor size and tumor burden between HBsAg+p27+/+ and HBsAg+p27–/– mice (Figure 2F and G). Histologically, HBsAg+p27+/+ and HBsAg+p27–/– livers contained similar numbers of hepatocellular foci (Figure 2H). The number of adenoma was clearly higher in HBsAg+p27–/– livers than in HBsAg+p27+/+ livers but the difference did not reach statistical significance (P = 0.081). However, HBsAg+p27–/– livers contained statistically significantly more carcinomas than HBsAg+p27+/+ livers (P = 0.012). These results demonstrate that inactivation of p27 enhanced the overall tumor phenotypes and promoted tumor progression to hepatocellular carcinomas at this stage.

At the end of 17 months, 4 of 32 (12.5%) HBsAg+p27+/+ mice had died (Figure 2I). For HBsAg+p27–/– mice, the death rate was increased to 68.4% (13 of 19). HBsAg+p27+/– mice had an intermediate death rate. It is, however, important to note that HBsAgp27–/– mice also exhibited an intermediate death rate. Since the livers of HBsAg-p27–/– mice were normal (data not shown), knock out of p27 could contribute to accelerated death independent of liver tumor most probably due to spontaneous pituitary tumorigenesis (18,20,21).

Inactivation of p27 led to more active proliferation of hepatocytes in liver tumors
Two important cellular processes in tumorigenesis are proliferation and apoptosis. To determine how p27 inactivation affected these two processes in promoting tumor progression in HBsAg+p27–/– mice at 15–17 months, we determined PCNA labeling indices (as a marker of proliferating hepatocytes) and Terminal deoxynucleotidyl Transferase Biotin-dUTP Nick End Labeling (TUNEL) labeling indices (as a marker of apoptotic hepatocytes) in tumors and adjacent non-tumor liver tissues of HBsAg+p27+/+ and HBsAg+p27–/– mice. The results showed that PCNA labeling indices in hepatocytes in tumors were significantly higher in HBsAg+p27–/– livers than in HBsAg+p27+/+ livers, whereas hepatocytes adjacent to the tumors showed similar PCNA labeling indices (Figure 3A, B and C). Although the numbers of PCNA-positive hepatocytes appeared to increase by ~2-fold at this particular time point as measured, the cumulative effects over time could be quite significant in promoting tumor progression. In comparison, TUNEL labeling indices showed slight but insignificant increases in HBsAg+p27–/– livers than in HBsAg+p27+/+ livers, both in tumors and in areas adjacent to the tumors (Figure 3D, E and F). These results suggest that stimulation of hepatocyte proliferation is the primary cellular mechanism for liver tumor promotion by p27 inactivation in HBsAg+ mice.


Figure 3
View larger version (62K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Determination of cell proliferation and apoptosis in livers of HBsAg+p27+/+ and HBsAg+p27–/– mice at 15–17 months of age. (A, B and C) Representative photographs of PCNA-stained liver section of the indicated genotypes, and quantification of the results (n = 4 and 8 for HBsAg+p27+/+ and HBsAg+p27–/– mice, respectively). (D, E and F) Similar presentation of TUNEL staining results. Numbers of PCNA- or TUNEL-positive cells in ~6 mm2 area inside lesions and 10 mm2 area outside the lesions were counted and average values with standard deviations are shown as bar graph. P values are by Student's t-test.

 
Cdc2 and cyclin E1 were frequently over-expressed in late-stage tumors regardless of p27 status
p27 is a well-established cyclin-dependent kinase inhibitor, and a common biochemical feature of tumor cells is various degrees of over-expression of certain cyclins. We next determined expression levels of cyclins A2, B1, E1, D1, Cdk2 and Cdc2 in liver tumors and adjacent non-tumor liver tissues to learn whether and how inactivation of p27 impacted their expression during tumorigenesis in this model. Figure 4A shows a representative set of samples. The most prominent findings were that Cdc2 levels were higher in all tumors and cyclin E1 levels were higher in half of the tumors in HBsAg+p27+/+ mice compared with non-tumor adjacent liver tissues and normal livers (HBsAg-p27+/+ and HBsAg-p27+/+). Levels of p27 did not show detectable changes in these same samples. Selection of cyclin E1 and Cdc2 over-expression in tumors suggests that these two proteins may play a promoting role in tumorigenesis in this model. When liver tumors of HBsAg+p27–/– mice were examined, we found the same pattern of Cdc2 and cyclin E1 over-expression. We consider this finding significant since if over-expression of cyclin E1 and Cdc2 and inactivation of p27 were all for the purpose of activating Cdk, artificial inactivation of p27 would be expected to alleviate the need for natural selection of their over-expression in tumors.


Figure 4
View larger version (54K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. Expression levels of cyclins and cyclin-dependent kinase activities in tumor and non-tumor adjacent liver tissues of HBsAg+p27+/+ and HBsAg+p27–/– mice in the 15- to 17-month age group. (A) Equal amounts of total extracts (100 µg) from the indicated tissues were Western blotted with the indicated antibodies. The numbers are mouse IDs. (B) Extracts of all available tumors in comparison with normal livers were Western blotted for cyclin E1 expression. (B-1 and B-2) The same extracts were used to perform IP-Kinase assays of Cdk2 and Cdc2 as indicated. Bar graphs represent relative kinase activity values after normalization against expression levels of Cdk2 and Cdc2 in total extracts.

 
Cdk2 or Cdc2 was highly activated in a subset of p27-deficient and cyclin E-over-expressing tumors
Since the biochemical functions of cyclin E1 and p27 in regulating Cdk2 activity positively and negatively, respectively, are well established, the conventional view is that tumor promotion by over-expression of cyclin E1 and inactivation of p27 is mediated through de-regulated Cdk2 activity. Here, we investigated whether and to what extent Cdk2 kinase was activated in tumors in relation to p27 inactivation and cyclin E1 over-expression.

Figure 4B shows the cyclin E1 protein levels and Cdk2- and Cdc2-associated kinase activities of all available liver tumors of the indicated genotypes. Cdk2-associated kinase activity after normalization against total Cdk2 protein levels in extracts is presented in a bar graph directly under the kinase gel (Figure 4B-1). These results show that Cdk2 kinase was not detectably activated in tumors in HBsAg+p27+/+ mice, regardless of whether cyclin E1 was over-expressed. In HBsAg+p27–/– tumors, high degrees of activation of Cdk2 were observed. Importantly however, only three of eight HBsAg+p27–/– tumors contained highly activated Cdk2 and these three tumors also all contained over-expressed cyclin E1. In this respect, none of the p27–/– tumors without cyclin E1 over-expression contained highly activated Cdk2. Although larger numbers of tumor samples with various status of p27 and cyclin E1 will be needed to draw a firm conclusion, these results suggest that Cdk2 could be highly activated in tumors but inactivation of p27 or over-expression of cyclin E1 was not sufficient for high-degree activation of Cdk2. Furthermore, combined cyclin E1 over-expression and p27 inactivation was still not sufficient for Cdk2 activation since only three of six such tumors contained highly activated Cdk2.

We went on to determine the activation status of Cdc2 in these same tumor extracts (Figure 4B-2). We found Cdc2 kinase activities were slightly activated above the base line in several tumors of p27+/+ or p27–/– genotypes. These small activations might have been caused by the significant increases in Cdc2 protein levels since they appeared similar after normalization to Cdc2 protein levels. Only one tumor contained highly activated Cdc2 and it also contained cyclin E1 over-expression.

These results together revealed that Cdk2 and Cdc2 could be highly activated in response to p27 inactivation and cyclin E1 over-expression but, unexpectedly, this high level of activation was not an obligatory outcome of p27 inactivation. These findings may imply that inactivation of p27 promoted tumor progression through kinase-dependent and kinase-independent mechanisms.

Activation of Cdk2 or Cdc2 by cyclins E1, A2 and other regulators in liver tumors
We next investigated the molecular mechanisms responsible for the high-level activation of Cdk2 or Cdc2 in certain p27-deficient and cyclin E1-over-expressing tumors. Cyclin E1 is a well-established cyclin partner of Cdk2. The fact that over-expression of cyclin E1 was present in all tumors with highly activated Cdk2 suggested that cyclin E1 was the activating cyclin for the activated Cdk2. Results shown in Figure 5A-1 confirmed that cyclin E1 in tumors with highly activated Cdk2 (tumor 22, 17 and 336, see Figure 4B-1) was associated with significantly high kinase activity. Cyclin A2 was not over-expressed and was not associated with activated kinase activity in these three tumors (Figure 5A-2). The best-established cyclin partners for Cdc2 is cyclins A and B, although a recent study showed that cyclin E1 could also activate Cdc2 (16). Interestingly, we found that in the tumor with highly activated Cdc2 kinase activity (tumor 520), cyclin E1 was highly over-expressed but was not associated with significant kinase activity (Figure 5A-1). In contrast, cyclin A2 was not significantly over-expressed in tumor 520 but was associated with high-level kinase activity (Figure 5A-2). Cyclin A2 in tumor 14, which contained clearly activated Cdc2 (Figure 4B-2), also contained clearly elevated kinase activity. These results provide evidence that over-expressed cyclin E1 contributed to activation of Cdk2 in p27-deficient tumors. Although not over-expressed, cyclin A2 contributed to Cdc2 activation in tumors 520 and 14.


Figure 5
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. Activation of Cdk2 and Cdc2 by cyclins and other regulators in liver tumors. (A-1 and A-2) Expression levels of cyclins E1 and A2 and their associated kinases activities in the indicated tumors. Bar graphs represent relative kinase activity values after normalization against expression levels of cyclins E1 and A2 in total extracts. (B) Measurement of Cdk2 and Cdc2 kinase activity after mixing of various extracts as indicated.

 
The fact that only a subset of tumors with p27 inactivation and cyclin E1 over-expression contained highly activated Cdk2 or Cdc2 kinase activity indicated the involvement of additional regulators for Cdk2 or Cdc2 activation in these tumors. We next used extract-mixing experiments to investigate whether kinase-active extracts contained a dominant activator or kinase-inactive extracts contained a dominant inhibitor.

For the regulation of Cdk2 kinase activation, we mixed extract 520 (no Cdk2 activation) with extract 17 (high Cdk2 activation) with a 1:1 ratio (Figure 5B, lane 4) and found that the mixed extract contained higher amount of Cdk2 kinase activity than either extracts alone (Figure 5B, lanes 2 and 3). Further, when extract 17 was mixed with a kinase-inactive extract of a p27+/+ tumor (extract 150), extract 17 was still dominant (Figure 5B, lane 5). Similarly, Cdc2-active extract (extract 520) was dominant over a Cdc2-inactive extract (extract 15) (Figure 5B, lanes 6, 7 and 8). These results suggest that, in addition to p27 inactivation and cyclin E1 over-expression, the activation of Cdk2 and Cdc2 in tumors may require activation of certain dominantly acting activators.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Since de-regulated proliferation is a hallmark of cancer, and Cdks are the engine of cell proliferation, deregulation of Cdks has been believed to play an important role in tumorigenesis (22). The actual role of a particular regulator of a particular Cdk is tissue type and oncogenic mechanism specific. In this study, we have determined the involvement of a number of key cell cycle regulators in the HBsAg+ mouse liver tumor model. Unlike most other liver tumor models, tumorigenesis in the HBsAg+ mice is not caused by an artificially defined genetic alteration in transformed hepatocytes. Rather, tumors arise among regeneratively proliferating hepatocytes undergoing multiple random and mostly undefined mutagenesis from the environment of chronic hepatocyte injury and death. This unique liver tumor model closely mimics most human liver cancers that are accompanied by chronic hepatocyte injury and regeneration (10). In this model, we found that cyclin E1 was naturally over-expressed in about half of the tumors and Cdc2 was naturally over-expressed in all the tumors. When p27 was artificially inactivated, tumor cell proliferation and progression were significantly enhanced. These results provide strong evidence that these cell cycle regulators play important roles in this liver tumor model. Thus, although targeting p27 could improve hepatocyte transplantation efficiencies, it may increase liver tumor risks if the host liver environment contains chronic hepatocyte injury, which may be applicable to most of the hepatocyte transplantation cases.

Mechanistically, de-regulated activation of Cdk2 is conventionally believed to be the downstream mechanism of tumor promotion by cyclin E1 over-expression and p27 inactivation since the biochemical functions of cyclin E1 and p27 in regulating Cdk2 are well established (23,24). However, recent reports have raised doubts on the importance of Cdk2 in cancer cells (see Introduction). Then, why is cyclin E1 over-expression a frequent event in tumors and why does p27 inactivation promote tumors? To answer these questions, it is first important to determine whether and to what extent Cdk2 is activated when tumor promotion by over-expression of cyclin E1 or inactivation of p27 is observed. Individual pituitary tumors that spontaneously developed in p27–/– mice contained only slightly elevated cyclin A/Cdk2 kinase activity, suggesting that either pituitary gland is especially sensitive to small increases in cyclin/Cdk activity or tumor promotion by p27 inactivation is independent of Cdk activity (25). In another study, using a SV40 large T antigen transgenic prostate tumor model, p27 inactivation promoted prostate tumor progression and pooled prostate cancer samples from p27–/– mice contained dramatically activated cyclin E- and cyclin A-associated kinase activity, supporting the notion that activation of Cdk is the underlying mechanism of tumor promotion by p27 inactivation in that model (26). It is important to note, however, that this study would not reveal whether the kinase was activated in all individual tumors or in only a subset of tumors since it used pooled tumor samples.

Findings reported here now revealed more detailed information about the effects of p27 inactivation on Cdk2 activation in a tumor model that closely mimics the pathogenesis of most clinical liver cancers (1117, 19). The dramatic activation of Cdk2 kinase in three of eight p27–/– tumors demonstrates that p27 inactivation could indeed facilitate Cdk2 activation, and Cdk2 in liver tissues has great potential to be activated. On this basis, our results clearly show that p27 inactivation does not necessarily lead to Cdk2 activation since five of eight p27–/– tumors do not contain significantly activated Cdk2 (Figure 4B). We further found that Cdk2-active p27–/– tumors all contained cyclin E1 over-expression, suggesting that Cdk2 activation requires synergistic action of p27 inactivation and cyclin E1 over-expression. Importantly, however, combined p27 inactivation and cyclin E1 over-expression still only led to Cdk2 activation in half of such tumors. The presence of additional activators was necessary for kinase activation. These results suggest that significant activation of Cdk2 is not the obligatory downstream mechanism of cyclin E1 over-expression and p27 inactivation when these two events are linked to enhanced tumorigenesis in this model.

One possibility for the failure to demonstrate a functional importance of Cdk2 in loss-of-function experiments is that Cdc2 may compensate for Cdk2 in its absence (see Introduction). Our studies have now provided new insights into the role of Cdc2 in tumorigenesis. Like Cdk2, Cdc2 can be dramatically activated in tumors with combined cyclin E1 over-expression and p27 inactivation, but we only found one tumor with highly activated Cdc2 (Figure 4B), which may suggest that Cdc2 plays a lesser role than Cdk2, although more tumor samples need to be studied to determine how frequent Cdc2 is activated in tumors. Although Cdc2 was dramatically activated in a tumor whose Cdk2 was not activated, four of eight p27–/– tumors contained no significant activation of Cdk2 or Cdc2.

Importantly, however, our current results cannot rule out the possibility that inactivation of p27 induced a small degree of Cdk2 or Cdc2 activation that is sufficient for tumor promotion in this model, and the in vitro kinase assay used in our experiments was not sensitive enough to detect a small degree of kinase activation. PCNA labeling indices were increased only 2- to 3-fold in p27–/– tumors compared with p27+/+ tumors, suggesting that a small increase in proliferation could result in a significant promotion of tumor progression over time. This hypothesis, however, does not explain why a subset of p27-deficient and cyclin E1-over-expressing tumors contained highly activated Cdk2 or Cdc2 kinase activity. It is possible that such high degree of kinase activation is a frequent secondary consequence of certain events in tumor progression. Consistent with this possibility, we found that kinase-active and -inactive p27–/– tumors had similar PCNA labeling indices (data not shown).

With these considerations, our current findings should raise the need to further study how cyclin E1 over-expression and p27 reduction, two frequent events in cancer, promote liver tumorigenesis induced by chronic hepatocyte injury using the HBsAg+ mouse model. Cdk-independent functions have been identified for both cyclin E1 and p27. Cyclin E1 can interact with centrosomes to promote cell proliferation independent of binding to Cdk2 in CHO cells (27). p27 can interact and inhibit RhoA to regulate cell migration of mouse embryonic fibroblasts and in human HEK 293T cells (28). Better understanding of the roles of Cdk and non-Cdk effectors in tumor promotion by cyclin E1 over-expression and p27 inactivation will be needed to guide drug discovery efforts to identify effective therapeutic targets for the treatment of cancer associated with these two changes.


    Footnotes
 
{dagger} Both authors contributed equally to this work. Back


    Acknowledgments
 
We thank Dr Steven Brunnert for performing histological diagnosis in a blind fashion. This work was supported by National Institutes of Health grant RO1DK58640. Albert Einstein Comprehensive Cancer Research Center and Liver Research Center provided core facility support. L.Z. is a recipient of the Irma T. Hirschl Career Scientist Award.

Conflict of Interest Statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Michalopoulos GK, et al. Liver regeneration. Science (1997) 276:60–66.[Abstract/Free Full Text]
  2. Karnezis AN, et al. Loss of p27(Kip1) enhances the transplantation efficiency of hepatocytes transferred into diseased livers. J. Clin. Invest. (2001) 108:383–390.[CrossRef][ISI][Medline]
  3. Yuan RH, et al. p27Kip1 inactivation provides a proliferative advantage to transplanted hepatocytes in DPPIV/Rag2 double knockout mice after repeated host liver injury. Cell Transplant. (2003) 12:907–919.[ISI][Medline]
  4. Luedde T, et al. p18(INK4c) collaborates with other CDK-inhibitory proteins in the regenerating liver. Hepatology (2003) 37:833–841.[CrossRef][ISI]
  5. Fero ML, et al. The murine gene p27Kip1 is haplo-insufficient for tumour suppression. Nature (1998) 396:177–180.[CrossRef][Medline]
  6. King TJ, et al. Deficiency in the gap junction protein connexin32 alters p27Kip1 tumor suppression and MAPK activation in a tissue-specific manner. Oncogene (2005) 24:1718–1726.[CrossRef][ISI][Medline]
  7. Tannapfel A, et al. Decreased expression of p27 protein is associated with advanced tumor stage in hepatocellular carcinoma. Int. J. Cancer (2000) 89:350–355.[CrossRef][ISI][Medline]
  8. Qin LF, et al. Expression of p27(KIP1) and p21(WAF1/CIP1) in primary hepatocellular carcinoma: clinicopathologic correlation and survival analysis. Hum. Pathol. (2001) 32:778–784.[CrossRef][ISI][Medline]
  9. Ito Y, et al. Expression and prognostic roles of the G1-S modulators in hepatocellular carcinoma: p27 independently predicts the recurrence. Hepatology (1999) 30:90–99.[CrossRef][ISI][Medline]
  10. Bruix J, et al. Focus on hepatocellular carcinoma. Cancer Cell (2004) 5:215–219.[CrossRef][ISI][Medline]
  11. Chisari FV, et al. Expression of hepatitis B virus large envelope polypeptide inhibits hepatitis B surface antigen secretion in transgenic mice. J. Virol. (1986) 60:880–887.[Abstract/Free Full Text]
  12. Chisari FV, et al. Molecular pathogenesis of hepatocellular carcinoma in hepatitis B virus transgenic mice. Cell (1989) 59:1145–1156.[CrossRef][ISI][Medline]
  13. Sherr CJ. Cancer cell cycles. Science (1996) 274:1672–1677.[Abstract/Free Full Text]
  14. Hinds PW. Cdk2 dethroned as master of S phase entry. Cancer Cell (2003) 3:305–307.[CrossRef][ISI][Medline]
  15. Tetsu O, et al. Proliferation of cancer cells despite CDK2 inhibition. Cancer Cell (2003) 3:233–245.[CrossRef][ISI][Medline]
  16. Aleem E, et al. Cdc2-cyclin E complexes regulate the G1/S phase transition. Nat. Cell Biol. (2005) 7:831–836.[CrossRef][ISI][Medline]
  17. Martin A, et al. Cdk2 is dispensable for cell cycle inhibition and tumor suppression mediated by p27(Kip1) and p21(Cip1). Cancer Cell (2005) 7:591–598.[CrossRef][ISI][Medline]
  18. Fero ML, et al. A syndrome of multiorgan hyperplasia with features of gigantism, tumorignesis, and female sterility in p27Kip1-deficient mice. Cell (1996) 85:733–744.[CrossRef][ISI][Medline]
  19. Dunsford HA, et al. Hepatocarcinogenesis due to chronic liver cell injury in hepatitis B virus transgenic mice. Cancer Res. (1990) 50:3400–3407.[Abstract/Free Full Text]
  20. Nakayama K, et al. Mice lacking p27Kip1 display incresased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors. Cell (1996) 85:707–720.[CrossRef][ISI][Medline]
  21. Kiyokawa H, et al. Enhanced growth of mice lacking the cyclin-dependent kinase inhibitor function of p27Kip1. Cell (1996) 85:721–732.[CrossRef][ISI][Medline]
  22. Malumbres M, et al. Cell cycle kinases in cancer. Curr. Opin. Genet. Dev. (2007) 17:60–65.[CrossRef][ISI][Medline]
  23. Polyak K, et al. p27Kip1, a cyclin-Cdk inhibitor, links transforming growth factor-ß and contact inhibition to cell cycle arrest. Genes Dev. (1994) 8:9–22.[Abstract/Free Full Text]
  24. Toyoshima H, et al. p27, a novel inhibitor of G1 cyclin-cdk protein kinase activity, is related to p21. Cell (1994) 78:67–74.[CrossRef][ISI][Medline]
  25. Chien WM, et al. Genetic mosaics reveal both cell-autonomous and cell-nonautonomous function of murine p27Kip1. Proc. Natl. Acad. Sci. USA (2006) 103:4122–4127.[Abstract/Free Full Text]
  26. Shaffer DR, et al. Evidence for a p27 tumor suppressive function independent of its role regulating cell proliferation in the prostate. Proc. Natl. Acad. Sci. USA (2005) 102:210–215.[Abstract/Free Full Text]
  27. Matsumoto Y, et al. A centrosomal localization signal in cyclin E required for Cdk2-independent S phase entry. Science (2004) 306:885–888.[Abstract/Free Full Text]
  28. Besson A, et al. p27Kip1 modulates cell migration through the regulation of RhoA activation. Genes Dev. (2004) 18:862–876.[Abstract/Free Full Text]
Received November 28, 2006; revised March 30, 2007; accepted April 2, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
28/9/1859    most recent
bgm079v2
bgm079v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sun, D.
Right arrow Articles by Zhu, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, D.
Right arrow Articles by Zhu, L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?