Skip Navigation


Carcinogenesis Advance Access originally published online on July 18, 2007
Carcinogenesis 2007 28(9):1928-1936; doi:10.1093/carcin/bgm126
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
28/9/1928    most recent
bgm126v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Google Scholar
Right arrow Articles by Lee, K.-W.
Right arrow Articles by Lee, K.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, K.-W.
Right arrow Articles by Lee, K.-T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oxfordjournals.org

Acteoside inhibits human promyelocytic HL-60 leukemia cell proliferation via inducing cell cycle arrest at G0/G1 phase and differentiation into monocyte

Kyung-Won Lee, Hyoung Ja Kim1, Yong Sup Lee, Hee-Jun Park2, Jong-Won Choi3, Joohun Ha4 and Kyung-Tae Lee4,*

Department of Pharmaceutical Biochemistry, College of Pharmacy, Kyung-Hee University, Hoegi-Dong, Seoul 130-701, Korea
1 Life Sciences Division, Korea Institute of Science and Technology PO Box 131, Seoul 130-650 Korea
2 Division of Applied Plant Sciences, Sang-Ji University, Woosan-Dong, Wonju 220-702, Korea
3 College of Pharmacy, Kyungsung University, Dayeon-Dong, Pusan, 608-736, Korea
4 College of Medicine, Kyung Hee University, Hoegi-Dong, Seoul 130-701, Korea

* To whom correspondence should be addressed. Tel: +82 2 961 0860; Fax: +82 2 962 0860; Email: ktlee{at}khu.ac.kr


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
We investigated the in vitro effects of acteoside on the proliferation, cell cycle regulation and differentiation of HL-60 human promyelocytic leukemia cells. Acteoside inhibited the proliferation of HL-60 cells in a concentration- and time-dependent manner with an IC50, ~30 µM. DNA flow cytometric analysis indicated that acteoside blocked cell cycle progression at the G1 phase in HL-60 human promyelocytic leukemia cells. Among the G1 phase cell cycle-related proteins, the levels of cyclin-dependent protein kinase (CDK)2, CDK6, cyclin D1, cyclin D2, cyclin D3 and cyclin E were reduced by acteoside, whereas the steady-state level of CDK4 was unaffected. The protein and mRNA levels of CDK inhibitors (cyclin-dependent kinase inhibitors), such as p21CIP1/WAF1 and p27KIP1, were gradually increased after acteoside treatment in a time-dependent manner. In addition, acteoside markedly enhanced the binding of p21CIP1/WAF1 and p27KIP1 to CDK4 and CDK6, resulting in the reduction of CDK2, CDK4 and CDK6 activities. Moreover, the hypophosphorylated form of retinoblastoma increased, leading to the enhanced binding of protein retinoblastoma (pRb) and E2F1. Our results further suggest that acteoside is a potent inducer of differentiation of HL-60 cells based on biochemical activities and the expression level of CD14 cell surface antigen. In conclusion, the onset of acteoside-induced G1 arrest of HL-60 cells prior to the differentiation appears to be tightly linked to up-regulation of the p21CIP1/WAF1 and p27KIP1 levels and decreases in the CDK2, CDK4 and CDK6 activities. These findings, for the first time, reveal the mechanism underlying the anti-proliferative effect of acteoside on human promyelocytic HL-60 cells.

Abbreviations: CDK, cyclin-dependent protein kinase; CKI, cyclin-dependent kinase inhibitor; DMSO, dimethyl sulfoxide; DTT, dithiothreitol; NBT, nitroblue tetrazolium; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; Rb, retinoblastoma; SDS, sodium dodecyl sulfate; TGF-ß, transforming growth factor-ß


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Cancers are characterized by three major clonal cellular disorders, cell differentiation arrest (i.e. the presence of immature cells), an inhibition of apoptosis (the accumulation of cells) and accelerated multiplication (proliferation). Cell proliferation in vivo and in vitro can be regulated by the coupling of growth arrest and cell differentiation (1,2). It is not surprising that the de-regulation of the cell cycle is one of the most frequent alterations during tumor development (3). Therefore, blockade of the cell cycle is regarded as an effective strategy for eliminating cancer cells (4,5).

Cell cycle progression is a highly ordered and tightly regulated process that involves multiple checkpoints, at which extracellular growth signals, cell size and DNA integrity are assessed. The cyclin-dependent protein kinases (CDKs) are the major regulators of the cell cycle, and these are regulated by multiple mechanisms (6,7). CDKs bind to and are activated by various cyclin regulatory subunits, and the synthesis and the ubiquitin-mediated destruction of cyclins are closely associated with cell cycle progression, and confine the activities of CDKs to appropriate cell cycle compartments. Also, CDKs are phosphorylated by cyclin-activating kinase, a phosphorylation event that allows subsequent CDK phosphorylations by a variety of protein kinases, which may either activate or inhibit CDK activity (8). Finally, the activities of cyclin–CDK complexes are carefully regulated by two families of CDK inhibitors. While members of the INK4 family (p16INK4A, p15 INK4B, p18INK4C and p19INK4D) interact specifically with CDK4 and CDK6, the CIP/KIP family (p21CIP1/WAF1, p27KIP1 and p57KIP2) inhibit a broader spectrum of CDKs. These cyclin-dependent kinase inhibitors (CKIs), especially p21CIP1/WAF1 and p27KIP1, which bind to cyclin–CDK complexes, render these complexes inactive (9). This multiplicity of regulatory mechanisms allows cell cycle progression to be responsive to a variety array of external and internal factors, and prevents cell cycle progression during periods when DNA damage or other cellular conditions would make such progression harmful to the cell. CKIs that act as brakes to stop cell cycle progression in response to regulatory signals are important negative regulators (10).

The transition from the G1 to the S phase is initiated by the expression of D-type cyclins and by their assembly into kinase complexes with CDK4 and CDK6 (11). The most recognized function of cyclin D-dependent kinases is the inactivation of tumor suppressor protein Rb (retinoblastoma). The initial phosphorylation of Rb by cyclin D–CDK4 complexes in mid-G1 negates the ability of Rb to repress transcription and results in increased cyclin E expression, the regulatory partner for CDK2. Subsequently, cyclin E–CDK2 complexes phosphorylate pRb on additional sites, causing the release of free E2F and the activated transcription of genes required for S-phase entry, including cyclin A.

The growth and differentiation of hematopoietic cells are regulated by a number of cytokines, in vitro and in vivo. HL-60, a human promyelocytic cell line, has been extensively used as an in vitro model for studying the effects of factors that regulate growth and differentiation of hematopoietic cells in general and of myeloid leukemia cells in particular (12). These cells proliferate as promyelocytes, yet retain the capacity to undergo terminal myeloid or monocytic differentiation in response to various inducing agents. In the presence of all-trans-retinoic acid, HL-60 cells undergo differentiation to granulocytes, whereas 1{alpha},25(OH)2-vitamin D3 and 12-O-tetradecanoylphorbol-13-acetate induce differentiation into monocytes/macrophages (13). Transforming growth factor-ß (TGF-ß), known to be a negative regulator of growth at all stages of hematopoiesis (14,15), induces differentiation of HL-60 cells to promonocytes, and has been shown to act synergistically with vitamin D3, tumor necrosis factor or the combination of all-trans-retinoic acid plus tumor necrosis factor to induce monocytic differentiation of several other myeloid leukemic cell lines (16,17). Other studies showing that induction of terminal differentiation by retinoids and vitamin D3 requires TGF-ß1 as an autocrine mediator suggest that endogenous TGF-ß1 plays a critical role in the differentiation of leukemia cells (18,19).

Various plants used in traditional medicines contain significant amounts of phenylpropanoids (20). For example, acteoside [2-(3,4-dihydroxyphenylethyl)-1-O-{alpha}-L-rhamnopyranosyl-(1 -> 3)-ß-D-(4-O-caffeyl)-glucopyranoside] is a phenylpropanoid glycoside that is widely distributed in plants (21). Several studies have shown that acteoside has various biological activities such as antioxidant activity (22,23), ability to modulate nitric oxide production (24,25) and cytotoxicity against various tumor cells (2628). However, the mechanisms by which acteoside induces cell cycle arrest and differentiation in cancer cells have not been established. Thus, as a part of our screening program to evaluate the chemopreventive potential effect of natural compounds, we examined the cytotoxic effects of acteoside and of its related phenylpropanoids on the various tumor cells. The cytotoxicity data obtained indicates that acteoside was the most effective among the phenylpropanoids examined. Here, we report the effects of acteoside on the proliferation, cell cycle regulation and differentiation of human leukemia HL-60 cells.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Materials
The acteoside and other phenylglycosides used in this study were isolated from the stems of Clerodendron trichotomum (Verbenaceae) and Fraxinus sieboldiana var. angustata (Oleaceae) and structural identities were determined spectroscopically (1H and 13Nuclear Magnetic Resonance (NMR), Infrared (IR), Mass (MS)) as described previously (29,30). These compounds isolated were checked by high-performance liquid chromatography and were found to be >98% pure.

Cell culture and MTT assay
3LL Lewis mouse lung carcinoma, U-937 human histocytic lymphoma, HL-60 human promyelocytic leukemia, SNU-C5 human colon cancer and HepG2 human hepatoma cell lines were obtained from the Korean Cell Line Bank. The cells were cultured in RPMI 1640 medium (Life technologies, Grand Island, NY) with 10% fetal bovine serum in a 37°C, CO2 incubator in the presence or absence of the chemicals. The cytotoxicity was measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tertazolium bromide (MTT) assay. Briefly, the cells (5 x 104) were seeded in each well containing 100 µl of the RPMI medium supplemented with 10% fetal bovine serum in a 96-well plate. After 24 h, various concentrations of phenylglycosides were added. After 48 h, 50 µl of MTT (5 mg/ml stock solution, Sigma, St Louis, MO) was added and the plates were incubated for an additional 4 h. The medium was discarded and the formazan blue, which was formed in the cells, was dissolved with 100 µl dimethyl sulfoxide (DMSO). The optical density was measured at 540 nm.

Growth inhibition assay
The in vitro growth inhibition effect of acteoside on the HL-60 cells was determined by trypan blue dye exclusion. The reduction in viable cell number was assessed for each 4 days. HL-60 cells were grown at 37oC in RPMI medium supplemented with 10% fetal bovine serum, penicillin (100 U/ml) and streptomycin sulfate (100 µg/ml) in a humidified atmosphere of 5% CO2. Cells were seeded at a concentration of 2 x 105 cells per ml and were maintained for logarithmic growth by passaging them every 2–4 days and incubated for 1–4 days with acteoside at various concentrations. Acteoside dissolved in DMSO was added to the medium in serial dilution (the final DMSO concentration in all assays did not exceeded 0.1%). Cells were loaded on a hemocytometer, and viable cell number was determined based on exclusion of trypan blue dye.

Flow cytometric cell cycle analysis
HL-60 cells were treated without or with acteoside for 96 h, and then re-suspended in 1 ml phosphate-buffered saline (PBS), fixed in 70% ice-cold ethanol and kept in a freezer overnight. The fixed cells were centrifuged, washed once in PBS and re-suspended in 100 µl of a phosphate–citrate buffer for 30 min at room temperature to wash out any degraded DNA from the apoptotic cells. The cells were then collected by centrifugation at 2000 r.p.m., and the cell pellets were washed twice with PBS and re-suspended in PBS containing 50 mg/ml propidium iodide and 100 µg/ml DNase-free RNase A. The cell suspension, which was hidden from light, was incubated for 30 min at 37°C and analyzed using the fluorescence-activated cell sorting cater-plus Flow cytometry (Becton Dickinson Co, Heidelberg, Germany).

Western blot analysis
Samples containing 30 µg of the total proteins were resolved by a 12% sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis, gel transferred onto a nitrocellulose membrane by electroblotting, and were then probed with anti-CDK2(M2), anti-CDK4(C-22), anti-CDK6(B-10), anti-cyclin D1(R-124), anti-cyclin D2(M-20), anti-cyclin D3(D-7), anti-cyclin E(M-20), anti-p21(187), anti-p27(F-8), anti-Rb, anti-E2F1(KH95), anti-ß-actin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-Smad2/3, anti-phospho-Smad2 (Ser465/467) and anti-phospho-Smad3 (Ser423/425) antibodies (Cell signaling technology, San Diego, CA). The blots were developed using an enhanced chemiluminescence kit (Amersham Bioscience, Uppsala, Sweden).

Immunoprecipitation
Samples of the total protein (100 µg) were incubated with the anti-CDK2, anti-CDK4 and anti-CDK6 polyclonal antibodies for 2 h at 4°C, followed by incubation with 20 µl of the protein A/G-Sepharose beads (Sigma) for 1 h. The protein complexes were washed four times with an immunoprecipitation buffer [50 mM Tris–HCl, pH 7.4, 0.5% Nonidet P-40, 150 mM NaCl, 50 mM NaF, 0.2 mM sodium orthovanadate, 1 mM dithiothreitol (DTT), 20 µg/ml aprotinin, 20 µg/ml leupeptin and 1 mM phenylmethylsulfonyl fluoride], and released from the beads by boiling in 2x SDS sample buffer (125 mM Tris–HCl, pH 6.8, 4% SDS, 10% ß-mercaptoethanol, 2% glycerol and 0.02% bromophenolblue) for 5 min; the reaction mixture was then resolved by a 12% SDS–polyacrylamide gel electrophoresis gel, transferred onto a nitrocellulose membrane by electroblotting and probed with antibodies. The blot was developed using an enhanced chemiluminescence kit.

Kinase activity assay
The total lysates (500 µg protein) were prepared and immunoprecipitated with 5 µg each of anti-CDK2, anti-CDK4 and anti-CDK6 polyclonal antibodies as described above. Fifty microliter of protein A-Sepharose CL-4B (Amersham Bioscience) prepared at 6 mg/ml in 0.1 M potassium phosphate buffer (pH 8.0) was added to each sample and incubated for 18 h at 4°C. Immunocomplexes were recovered by centrifugation for 30 s at 14 000g and washed three times in a lysis buffer. The immunocomplexes were then re-suspended and washed three times with a kinase buffer (50 mM Tris–HCl, pH 7.4, 1 mM DTT, 10 mM MgCl2, 2.5 mM ethylenediaminetetraacetic acid, 10 mM ß-glycerophosphate and 1 mM NaF for CDK4; 50 mM Tris–HCl, pH 7.4, 1 mM DTT and 10 mM MgCl2 for CDK2). The kinase reactions were carried out in a final volume of 40 µl containing 20 µM ATP, 25 µCi [{gamma}-32 P]ATP, 2 µg histone H1 for CDK2 or 1 µg glutathione S-transferase (GST)-Rb for CDK4 and CDK6. The reactions were performed for 20 min at 30°C and quenched by adding an equal volume of a 2x SDS loading buffer. After boiling for 10 min, the reaction products were separated by 12% SDS–polyacrylamide gel electrophoresis gel and the phosphorylated proteins were detected by autoradiography.

Reverse transcription–polymerase chain reaction of p21CIP1/WAF1 and p27KIP1
The total cellular RNA was isolated using Easy Blue® kits according to the manufacturer's instructions (iNtRON Biotechnology, Seoul, Korea). From each sample, 1 µg of RNA was reverse transcribed using a MuLV reverse transcriptase (Takara Biomedicals, Shiga, Japan), 1 mM deoxyribonucleoside triphosphates and 0.5 µg/µl of oligo (dT12–18) (Bioneer, Seoul, Korea). The polymerase chain reaction (PCR) analyses were then performed on the aliquots of the cDNA preparations to detect the p21, p27 and ß-actin gene expression using a thermal cycler (Perkin Elmer Cetus, Foster City, CA). The reactions were carried out in a volume of 25 µl containing (final concentration) 2 U of Taq DNA polymerase, 0.2 mM deoxyribonucleoside triphosphate, x10 reaction buffer and 100 pmol of 5' and 3' primers. For p21 amplification, the PCR primers were 5' to 3' AGGAGGCCCGTGAGCGATGGAAC and ACAAGTGGGGAGGAGGAAGTAGC (Bioneer). The denaturation cycle 94oC: 5 min was followed to 30 cycles at 94oC: 30 s, 60oC: 30 s, 72oC: 30 s and an elongation cycle 72oC: 5 min. For p27 amplification, the PCR primers were 5' to 3' CCGGCTAACTCTGAGGACAC and AGAAGAATCGTCGGTTGCAG. The denaturation cycle 95°C: 5 min was followed to 35 cycles at 95°C: 45 s, 60°C: 45 s, 72°C: 1 min and an elongation cycle 72°C: 5 min. For ß-actin amplification, the PCR primers were 5' to 3' GATATCGCCGCGCTCGTCGTCGAG and CAGGAAGGAAGGCTGGAAGAGTGC (Bioneer). The denaturation cycle 95°C: 5 min was followed to 35 cycles at 95°C: 45 s, 60°C: 45 s, 72°C: 1 min and an elongation cycle 72°C: 5 min. The PCR products were analyzed by 2.5% agarose gel electrophoresis and visualized by ethidium bromide staining and Ultraviolet irradiation.

Electrophoretic mobility shift assays
Cells were incubated with or without 30 µM acteoside, and the cells (1 x 107) were washed twice with ice-cold PBS and pelleted. The cell pellet was re-suspended in hypotonic buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM ethylenediaminetetraacetic acid, 0.1 mM ethyleneglycol-bis(aminoethylether)-tetraacetic acid, 1 mM DTT, 0.5 mM phenylmethylsulphonyl fluoride, 1 mM NaF and 1 mM Na3VO4) and incubated on ice for 15 min. Then the cells were lysed by the addition of 0.5% Nonidet P-40 and vigorous vortexing for 10 s. The nuclei were pelleted by centrifugation at 12 000g for 30 s at 4°C and re-suspended in extraction buffer (20 mM HEPES, pH 7.9, 400 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 1 mM ethyleneglycol-bis(aminoethylether)-tetraacetic acid, 1 mM DTT, 1 mM NaF and 1 mM Na3VO4). After 15 min on ice, lysates were centrifuged at 12 000g for 10 min at 4°C. Supernatants were obtained and stored at –70°C. The oligonucleotide sequence 5'-TCAGAGGCTTGGCGGGAAAAAGAACGGAGG-3', corresponding to the E2F binding site of the c-myc P2 promoter, was synthesized. The DNA-binding activity was separated from free probe using a 5% polyacrylamide gel at 100 V in 0.5x Tris-Borate-EDTA (TBE) buffer. The gel was dried for 1 h at 80°C and subjected to autoradiography.

Differentiation assay
(i) Nitroblue tetrazolium (NBT) reduction test: the percentage of HL-60 cells capable of reducing NBT was measured by counting the number of cells containing the precipitated formazan particles after the cells had been incubated with the NBT (1.0 mg/ml) at 37°C for 30 min. 12-O-Tetradecanoylphorbol-13-acetate was used to stimulate the formation of formazan. (ii) Phagocytosis test: the HL-60 cells (1 x 106 cells per ml) were suspended in serum-free RPMI 1640 medium containing 0.2% of the latex particles (average diameter, 0.81 µM) and incubated at 37°C for 4 h. After incubation, the cells were washed once with PBS. The cells containing >10 latex particles were scored as being phagocytic cells (31). (iii) Esterase activity test: a smear preparation was chemically stained for {alpha}-naphthyl acetate esterase and naphthol AS-D chloroacetate esterase using the standard techniques (31). (iv) Flow cytometry: the HL-60 cells (2 x 105 cells per ml) exposed to acteoside were collected and washed twice with ice-cold PBS. The cells were then incubated with the direct fluorescein isothiocyanate-labeled anti-CD 14 or anti-CD 66b antibodies (Pharmingen, San Diego, CA) on ice for 30 min, washed twice with PBS, and the level of antibody binding to the cells was quantified using fluorescence-activated cell sorting flow cytometry (Becton Dickinson Co).

Analysis of TGF-ß1 mRNA levels
Total RNA was extracted with Easy Blue® kits according to the manufacturer's instructions (iNtRON Biotechnology). TGF-ß1 mRNA expression in cells was measured with Quantikine mRNA ELISA according to the manufacturer's (R&D Systems, Minneapolis, MN) protocol.

Densitometric scanning and data analysis
The intensity of the immunoreactive bands was determined using a densitometer (Bio-Rad, Hercules, CA). Statistical significance of differences between control and treated samples were calculated by Student's t-test (SigmaStat 2.03). P < 0.05 was considered significant. All the experiments were done at least three times, each time with three or more independent observations.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Several phenylpropanoid glycosides inhibit cell proliferation
Previous studies have shown that phenylpropanoids are potent anti-proliferative (26) and anticancer agents (27,28). Here, we investigated the anti-proliferative effects of seven structurally related phenylpropanoid glycosides isolated from the stems of C.trichotomum (Verbenaceae); (i) acteoside, (ii) isoacteoside, (iii) isomartynoside, (iv) martynoside and (v) leucosceptoside A and from the stems of F.sieboldiana var. angustata (Oleaceae); (vi) calceolarioside B and (vii) calceolarioside A. The structures of these phenylpropanoid glycosides are illustrated in Figure 1. To assess the inhibitory effects of these phenylpropanoid glycosides on cancer cell growth, we first determined the cytotoxicities of these compounds using a MTT assay. As shown in Table I, the phenylpropanoid glycosides showed varying degrees of cytotoxicity, as assessed using their IC50 values. Isoacteoside and leucosceptoside A showed dose-dependent cytotoxic effects on various cancer cells, but their cytotoxicities were lower than that of acteoside. Among the tested cancer cell lines, HL-60 cells showed the most cytotoxicity in response to acteoside. We examined the effect of acteoside on HL-60 proliferation by trypan blue exclusion test. Exponentially growing HL-60 cultures rapidly underwent growth inhibition with the addition of various concentrations of acteoside, as evidenced by a decrease of cell proliferation over the experimental period (Figure 2). This inhibitory effect became apparent at a concentration of 30 µM acteoside, and no cytocidal effects were observed under this condition. Therefore, this concentration was used throughout the study.


View this table:
[in this window]
[in a new window]

 
Table I. Cytotoxic activity of different phenylglycosides on cancer cell growth in vitro

 


Figure 1
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Chemical structures of the various phenylpropanoids.

 


Figure 2
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Growth inhibitory effects of acteoside on HL-60 cells. Exponentially growing cells were treated with the indicated concentrations of acteoside for 96 h (–, control; open square, 10 µM; closed square, 20 µM; closed triangle, 30 µM; closed circle, 40 µM). Cell growth inhibition was assessed by a trypan blue exclusion test as described in Materials and Methods. The growth of the HL-60 cells was significantly inhibited by acteoside in a dose-dependent manner. The data shown represent the mean ± SD of three independent experiments.

 
Acteoside induces G1 cell cycle arrest in HL-60 cells
As acteoside induces significant growth inhibition of human leukemia HL-60 cells (Figure 2), we further examined the precise effect of acteoside on the cell cycle of HL-60 cells, using flow cytometry (Figure 3A). When cells were treated with 30 µM acteoside for 48 h, the cell cycle arrest at G1 phase was evident, accompanying a decrease in S and G2/M phase when compared with the untreated control cells. This result suggests that the growth inhibitory effect of acteoside was the result of a block of cell cycle at G1 phase. In addition, this cell cycle arrest induced by acteoside occurred in a time-dependent manner (Figure 3B).


Figure 3
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. DNA Fluorescence flow cytometry histograms of HL-60 cells treated with or without acteoside for 48 h. Cell cycle analysis was performed as described in Material and Methods. (A) The cells were exposed to acteoside at 30 µM for 48 h, washed and then harvested. The cells were then fixed and stained with propidium iodide and DNA contents were analyzed by flow cytometry (fluorescence-activated cell sorting). (B) The percentages of each phase of the cell cycle were calculated during the time course of acteoside treatment (open square, Sub-G1 phase; closed square, G1 phase; closed triangle, S phase; closed circle, G2/M phase).

 
Effects of acteoside on the expressions of cell cycle regulatory proteins in HL-60 cells
It is well known that CDK2, CDK4/6, cyclin D and cyclin E cooperate to promote G1-phase progression. We first determined whether acteoside affected the expression of these G1-related proteins in cells treated with 30 µM acteoside for 96 h. Under this condition, acteoside down-regulated CDK2, CDK6, cyclin D1, cyclin D2, cyclin D3 and cyclin E protein levels, whereas CDK4 was unaffected (Figure 4). CKIs are well known to interfere with cell cycle progression to cause phase-specific cycle arrest (32,33). These kinase inhibitors perturb the phosphorylation process by interacting directly with their target proteins, i.e. cyclins or CDKs. The protein levels of certain CKI family members, crucially required for the regulation of G1-phase progression, were determined by western blot analysis (Figure 5). The related CDK inhibitor p21CIP1/WAF1 became detectable after 24 h and increased further at 96 h. The related CDK inhibitor p27KIP1 was also increased ~7-fold at 72 h. In accordance with observed protein levels, the mRNA levels of p21CIP1/WAF1 and p27KIP1 were also found to increase in a time-dependent manner, as evaluated by the semi-quantitative reverse transcriptase–PCR (Figure 5B). Therefore, these results indicate that the inhibitory effect of acteoside on cell proliferation is a result of the induction of the G1 phase arrest of the HL-60 cell cycle through changes in the expressions of G1 phase regulatory proteins.


Figure 4
View larger version (44K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. The effects of acteoside on the protein levels of cell cycle regulators in HL-60 cells. Protein extracts were harvested from HL-60 cells exposed to 30 µM acteoside for the indicated times and subjected to western blot analysis using the specific antibodies for the cell cycle-related proteins. The experiments were repeated three times with similar results. All results are presented as n-fold of the expression levels respect to non-treated cells.

 


Figure 5
View larger version (42K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. The effects of acteoside on p21CIP1/WAF1 and p27KIP1 expressions in HL-60 cells. (A) Protein levels of p21CIP1/WAF1 and p27KIP1. Cells were harvested at the indicated times after incubation with 30 µM acteoside. Cell lysis and western blot were performed as described in Material and Methods. All results are presented as n-fold of the expression levels respect to non-treated cells. All results are presented as n-fold of the expression levels respect to non-treated cells. (B) The effects of acteoside on p21CIP1/WAF1 and p27KIP1 mRNA expressions. Total RNA extraction and the reverse transcription PCR of p21CIP1/WAF1 and p27KIP1 or ß-actin were performed as described in Materials and Methods.

 
Effect of acteoside on the p21CIP/WAF1 and p27KIP1 levels of the CDK immune complex and on the CDK-associated kinase activity
Next, we questioned whether or not acteoside-induced p21CIP1/WAF1 and p27KIP1 would be detected in the complexes with the CDKs. Thus, CDK2, CDK4 and CDK6 complexes were immunoprecipitated from HL-60 cells, which were either treated or not treated with acteoside, and the levels of coimmunoprecipitated p21CIP1/WAF1 and p27KIP1 in each immune complex were determined by western blot analysis using anti-p21 or anti-p27 antibodies. As shown in Figure 6A, the levels of p21CIP1/WAF1 and p27KIP1 in the CDK4 and CDK6 immune complexes of acteoside-treated cells were distinctly higher than in those of the untreated cells. However, there was essentially no difference in the p21CIP1/WAF1 and p27KIP1 levels of the CDK2 immune complex regardless of the acteoside treatment. Since the increased binding of CKIs to CDK complexes subsequently reduces the kinase activity of CDK-cyclin complex, we next investigated the effect of acteoside on in vitro kinase activities, which were directly measured by forming an immune complex with histone H1 (for CDK2) or with GST–Rb fusion protein (for CDK4 or CDK6). As shown in Figure 6B, HL-60 treated with acteoside at 30 µM for 96 h strongly reduced the histone H1-associated kinase activities of CDK2 and Rb-associated kinase activities of CDK4 and CDK6 in response to acteoside treatment. We further found that decreased CDK2 activity was absolutely caused by the reduction of CDK2 protein levels instead of decreased binding of CKIs to CDK2 complexes. Collectively, these results suggest that p21CIP1/WAF1 and p27KIP1 proteins might play a key role in G1 phase arrest though their increased binding to CDK4 and CDK6 in the acteoside-treated HL-60 cells, which leads to the down-regulation of the kinase activities of CDK4 and CDK6 and hence to cell cycle arrest.


Figure 6
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. Inhibition of CDKs in HL-60 cells exposed to acteoside. (A) CKI (p21CIP1/WAF1 and p27KIP1)-CDKs association after acteoside treatment. The cells were incubated with or without 30 µM acteoside for 96 h. Cell lysates were immunoprecipitated with anti-CDK2, anti-CDK4 or anti-CDK6 antibodies and immunoprecipitates were collected. These immunoprecipitated proteins were separated in 12% SDS-polyacrylamide gels, transferred to nitrocellulose membranes and probed with anti-21 or anti-p27 antibodies. The proteins were detected by enhanced chemiluminescence. (IP: immunoprecipitation, WT: western). (B) The kinase activities of CDKs after acteoside exposure. Total cell lysates from the control cells and the cells that were treated with acteoside at a dose of 30 µM for 96 h were immunoprecipitated with anti-CDK2, anti-CDK4 or anti-CDK6 antibodies. Kinase activities were assayed using histone H1 (for CDK2) and Rb (for CDK4 and CDK6) as substrates.

 
Acteoside increases the hypophosphorylated levels of pRb and E2F1–DNA binding
Considering that pRb is one of the most relevant targets of CDKs (34), we evaluated the degree of phosphorylation of this tumor suppressor protein in western blot, by using whole extracts from the control or acteoside-treated cells. In HL-60 control cells, pRb was almost completely hyperphosphorylated, whereas in 30 µM acteoside-treated cells, a progressive loss of phosphate groups was evident after 48 h, as indicated by a change in the mobility of pRb immunoreactive bands (Figure 7A). To examine whether acteoside treatment can affect the amount of complex formed by Rb with E2F1, we performed immunoprecipitation with anti-Rb antibody followed by western blot using anti-E2F1 antibody. Rb/E2F1 complex was markedly increased after acteoside treatment compared with control (Figure 7B). Next, we examined the effects of acteoside on E2F1–DNA-binding capacity by performing electrophoretic mobility shift assay using an oligonucleotide harboring a consensus E2F1-binding element, and found that acteoside treatment caused a time-dependent reduction in E2F1–DNA-binding capacity in HL-60 cells (Figure 7C). This observation seems to reflect an increase in Rb-E2F1-binding due to Rb hypophosphorylation, and a subsequent decrease in E2F1–DNA-binding capacity in acteoside-treated HL-60 cells.


Figure 7
View larger version (44K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7. Hypophosphorylation of Rb and the effect of acteoside on the DNA-binding capacity of E2F1 in HL-60 cells. (A) Total cell lysates were prepared and separated by 8% SDS-polyacrylamide gel. Western blot analysis was performed using anti-Rb antibody. (B) The association of Rb and E2F1 in HL-60 cells after acteoside treatment. The untreated cells and acteoside-treated cells were harvested for 96 h. Whole-cell lysates from the control cells and the cells that were treated with acteoside were immunoprecipitated with an anti-Rb antibody. Immunocomplexes were separated by 8% SDS-polyacrylamide gel electrophoresis, transferred to a nitrocellulose membrane and probed with an anti-E2F1 antibody. Proteins were detected by enhanced chemiluminescence. (C) Electrophoretic mobility shift assays were performed using the E2F1-specific DNA-binding site (see Materials and Methods). The band indicated by the arrow is that of the E2F1–DNA complex.

 
Effect of acteoside on differentiation of HL-60 cells
In order to determine whether growth inhibition via cell cycle arrest by acteoside is associated with terminal differentiation, we performed a NBT reduction test, and measured esterase activity, phagocytic activity and CD14 and CD66b surface antigen expressions of acteoside-treated HL-60 cells. Treatment with acteoside for 96 h demonstrated in a progressive increase in the proportion of NBT-stained cells in a time-dependent manner (Figure 8A). More than 40% of cells were NBT reducible at the end of this treatment period, and this effect was comparable with that of 1{alpha},25(OH)2D3 (20 nM), which is a known potent inducer of HL-60 cell differentiation. In order to test whether acteoside induces HL-60 cells to differentiate into monocytes/macrophages or granulocytes, esterase activities were measured under identical conditions. Treatment of HL-60 cells with 30 µM acteoside resulted in a time-dependent increase in {alpha}-naphthyl acetate esterase activity, but the effect of acteoside on naphthyl AS-D chloroacetate esterase activity was relatively small (Figure 8B). Moreover, cells treated with acteoside also showed an apparent increase in phagocytic activity (Figure 8C). In addition, 30 µM acteoside significantly increased the expression of membrane antigen CD14, whereas it did not show any influence on the expression of CD66b (Figure 8D). These results indicate that acteoside induces differentiation of human promyelocytic leukemia cells to monocyte/macrophage lineage.


Figure 8
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 8. The differentiation-inducing effect of 30 µM acteoside. (A) Acteoside-induced differentiation of HL-60 cells. NBT-reducible cells were detected by NBT reduction test as described in Materials and Methods. (B) Differentiation of HL-60 cells by acteoside. Two hundred cells were scored and index of esterase activity was presented as the percentage of cells scored positively. (C) Commitment of HL-60 cells to the monocytic lineage after acteoside treatment. (D) Fluorescence-activated cell sorting analysis of the expressions of CD14 and CD66b antigens in HL-60 cells treated with or without 30 µM acteoside for 96 h. The data shown represent the means ± SDs of three independent experiments. *P < 0.05 versus the control group; significances between treated groups were determined using the Student's t-test.

 
Acteoside increased TGF-ß1 mRNA expression and phosphorylation of Smad2/3 in HL-60 cells
TGF-ß1 belong to a family of growth factors that regulate essential functions such as proliferation, differentiation, cellular senescence and apoptosis. Therefore, the effect of acteoside on TGF-ß1 expression was examined. Immunoassay analyses revealed that acteoside dose-dependently stimulated TGF-ß1 mRNA level in human leukemia HL-60 (Figure 9A). To further confirm acteoside-mediated growth inhibition involving TGF-ß1/Smad signaling, we performed western blot to explore critical molecular changes of this pathway. Acteoside produced a significant increase in phosphorylation of Smad2/3 in a time-dependent manner (Figure 9B). These data suggested that acteoside activates TGF-ß1 production and phosphorylate Smad proteins in HL-60 cells.


Figure 9
View larger version (40K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 9. Expression of TGF-ß1 mRNA and Smad 2/3, phospho-Smad2 and phospho-Smad3 by acteoside. (A) HL-60 cells were cultured with or without acteoside 30 µM. Total RNA was isolated and aliquots of RNA (2 µg) at different times were assayed for TGF-ß1 mRNA. The data shown represent the means ± SD of 3 independent experiments. *p<0.05 vs the control group; significances between treated groups were determined using the Student's t-test. (B) Cells were treated with acteoside (30 µM) for up to 96 h, and the protein expression of the Smad2/3, phospho-Smad2 and phospho-Smad3 were observed by western blot analysis using specific antibodies. Experiments were repeated three times with similar results. All results are presented as n-fold of the expression levels respect to non-treated cells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
The phenylpropanoid glycosides, natural polyphenol constituents of plants, are widely found in many dicotyledon families. Several phenylpropanoid glycosides have been shown to have a wide range of biological activities, including antioxidant (22,23) and antitumor effects (27). The results of the present study using seven phenylpropanoid glycosides isolated from the stems of C.trichotomum and F.sieboldiana var. angustata demonstrate that phenylpropanoids possess a wide range of activities, and that these depend on the natures of the substituents attached to the glucose backbone. In the present study, acteoside and isoacteoside, which have two catechol moieties and one rhamnose group, were found to be potently cytotoxic to various cancer cells (Table I), suggesting that caffeoyl substituents on the glucose ring of the phenylpropanoid structure are crucial for cytotoxicity. Moreover, the cytotoxicity of leucosceptoside A was approximately a half that of the acteoside derivatives, thus implying that the number of catechol moieties is also an important cytotoxic feature. Consistent with this trend, martynoside and isomartynoside, which have no catechol moiety, showed no cytotoxic effect at <150 µM. On the other hand, calceolarioside A and B were slightly less cytotoxic than leucosceptoside A, although these possess two catechol moieties, which indicate that the rhamnose group is also an important anticancer feature. Moreover, the positions of the caffeoyl substituents on the glucose ring has a secondary effect on cytotoxicity, as acteoside and calceolarioside A were more cytotoxic to various cancer cells than isoacteoside and calceolarioside B, respectively.

Acteoside has been reported to induce differentiation and apoptosis by inhibiting telomerase activity in human gastric carcinoma cells (35) by exhibiting anti-proliferative activity toward some tumor cells (36), by inhibiting microsomal lipid peroxidation as an effective Reactive oxygen species (ROS) scavenger (e.g. for O2 and OH) (37) and by repairing DNA damage caused by oxidative stress (38). The present study demonstrates that acteoside potently causes HL-60 cell cycle arrest, and that this leads to the inhibition of the cell proliferation and the induction of differentiation. Moreover, we found that acteoside inhibits HL-60 proliferation in a dose- and time-dependent manner, by the trypan blue exclusion method (Figure 2B). This observation prompted us to investigate the effect of acteoside on cell cycle regulation and characteristics of HL-60 differentiation. Flow cytometric data of acteoside-treated HL-60 cells revealed that the cell cycle was blocked by acteoside at the G1 to S phase transition (Figure 3).

The results obtained in the present study provide convincing evidence that acteoside exerts its effects on cell cycle progression mainly via an up-regulation of p21CIP1/WAF1 and p27KIP1 proteins and mRNA expressions in HL-60 cells (Figure 5). When cell cycle phase distributions are compared with alternations in cell cycle regulatory molecules, it was apparent that strong CKI up-regulation is one of the major causes of acteoside-induced G1 arrest and cell growth inhibition. The mammalian cell cycle is regulated by complex machinery, in which CDKs, CKIs and cyclins play essential roles (39). CKIs are tumor suppressor proteins that down-regulate cell cycle progression by binding to active CDK–cyclin complexes, thereby inhibiting their kinase activities (40,41). The important CKIs include p21CIP1/WAF1, a universal inhibitor of CDKs whose expression is mainly regulated by the p53 tumor suppressor protein (39), and p27KIP1 that is also up-regulated in response to anti-proliferative signals (40). Additionally, our data suggest that CKI up-regulation by acteoside involves a p53-independent pathway because HL-60 cells lack functional p53.

Among the CDKs that regulate the cell cycle, CDK2, CDK4 and CDK6 are known to be activated in association with D-type cyclins or cyclin E during G1 progression and G1–S transition (6). This study reveals that CDK2 and CDK6 and that cyclin D1, cyclin D2, cyclin D3 and cyclin E expressions are reduced by acteoside in HL-60 cells but that of CDK4 is not. In addition, proteins were found to accumulate in association with G1 arrest, and were largely complexed with both CDK4 and CDK6, respectively. The decreased CDK2, CDK6, cyclin D1, cyclin D2, cyclin D3 and cyclin E levels and the increased forms of p21CIP1/WAF1-CDK4, p21CIP1/WAF1-CDK6, p27KIP1-CDK4 and p27KIP1-CDK6 complexes support the notion that acteoside markedly attenuates CDK4- and CDK6-associated kinase activities in HL-60 cells. Although we increased the amounts of CDK2 antibodies, the complexes between CDK2 and p21CIP1/WAF1 and p27KIP1 were not affected, indicating that the reduction of CDK2 activities was solely dependent on the reduction of the expression level of CDK2 protein instead of binding with p21CIP1/WAF1 and p27KIP1 proteins. Furthermore, reduced CDK4 and CDK6 kinase activities were found to be associated with the underphosphorylation of the Rb protein, which is known to sequester the transcription factor, E2F, and thereby to prevent cell cycle progression. In addition, electrophoretic mobility shift assay experiments confirmed that acteoside reduced E2F1–DNA-binding capacity in a time-dependent manner. Overall, G1 blockade in HL-60 cells appears to be mediated by the down-regulations of CDK4- and CDK6-associated kinase activity in association with the induction of CKIs, like p21CIP1/WAF1 and p27KIP1.

These anti-proliferative effects were also related to the terminal differentiation. Terminal differentiation in the diverse cell types, which occurs either spontaneously or as a consequence of a treatment with the specific inducing agents, correlates with an irreversible loss of the proliferative potential (42). In this regard, the differentiation-inducing effect of acteoside was further examined in the present study. Acteoside-induced differentiation of HL-60 cells toward the monocyte/macrophage lineage, as determined using differentiation markers such as NBT-reducing ability (Figure 8A), the appearance of esterase activity, increased phagocytic activity and a marked increase in the expression of cell surface antigen CD14, which has been reported to be an antigenic monocyte marker. Thus, our results indicate that acteoside is a novel and potent inducer of HL-60 human leukemia cell to monocyte/macrophage differentiation.

TGF-ß is a pluripotent cytokine that controls multiple cellular responses including the induction of cell growth inhibition, differentiation, cellular senescence, wound healing and apoptosis (4345). These cellular responses are thought to define the role of TGF-ß as a tumor suppressor. It inhibits the cell cycle through a partial block in the cell transition from G1 to S phase by down-regulating components of the cell cycle and up-regulating cell cycle inhibitors (46). In addition, HL-60 cells express Smad2 and Smad3, which are important direct downstream targets of TGF-ß type I receptor and also express Smad4, which forms heteromeric complexes with Smad2 and Smad3 to enter the nucleus as transcription regulators (47). The results described here demonstrated that, indeed, the actions of acteoside on leukemia cells might involve TGF-ß1 signaling. Acteoside treatment increased TGF-ß1 mRNA expression and also significantly increased phosphorylation of Smad2/3, suggesting that TGF-ß1 plays a critical role in growth inhibition mediated by acteoside.

Acteoside has been reported to mediate cell differentiation, and apoptosis may be affected by telomere-telomerase-cell cycle dependent modulation (35). Other chemical differentiation inducers, for example, 12-O-tetradecanoylphorbol-13-acetate, DMSO, all-trans-retinoic acid and 1{alpha},25(OH)2-vitamin D3, also inhibit the expression of telomerase in HL-60 leukemia cells (48,49). This suggests that the telomerase activity may serve as a cellular marker for the differentiation process involved in HL-60 cells. However, the exact mechanism by which acteoside reduces telomerase activity at transcriptional and/or translational levels warrants further investigation. In this regard, a TGF-ß1–p21WAF1/CIP1 pathway has been recently reported to negatively regulate human telomerase reverse transcriptase and an up-regulation of telomerase associate proteins as shown by several investigators (5052). The telomerase-specific inhibitors, Telomestatin (SOT-095), was also shown to enhance p21CIP1/WAF1 expression in human leukemia cells (53), highlighting the importance of this molecule in the process of mediating the effects of acteoside on growth inhibition, G1/G0 arrest and differentiation.

In summary, acteoside was found to inhibit the cell proliferation of HL-60 cells not only by arresting the G1 phase cell cycle through the down-regulation of the CDK4- and CDK6-associated kinase activities in association with the induction of CKIs such as p21CIP1/WAF1 and p27KIP1 but also by inducing differentiation via increased TGF-ß1 signaling. Finally, these results suggest that acteoside may be useful as one of the investigational drugs for treating leukemia patients.


    Funding
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Korea Science and Engineering Foundation (R13-2002-020-01002-0); Seoul Research and Business Development Program (10524).


    Acknowledgments
 
Conflict of Interest statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 

  1. Tomas BJ. Cell-cycle control during development: taking it up a notch. Dev. Cell (2005) 8:451–452.[CrossRef][Web of Science][Medline]
  2. Scott RE, et al. Coupling of growth arrest and differentiation at a distinct state in the G1 phase of the cell cycle: GD. Proc. Natl Acad. Sci. USA (1982) 79:845–849.[Abstract/Free Full Text]
  3. Collins K, et al. The cell cycle and cancer. Proc. Natl Acad. Sci. USA (1997) 94:2776–2778.[Free Full Text]
  4. Buolamwini JK. Cell cycle molecular targets in novel anticancer drug discovery. Curr. Pharm. Des. (2000) 6:379–392.[CrossRef][Web of Science][Medline]
  5. Hajduch M, et al. Synthetic cyclin dependent kinase inhibitors. New generation of potent anti-cancer drugs. Adv. Exp. Med. Biol. (1999) 457:341–353.[Web of Science][Medline]
  6. Viallard JF, et al. Molecular mechanisms controlling the cell cycle: fundamental aspects and implications for oncology. Cancer Radiother. (2001) 5:109–129.[Medline]
  7. Sharma HW, et al. Differentiation of immortal cells inhibits telomerase activity. Proc. Natl Acad. Sci. USA (1995) 92:12343–12346.[Abstract/Free Full Text]
  8. Fisher RP, et al. A novel cyclin associates with MO15/CDK7 to form the CDK-activating kinase. Cell (1994) 78:713–724.[CrossRef][Web of Science][Medline]
  9. Harper JW, et al. CDK inhibitors in development and cancer. Curr. Opin. Genet. Dev. (1996) 6:56–64.[CrossRef][Web of Science][Medline]
  10. Sherr CJ, et al. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. (1999) 13:1501–1512.[Free Full Text]
  11. Sherr CJ. G1 phase progression: cycling on cue. Cell (1994) 79:551–555.[CrossRef][Web of Science][Medline]
  12. Drexler HG, et al. Leukemia cell lines: in vitro models for the study of acute promyelocytic leukemia. Leuk. Res. (1995) 19:681–691.[CrossRef][Web of Science][Medline]
  13. Andersson G, et al. Adhesion of human myelomonocytic (HL-60) cells induced by 1,25-dihydroxyvitamin D3 and phorbol myristate acetate is dependent on osteopontin synthesis and the alpha v beta 3 integrin. Connect. Tissue Res. (1996) 35:163–171.[Medline]
  14. Jacobsen SE, et al. The growth response of Lin-Thy-1 hematopoietic progenitors to cytokines is determined by the balance between synergy of multiple stimulators and negative cooperation of multiple inhibitors. Exp. Hematol. (1994) 22:985–989.[Web of Science][Medline]
  15. Drexler HG, et al. Growth-inhibitory effects of transforming growth factor-beta 1 on myeloid leukemia cell lines. Leuk. Res. (1998) 22:927–938.[CrossRef][Web of Science][Medline]
  16. De Benedetti F, et al. Synergy between transforming growth factor-beta and tumor necrosis factor-alpha in the induction of monocytic differentiation of human leukemic cell lines. Blood (1990) 75:626–632.[Abstract/Free Full Text]
  17. Selvakumaran M, et al. Progression of the myeloid differentiation program is dominant to transforming growth factor-beta 1-induced apoptosis in M1 myeloid leukemic cells. Blood (1994) 84:1036–1042.[Abstract/Free Full Text]
  18. Defacque H, et al. Transforming growth factor-beta1 is an autocrine mediator of U937 cell growth arrest and differentiation induced by vitamin D3 and retinoids. J. Cell. Physiol. (1999) 178:109–119.[CrossRef][Web of Science][Medline]
  19. Verlinden L, et al. Differentiation induction of HL60 cells by 1,25(OH)2D3, all trans retinoic acid, rTGF-beta2 and their combinations. J. Steroid Biochem. Mol. Biol. (1997) 60:87–97.[CrossRef][Web of Science][Medline]
  20. Ismailoglu UB, et al. Effects of phenylpropanoid and iridoid glycosides on free radical-induced impairment of endothelium-dependent relaxation in rat aortic rings. J. Ethnopharmacol. (2002) 79:193–197.[CrossRef][Web of Science][Medline]
  21. Pu X, et al. Acteoside from Cistanche salsa inhibits apoptosis by 1-methyl-4-phenylpyridinium ion in cerebellar granule neurons. Planta Med. (2003) 69:65–66.[CrossRef][Web of Science][Medline]
  22. Xiong Q, et al. Antioxidative effects of phenylethanoids from Cistanche deserticola. Biol. Pharm. Bull. (1996) 19:1580–1585.[Web of Science][Medline]
  23. Wong IY, et al. Antioxidative activities of phenylethanoid glycosides from Ligustrum purpurascens. J. Agri. Food Chem. (2001) 49:3113–3119.[CrossRef]
  24. Xiong Q, et al. Inhibition of nitric oxide by phenylethanoids in activated macrophages. Eur. J. Pharmacol. (2000) 400:137–144.[CrossRef][Web of Science][Medline]
  25. Lee JY, et al. Inhibition of lipopolysaccharide-inducible nitric oxide synthase expression by acteoside through blocking of AP-1 activation. J. Ethnopharmacol. (2005) 97:561–566.[CrossRef][Web of Science][Medline]
  26. Saracoglu I, et al. Studies on constituents with cytotoxic and cytostatic activity of two Turkish medicinal plants Phlomis armeniaca and Scutellaria salviifolia. Biol. Pharm. Bull. (1995) 18:1396–1400.[Web of Science][Medline]
  27. Kunvari M, et al. Biological activity and structure of antitumor compounds from Plantago media L. Acta Pharm. Hung. (1999) 69:232–239.[Medline]
  28. Ohno T, et al. Antimetastatic activity of acteoside, a phenylethanoid glycoside. Biol. Pharm. Bull. (2002) 25:666–668.[CrossRef][Web of Science][Medline]
  29. Kim HJ, et al. HIV-1 integrase inhibitory phenylpropanoid glycosides from Clerodendron trichotomum. Arch. Pharm. Res. (2001) 24:286–291.[Web of Science][Medline]
  30. Kim HJ, et al. HIV gp41 binding phenolic components from Fraxinus sieboldiana var. angustata. Planta Med. (2002) 68:1034–1036.[CrossRef][Web of Science][Medline]
  31. Seo BR, et al. Saucernetin-7 isolated from Saururus chinensis inhibits proliferation of human promyelocytic HL-60 leukemia cells via G0/G1 phase arrest and induction of differentiation. Carcinogenesis (2004) 25:1387–1394.[Abstract/Free Full Text]
  32. Sherr CJ. The Pezcoller lecture: cancer cell cycles revisited. Cancer Res. (2000) 60:3689–3695.[Abstract/Free Full Text]
  33. Elledge SJ, et al. CDK inhibitors: on the threshold of checkpoints and development. Curr. Opin. Cell Biol. (1994) 6:847–852.[CrossRef][Web of Science][Medline]
  34. Hauck L, et al. E2F transcription factors and pRb pocket proteins in cell cycle progression. Methods Mol. Biol. (2005) 296:239–245.[Medline]
  35. Zhang F, et al. In vitro modulation of telomerase activity, telomere length and cell cycle in MKN45 cells by verbascoside. Planta Med. (2002) 68:115–118.[CrossRef][Web of Science][Medline]
  36. Wartenberg M, et al. Inhibition of tumor-induced angiogenesis and matrix-metalloproteinase expression in confrontation cultures of embryoid bodies and tumor spheroids by plant ingredients used in traditional chinese medicine. Lab. Invest. (2003) 83:87–98.[Web of Science][Medline]
  37. Chiou WF, et al. Acteoside protects endothelial cells against free radical-induced oxidative stress. J. Pharm. Pharmacol. (2004) 56:743–748.[CrossRef][Web of Science][Medline]
  38. Li YM, et al. Fast repairing of oxidized OH radical adducts of dAMP and dGMP by phenylpropanoid glycosides from Scrophularia ningpoensis Hemsl. Acta Pharmacol. Sin. (2000) 21:1125–1128.[Web of Science][Medline]
  39. Grana X, et al. Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CKIs). Oncogene (1995) 11:211–219.[Web of Science][Medline]
  40. Morgan DO. Principles of CDK regulation. Nature (1995) 374:131–134.[CrossRef][Medline]
  41. Hunter T, et al. Cyclins and cancer. II: cyclin D and CDK inhibitors come of age. Cell (1994) 79:573–582.[CrossRef][Web of Science][Medline]
  42. Miura D, et al. Antagonistic action of novel 1{alpha},25-dihydroxyvitamin D3-26,23-lactone analogs on differentiation of human leukemia cells (HL-60) induced by 1{alpha},25-dihydroxyvitamin D3. J. Biol. Chem. (1999) 274:16392–16399.[Abstract/Free Full Text]
  43. Derynck R, et al. TGF-ß signaling in tumor suppression and cancer progression. Nat. Genet. (2001) 29:117–129.[CrossRef][Web of Science][Medline]
  44. Shi Y, et al. Mechanisms of TGF-ß signaling from cell membrane to the nucleus. Cell (2003) 113:685–700.[CrossRef][Web of Science][Medline]
  45. Siegel PM, et al. Cytostatic and apoptotic actions of TGF-ß in homeostasis and cancer. Nat. Rev. Cancer (2003) 3:807–821.[CrossRef][Web of Science][Medline]
  46. Gong J, et al. Transforming growth factor ß1 increases the stability of p21WAF1/CIP1 protein and inhibits CDK2 kinase activity in human colon carcinoma FET cells. Cancer Res. (2003) 63:3340–3346.[Abstract/Free Full Text]
  47. Li F, et al. TGF-ß signaling in colon cancer cells. World J. Surg. (2005) 29:306–311.[CrossRef][Web of Science][Medline]
  48. Bestilny LJ, et al. Selective inhibition of telomerase activity during terminal differentiation of immortal cell lines. Cancer Res. (1996) 56:3796–3802.[Abstract/Free Full Text]
  49. Reichman TW, et al. Downregulation of telomerase activity in HL60 cells by differentiating agents is accompanied by increased expression of telomerase-associated protein. J. Cell. Biochem. (1997) 67:13–23.[CrossRef][Web of Science][Medline]
  50. Rama S, et al. TGF-ß1 induces multiple independent signals to regulate human trophoblastic differentiation: mechanistic insights. Mol. Cell. Endocrinol. (2003) 206:123–136.[CrossRef][Web of Science][Medline]
  51. Newbold RF. The significance of telomerase activation and cellular immortalization in human cancer. Mutagenesis (2002) 17:539–550.[Abstract/Free Full Text]
  52. Zeng XL, et al. In vitro induction of differentiation by ginsenoside Rh2 in SMMC-7721 hepatocarcinoma cell line. Pharmacol. Toxicol. (2003) 93:275–283.[CrossRef][Web of Science][Medline]
  53. Tauchi T, et al. Activity of a novel G-quadruplex-interactive telomerase inhibitor, telomestatin (SOT-095), against human leukemia cells: involvement of ATM-dependent DNA damage response pathways. Oncogene (2003) 22:5338–5347.[CrossRef][Web of Science][Medline]
Received October 30, 2005; revised April 27, 2007; accepted May 17, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
28/9/1928    most recent
bgm126v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Google Scholar
Right arrow Articles by Lee, K.-W.
Right arrow Articles by Lee, K.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, K.-W.
Right arrow Articles by Lee, K.-T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?