Skip Navigation


Carcinogenesis Advance Access originally published online on September 24, 2007
Carcinogenesis 2008 29(1):161-168; doi:10.1093/carcin/bgm205
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
29/1/161    most recent
bgm205v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Perra, A.
Right arrow Articles by Columbano, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perra, A.
Right arrow Articles by Columbano, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

{alpha}-lipoic acid promotes the growth of rat hepatic pre-neoplastic lesions in the choline-deficient model

Andrea Perra, Monica Pibiri, Pia Sulas, Gabriella Simbula, Giovanna Maria Ledda-Columbano and Amedeo Columbano*

Department of Toxicology, Oncology and Molecular Pathology Unit, University of Cagliari, Via Porcell 4, 09124 Cagliari, Italy

* To whom correspondence should be addressed. Tel: +39 070 6758345; Fax: +39 070 666062; Email: columbano{at}unica.it


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
{alpha}-lipoic acid ({alpha}-LA) is an antioxidant used in a number of conditions related to liver diseases. Herein, we investigated the effect of {alpha}-LA on the development of rat pre-neoplastic lesions generated by a model of hepatocarcinogenesis, which has similarities in its histopathological sequence to human hepatocellular carcinoma development with cirrhosis. Initiation of hepatocytes was achieved by treatment with a single dose of diethylnitrosamine and promotion by feeding a choline–methionine-deficient diet (CMD), with or without {alpha}-LA. Pre-neoplastic lesions were identified by their positivity to the placental form of glutathione S-transferase (GSTP) or to gamma glutamyl transpeptidase. {alpha}-LA given to rats fed a CMD for 6 weeks dramatically increased the number of GSTP-positive foci as compared with rats fed a CMD alone (96/cm2 versus 7/cm2), the mean foci area (0.033 versus 0.008 mm2) and the percentage of GSTP-positive liver tissue (3.01 versus 0.07%). Essentially similar results were obtained after 10 weeks of treatment. Co-treatment with CMD + {alpha}-LA also resulted in the enhancement of fat accumulation, lipid peroxidation and hepatocyte death; increased expression of tumor necrosis factor-{alpha}, cytochrome 2E1 and cyclooxygenase-2, enhanced activation of c-jun N-terminal kinase and signal transducer activator of transcription 3, and chronic hepatocyte proliferation was also observed. No such effects were observed when {alpha}-LA was added to a choline-supplemented diet. In conclusion, administration of {alpha}-LA in conditions associated with hepatic damage aggravates liver injury and stimulates the development of pre-neoplastic lesions; the results also suggest caution in its use in the presence of chronic liver injury.

Abbreviations: {alpha}-LA, {alpha}-lipoic acid; BrdU, bromodeoxyuridine; CMD, choline–methionine deficient diet; CS, choline-supplemented diet; COX, cyclooxygenase; DENA, diethylnitrosamine; GGT, gamma glutamyl transpeptidase; GSTP, glutathione S-transferase; HCC, hepatocellular carcinoma; JNK, c-jun N-terminal kinase; LPO, lipid peroxidation; mRNA, messenger RNA; ROS, reactive oxygen species; STAT3, signal transducer activator of transcription 3; TNF-{alpha}, tumor necrosis factor-{alpha}


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 Funding
 References
 
Hepatocellular carcinoma (HCC) is the fifth leading cancer in the world with an increasing rate of incidence and mortality and a poor prognosis (1). Although, during the past 25 years striking advances have been made in our understanding of HCC, including the development of new approaches to the heterogeneous nature of HCC (2), current treatments are not effective, and the identification of relevant pathways and novel therapeutic agents are much needed.

The availability of substances, including natural antioxidants, which are non-toxic for normal liver while having a direct or indirect effect on tumor cell growth, may provide useful for the development of antitumoral strategies aimed at inhibiting tumor growth and/or selectively eliminating cancer cells.

{alpha}-Lipoic acid ({alpha}-LA) is a naturally occurring, short-chain fatty acid containing two sulfur molecules. It is an essential cofactor of mitochondrial respiratory enzymes (3), taken up and reduced to dihydrolipoic acid, which can be released into the extracellular compartment. {alpha}-LA and dihydrolipoic acid can serve as powerful antioxidants through several mechanisms, including scavenging of free radicals, chelation of metal ions and regeneration of endogenous and exogenous antioxidants, such as ubiquinon, vitamins C and E and glutathione (4). Pharmacologically, {alpha}-LA has been widely used as a therapeutic agent in the treatment and prevention of several pathological conditions, such as diabetic polyneuropathy, hypertension, insulin resistance and bone loss (5–7). Furthermore, {alpha}-LA has also been used in a number of conditions related to liver diseases, such as alcohol-induced damage, mushroom poisoning, metal intoxication, CCl4 poisoning and hyperdynamic circulation in biliary cirrhosis (8–10) and has been reported to have a beneficial effect in patients with advanced cancer by increasing the glutathione peroxidase activity and by reducing oxidative stress (11). Interestingly, while {alpha}-LA exerts a protective effect against apoptosis in normal hepatocytes, similarly to what described in several cancer cell lines (12–14), it possesses a strong pro-apoptotic effect on human and murine hepatoma cells (15), suggesting that {alpha}-LA may play a role in the hepatocarcinogenic process.

Animal models have greatly contributed to the understanding of the carcinogenic process in the liver. In particular, short-term in vivo assay systems with suitably short duration but sufficient effect in inducing measurable lesions, have been widely accepted as early indicators of neoplastic development, as they provide results closely comparable with those of long-term carcinogenicity testing (16–18). Among the several models developed in the past years, a very useful one is the high-fat choline–methionine-deficient diet (CMD), which is known to cause fatty change, hepatocyte injury, fibrosis, cirrhosis and generation of oxidative DNA damage via 8-hydroxydeoxyguanosine, in rodents (19,20). Administration of CMD to rats, following a single initiating dose of carcinogen, enhances both induction of enzyme-altered pre-neoplastic foci and subsequent progression to HCC (21). Acceleration of development of hepatic neoplasms by CMD has also been reported in mice (22). This provides us with a useful experimental model for promotion of hepatocarcinogenesis caused by endogenous factors, and which has similarities in its histopathological sequence to human HCC development with cirrhosis (23).

Based on the wide therapeutic use of {alpha}-LA in several diseases (5–7), including conditions related to liver diseases (8–10), and since no data are available on the effect of {alpha}-LA on liver cancer development, the aim of the present study was to investigate the effect of {alpha}-LA on the occurrence of putative pre-neoplastic lesions induced by a short-term in vivo assay consisting of a single dose of the hepatocarcinogen diethylnitrosamine (DENA) and promotion with the CMD. We report here that addition of {alpha}-LA to the CMD strongly promoted the growth of hepatic pre-neoplastic foci positive for the placental form of glutathione S-transferase (GSTP) and gamma glutamyl transpeptidase (GGT), the two most reliable markers for rat pre-neoplasia (24,25), and potentiates accumulation of triglycerides in the liver and hepatocellular damage, suggesting caution about its use in conditions associated with pre-existing liver damage.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 Funding
 References
 
Animals and reagents
Eight-week-old Fischer rats (F-344, 175–200 g, Charles River, Milano, Italy) were used for the experiments. All procedures were performed in accordance with the Universities Federation for Animal Welfare Handbook on the Care and Management of Laboratory Animals and the guidelines of the animal ethics committee of this University. DENA was purchased from Sigma Chemical Co. (St Louis, MO). {alpha}-LA (Sigma) was given in drinking water at the concentration of 0.01, 0.05, 0.1 and 0.2% for the times indicated in the Experimental protocol I or added to the diet at a final concentration of 0.2% (Experimental protocols II and III).

Experimental protocol I
Rats were injected intraperitoneally with a single dose of DENA (150 mg/kg body wt). After a 2 week recovery period, rats were fed a CMD for 6 weeks. At the beginning of the CMD, {alpha}-LA was given in drinking water at the following concentrations: 0.01, 0.05, 0.1 and 0.2%. The same doses of {alpha}-LA were given to rats fed a choline-supplemented diet (CS).

Experimental protocol II
Two weeks after treatment with DENA, rats were divided in four groups: group 1 was placed on a CMD; group 2 on a CMD supplemented with 0.2% {alpha}-LA ({alpha}-LA + CMD); group 3 on a CS; group 4 on a CS supplemented with 0.2% {alpha}-LA (CS + {alpha}-LA). All animals were killed 6 or 10 weeks after starting of the diet.

Experimental protocol III
Rats were fed CMD with or without {alpha}-LA (final concentration in the diet 0.2%), in the absence of carcinogen treatment, for 10 weeks.

Histology and immunohistochemistry
Sections of the liver were fixed in 10% buffered formalin and processed for staining with hematoxylin–eosin. Other sections were used for immunohistochemical detection of bromodeoxyuridine (BrdU), GSTP and GGT as described (26). The remaining liver was snap frozen in liquid nitrogen and kept at –80°C until use.

Double labeling of BrdU and GSTP-positive hepatocytes in DENA-initiated rat liver
BrdU (Sigma Chemical Co.) dissolved in drinking water (1 mg/ml) was given throughout the last week of treatment (26). BrdU incorporation into nuclei and the location of GSTP was determined as described previously (27). The sites of phosphatase binding were detected with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate system (K598, Dako Corp, Carpinteria, CA).

Measurement of GSTP- and GGT-positive foci
GSTP- and GGT-positive foci were measured with a computer-assisted image processor, according to Abramoff et al. (28). For each animal, three different sections from three distinct lobes were measured. Only foci >75 µm in diameter were scored.

Determination of labeling index
Random microscope fields were scored for BrdU-positive hepatocytes. The labeling index was calculated as BrdU-positive hepatocyte nuclei per 100 nuclei. At least 5000 hepatocyte nuclei per liver were scored.

Determination of apoptotic index
The incidence of apoptotic bodies was determined by scoring 3000–4000 hepatocytes per liver, as described previously (29). The apoptotic index was expressed as number of apoptotic bodies per 100 hepatocytes.

Serum alanine aminotransferase
Blood samples were centrifuged at 1500 r.p.m. for 15 min and the serum was tested for alanine aminotransferase, using a commercially available kit from Ortho-Clinical Diagnostics, Rochester, NY.

Lipid peroxidation assay
Approximately 100 mg of liver tissue were homogenized with a Ultra Turrax T8 stirrer in ice-cold 20 mM Tris–HCl buffer, pH 7.4, to produce a 1/10 homogenate. The crude homogenate was centrifuged at 7.000 r.p.m. for 15 min at 4°C. Aliquots of the supernatant were used for protein total determination or to calculate lipid peroxidation (LPO). Malondialdehyde and 4-hydroxyalkenals concentrations provide a convenient index of LPO (30). The Bioxytech LPO-586 kit (Oxix International, Portland, OR) was used.

Northern blot
Total RNA was prepared from CS, CMD, {alpha}-LA + CS and {alpha}-LA + CMD-fed rats by using TRIzol isolation reagent (Invitrogen, San Giuliano Milanese, Italy). Thirty micrograms of total RNA were fractionated on formaldehyde–agarose gel and transferred to Hybon-XL-membrane (Amersham Biosciences, Buckinghamshire, UK), as described previously (31). Probe for 18S was prepared from total RNA using SuperScriptTM IIIOne-Step RT–PCR System with Platinum Taq DNA Polymerase (Invitrogen). Polymerase chain reaction primers for 18S were forward CGGCTACCACATCCAAGGAA and reverse GCTGGAATTACCGCGGCT. Probes for tumor necrosis factor-{alpha} (TNF-{alpha}) and Cytochrome P450 2E1 (Cyp2E1) were prepared from total RNA, reverse transcribed with ThermoScript RT–PCR System (Invitrogen, Carlsbad, CA) and polymerase chain reaction amplified with Platinum Taq DNA Polymerase (Invitrogen) using the following primers: forward primer CCCAGACCCTCACACTCAGA and reverse primer ATCCACTCAGGCATCGACAT for TNF-{alpha} probe and forward primer AAGGATATCCCCAAGTCTTTCACCA and reverse primer GTGGTCTCAGTTCCTGCAAAGAACA for Cyp2E1 probe. DNA probes were labeled with [{alpha}-32P] deoxycytidine triphosphate and [{alpha}-32P] deoxyadenosine triphosphate by random priming (Ready to go DNA labelling beads or Megaprime DNA Labelling Systems; Amersham Bioscience). Unincorporated nucleotides were removed with Microspin G50 columns (GE Healthcare, Buckinghamshire, UK). Membranes were exposed to autoradiographic film (Eastman Kodak, Rochester, NY, Sigma Chemical Co.).

Western blot analysis
Total cell extracts were prepared from frozen livers as described previously (31). For immunoblot analysis, equal amount (from 100 to 150 µg per lane) of proteins were electrophoresed on sodium dodecyl sulfate 12 or 8% polyacrylamide gels (Sigma Chemical Co.). After gels' electrotransfer onto nitrocellulose membranes (Osmonics, Westborough, MA) to ensure equivalent protein loading and transfer in all lanes, the membranes and the gels were stained with 0.5% (wt/vol) Ponceau S red (ICN Biomedicals) in 1% acetic acid, and with Coomassie blue (ICN Biomedicals) in 10% acetic acid, respectively. After blocking in Tris-buffered saline + 5% non-fat dried milk, membranes were washed in Tris bufferered saline-Tween 20 and then incubated with the appropriate primary antibodies. Filters were incubated with anti-mouse or anti-rabbit or anti-goat horseradish peroxidase-conjugated IgG (Santa Cruz Biotechnology, Santa Cruz, CA). Immunoreactive bands were identified with chemiluminescence detection system (Supersignal Substrate; Pierce, Rockford, IL).

Antibodies
Primary antibodies used in this study were mouse monoclonal antibodies against cyclin D1 (72-13G; Santa Cruz Biotechnology), actin (clone AC40; Sigma Chemical Co.) proliferating cell nuclear antigen (PC-10; Santa Cruz Biotechnology), Bax (B-9; Santa Cruz Biotechnology) and caspase-9 (C-9; Cell Signalling Technology, Beverly, MA); rabbit polyclonal antibodies against signal transducer activator of transcription 3 (STAT3), phospho-STAT3 (Tyr705), Stress activated protein kinase (SAPK)/c-jun N-terminal kinase (JNK), phospho-SAPK/JNK and Poly(ADP-ribose)polymerase (Cell Signalling Technology), pro-caspase-8 (H-134; Santa Cruz Biotechnology); goat polyclonal antibodies directed against cyclooxygenase (COX)-1 (M-20) and COX-2 (M-19) (Santa Cruz Biotechnology). For immunohistochemistry, the antibodies used were rabbit polyclonal antibody anti-GSTP (MBL, Woburn, MA) and anti-GGT(a kind gift from A.Pompella and A.Paolicchi, University of Pisa).

Statistical analysis
Instant software (GraphPad Prism 5, San Diego, CA) was used to analyze the data. One-way analysis of variance with post hoc analysis using Tukey's multiple comparison test was used for parametric data. The results of multiple observations were presented as the means ± SE of at least two separate experiments. A P value of <0.05 was regarded as a significant difference between groups.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 Funding
 References
 
Experimental protocol I
A concentration of 0.2% of {alpha}-LA does not cause any toxic effect on the liver while improving indices of metabolic activity as well as lowering oxidative stress and damage caused by aging in rat liver (32). To evaluate the effect of {alpha}-LA on the development of pre-neoplastic hepatic lesions, rats fed CMD received {alpha}-LA in drinking water at concentrations of 0.2% or lower (0.1, 0.05 and 0.01) for 6 weeks. No rats died in any of the groups during the experimental period. As shown in Table I, the three highest concentrations of {alpha}-LA exerted a promoting effect on the development of GSTP-positive foci compared with the group given CMD alone. Indeed, quantification of the number of GSTP-positive foci showed that CMD-fed rats given 0.2, 0.1 and 0.05% of {alpha}-LA exhibited a significant increase in the number of GSTP-positive foci (38, 31 and 20/cm2, respectively versus 13.5/cm2 of rats given DENA and fed CMD alone). Very few GSTP-positive foci were observed in the liver of rats treated with DENA and fed CS, and this number was not modified by any of the doses of {alpha}-LA.


View this table:
[in this window]
[in a new window]

  		Table I. Effect of various concentrations of {alpha}-LA on the induction of GSTP-positive foci in rat liver initiated by DENA

 
Experimental protocol II
As the concentration of 0.2% of {alpha}-LA appeared to be the most effective in promoting the occurrence of GSTP-positive foci, next experiments were performed using a CMD supplemented with this concentration of {alpha}-LA for 6 or 10 weeks. As in experimental protocol 1, no mortality was observed. A decreased body weight of rats given {alpha}-LA fed on either the CS or CMD for 6 weeks was found, compared with CMD or CS alone (Table II). The ratio of liver weight to body weight increased in CMD-fed rats compared with CS and was further enhanced in CMD + {alpha}-LA-fed rats.


View this table:
[in this window]
[in a new window]

  		Table II. Effect of {alpha}-LA on the induction of GSTP-positive foci in the liver of rats initiated with DENA

 
Under histological examination, the liver of rats fed CMD showed distinct nodular foci of hepatocytes, which, on this basis, could be readily distinguished from the surrounding fatty parenchyma. The hepatocytes in the foci were arranged irregularly without a distinct sinusoidal pattern and in plates more than one cell thick, had basophilic cytoplasm, contained droplets of fat, albeit at a lower level compared with surrounding parenchyma, and displayed frequent mitoses. Foci of hepatocytes similar to these, but much larger in size and several fold more numerous were observed in the liver of rats fed CMD + {alpha}-LA. Indeed, as shown in Table II, a dramatic increase in the number of pre-neoplastic lesions was observed in the liver from rats given DENA and fed CMD + {alpha}-LA (95.7 GSTP-positive foci per cm2 versus 6.7 of rats fed CMD alone); the number of GSTP-positive foci caused by {alpha}-LA supplementation in the diet was higher than that seen when the same concentration of {alpha}-LA was added to drinking water (compare Table II and Table I). {alpha}-LA supplementation to the diet also caused a striking increase in the percentage of area occupied by GSTP-positive hepatocytes (3.01 versus 0.07% of CMD-fed rats) (compare Figure 1D with C). Moreover, the mean area of foci in CMD + {alpha}-LA-fed rats was also increased by ~4-fold, being 0.033 versus 0.008 mm2 of rats fed CMD alone. Very few and small GSTP-positive mini-foci were observed in rats fed CS (Figure 1A) or CS + {alpha}-LA (Figure 1B). No GSTP-positive foci were observed in rats fed CMD with or without {alpha}-LA, in the absence of DENA treatment (data not shown). Feeding CMD for four extra weeks caused an increase in the number of GSTP-positive foci (66/cm2), in the percentage of liver area GSTP positive (1.94%) and in the average area size (0.028 mm2) (Table II and Figure 1E). However, supplementation with {alpha}-LA for the same period of time did result in a further increase in the number (155 GSTP-positive foci/cm2), percentage liver area (11.3%) and average foci area (0.074 mm2), clearly demonstrating the powerful enhancing effect of {alpha}-LA on tumor promotion by CMD (Table II and Figure 1F). Although GSTP is considered to be the most reliable marker for pre-neoplastic lesions induced by genotoxic carcinogens (24), it does not identify all putative pre-neoplastic lesions. Therefore, pre-neoplastic lesions were also identified by their positivity for GGT, the second best marker for pre-neoplasia (25). The results confirmed that feeding a CMD + {alpha}-LA diet for 10 weeks caused a striking increase in the number of pre-neoplastic lesions compared with the animals fed the CMD alone (72.1 ± 13 foci/cm2 versus 25.4 ± 7 foci/cm2), although, in agreement with the literature (25), the number of lesions detected by GGT staining was lower than that determined by GSTP staining.


Figure 1
View larger version (120K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. Photomicrographs of liver sections from rats treated with DENA (150 mg/kg) and fed a CS (A) or a CS supplemented with 0.2% {alpha}-LA (B) for 6 weeks. (C and E) Liver sections from rats treated with DENA and fed CMD for 6 (C) or 10 (E) weeks. (D and F) Liver sections from rats treated with DENA and fed CMD supplemented with 0.2% {alpha}-LA for 6 (D) or 10 (F) weeks. Sections were stained for GSTP and counterstained with hematoxylin (x15).

 
Interestingly, at the time points examined, a more severe degree of fatty change was present in the liver of CMD + {alpha}-LA diet-fed rats as compared with CMD alone (See Figures 1 and 2). Fatty liver is usually followed by hepatocyte injury (steatohepatitis) which in turns induces compensatory regeneration; repeated cycles of oxidative stress, hepatocyte injury and regeneration (27,33) have been postulated to be involved in the appearance of pre-neoplastic lesions in the CMD model (34). Therefore, we sought to examine whether the promoting effect of {alpha}-LA on the development of pre-neoplastic lesions could be the consequence of increased (i) oxidative stress; (ii) liver damage and (iii) chronic liver regeneration.


Figure 2
View larger version (144K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. Photomicrographs of liver sections from rats treated with DENA (150 mg/kg) and fed CS or CMD with (B and D) and without {alpha}-LA (A and C) for 10 weeks. Sections were stained for GSTP and counterstained with hematoxylin (x40). Note the confluence of lipid vacuoles in the liver of rats fed CMD + {alpha}-LA and the reduced fat accumulation in the GSTP-positive pre-neoplastic hepatocytes. (E and F) Photomicrographs of liver sections double stained for GSTP and BrdU. Liver sections from rats treated with DENA + CMD (E) and DENA + CMD supplemented with 0.2% {alpha}-LA (F). Several labeled nuclei are present in a GSTP-positive nodule generated by a single DENA administration followed by feeding a CMD with {alpha}-LA (x40). Note the much higher different labeling in the nodule as compared with the surrounding liver.

 
Cyp2E1, one of the several possible sources of reactive oxygen species (ROS) is increased in the liver of humans with alcohol-induced liver disease (35) and non-alcoholic steatohepatitis (36,37). Furthermore, induction of Cyp2E1 and accumulation of hepatic lipoperoxides (38) have been shown to occur in rodents with steatohepatitis induced by feeding a CMD. These finding prompted us to investigate whether {alpha}-LA could enhance chronic oxidative stress through Cyp2E1 induction and LPO (see Experimental protocol III). The results in Figure 3A show that, in agreement with previous findings (38), Cyp2E1 expression was increased in CMD-fed rats; however, {alpha}-LA addition to CMD further enhanced the hepatic levels of Cyp2E1 messenger RNA (mRNA) compared with CMD alone. Very low expression of Cyp2E1 was observed in both CS and CS + {alpha}-LA groups. Moreover, {alpha}-LA addition to CMD caused a significant increase in LPO, compared with CMD alone (Figure 3B).


Figure 3
View larger version (46K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3. (A) Northern blot analysis of Cyp2E1 and TNF-{alpha} mRNA levels. Total RNA was prepared from rat liver 10 weeks after the beginning of dietary regimen with CS or CMD, with or without 0.2% {alpha}-LA and subjected to northern blot analysis as described in Materials and Methods. 18S was used as a loading control. Each lane represents an individual sample. (B) Effect of co-treatment with {alpha}-LA on LPO levels in the liver of CMD-fed rats. Four to five rats per group were used. §Significantly different from CS and CS + {alpha}-LA; P < 0.001; *significantly different from CMD; P < 0.001; (C) western blot analysis of STAT3, phospho-STAT3, phospho-SAPK/JNK, SAPK/JNK, COX-2 and COX-1. Western analysis was performed as described in Material and Methods. Actin was used as loading control. Each lane represents a pool of four different samples. (D) Serum alanine aminotransferase levels in rats fed CS or CMD, with or without {alpha}-LA for 10 weeks. Results are expressed as means ± SE of five rats per group. *Significantly different from CMD; P < 0.005.

 
The products of LPO can mediate inflammatory recruitment by activating nuclear factor-{kappa}B with downstream consequences that include expression of COX. COX catalyzes the conversion of arachidonic acid to prostanoids and thromboxanes, some of which are intensely pro-inflammatory. Since COX-2 acts as pro-inflammatory mediator in the CMD-induced steatohepatitis model (39), we investigated the effect of {alpha}-LA on COX-2 expression. The results shown in Figure 3C demonstrate that CMD increased the expression of COX-2, compared with CS, and that {alpha}-LA added to the CMD further increased the hepatic levels of this pro-inflammatory protein. No effect of {alpha}-LA was observed when added to the CS. No change in the protein levels of COX-1 was induced by CMD dietary feeding, with or without {alpha}-LA. Cyp2E1 over-expression causes an activation of JNK (40). As phosphorylation of JNK regulates hepatocellular injury and insulin resistance, thus mediating the development of steatohepatitis, the expression of JNK was examined in the liver of rats fed CMD with or without {alpha}-LA. The results showed that CMD causes an increase of JNK phosphorylation and that {alpha}-LA addition further increases activation of this kinase (Figure 3C); northern analysis showed that co-treatment of CMD + {alpha}-LA also resulted in increased hepatic levels of TNF-{alpha}, a candidate molecule in the transition of steatosis to steatohepatitis and a known JNK activator (Figure 3A); similar results were confirmed by semi-quantitative polymerase chain reaction (data not shown). Very little activation of JNK was observed in the non-injured liver from CS-fed animals, with or without {alpha}-LA. STAT3 is known to play a crucial role in inflammation and cell proliferation (41–43). As shown in Figure 3C, hepatic protein levels of phosphorylated STAT3 were increased after 10 weeks of CMD dietary feeding compared with CS. Consistent with the proposed pro-inflammatory role of STAT3, the hepatic levels of phosphorylated STAT3 were further enhanced in rats given {alpha}-LA together with CMD whose liver was more severely damaged compared with the CMD group. No STAT3 activation was observed in the liver of rats given {alpha}-LA + CS.

The severe fat accumulation and oxidative stress caused by {alpha}-LA in rats fed the CMD were associated with increased liver cell death. Indeed, while an almost 3-fold increase of serum alanine aminotransferase levels was found in rats fed CMD for 10 weeks, as compared with CS-fed rats, a 6-fold increase over the control values was observed in {alpha}-LA + CMD-fed rats (Figure 3D). The increase in serum transaminase levels was associated with the occurrence of apoptosis. Indeed, a significant increase in the number of apoptotic bodies was observed in CMD + {alpha}-LA-fed rats compared with rats fed the CMD alone (apoptotic index was 5.15 ± 0.020% in CMD + {alpha}-LA-fed rats versus 1.73 ± 0.010% of rats fed CMD alone) (Figure 4A). Only a negligible number of apoptotic bodies (<0.1%) was observed in CS and CS + {alpha}-LA-fed rats. The increased occurrence of apoptosis was associated with enhanced expression of the pro-apoptotic proteins caspase-9, Bax and Poly(ADP-ribose)polymerase (Figure 4B). No change in the anti-apoptotic content of Bcl-xL was observed.


Figure 4
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4. (A) Apoptotic index in the liver of rats fed CMD and CS, with or without {alpha}-LA for 10 weeks. *Significantly different from CMD; P < 0.001. (B) Western blot analysis of BAX, Bcl-xL, caspase-9, pro-caspase 8 and cleaved Poly(ADP-ribose)polymerase (PARP). Western analysis was performed as described in Material and Methods. Actin was used as loading control. Each lane represents a pool of four different samples.

 
Hepatocyte injury is followed by liver regeneration. Since cell proliferation is considered to play an important role in the several steps of the carcinogenic process (44–46), we sought to determine whether enhanced hepatocyte replication due to the increased hepatotoxicity caused by feeding CMD + {alpha}-LA diet could accompany and sustain the accelerated growth of pre-neoplastic foci observed in the latter group. Figure 5A shows that treatment with {alpha}-LA + CMD resulted in a strong increase in the labeling index when compared with rats fed a CMD alone (LI was 19.63 versus 8.45% of CMD group). A much lower labeling index was found in rats fed a CS or CS + {alpha}-LA (1.5 and 3.0%, respectively). In agreement with the immunohistochemical data, western blot analysis showed an increase in the hepatic levels of two markers of cell proliferation, namely cyclin D1 and proliferating cell nuclear antigen (Figure 5B), in the {alpha}-LA + CMD group, compared with those of rats fed a CMD alone.


Figure 5
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5. (A) Labeling index of F-344 rat hepatocytes 10 weeks after a dietary regimen consisting of CS or CMD, with or without {alpha}-LA. At least 5000 hepatocyte nuclei per liver were scored. LI was expressed as number of BrdU-positive hepatocyte nuclei per 100 nuclei. Results are expressed as means ± SE of five rats per group. *Statistically significant from CMD; P < 0.001; (B) Western blot analysis of cyclin D1 and proliferating cell nuclear antigen (PCNA) in the liver from rats fed CS or CMD, with or without {alpha}-LA for 10 weeks. Western analysis was performed as described in Material and Methods. Actin was used as loading control. Each lane represents a pool of four different samples.

 
Finally, double staining for BrdU and GSTP showed that the addition of {alpha}-LA to the CMD caused a striking increase in DNA synthesis of GSTP-positive pre-neoplastic hepatocytes compared with that of surrounding liver cells and to that of the tiny GSTP-positive hepatocytes generated by the CMD alone (Figure 2E and F).


   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
Funding
 References
 
The important finding of this study is that, in a nutritional model of steatohepatitis, {alpha}-LA, a natural agent widely used in the treatment and prevention of several pathological conditions, such as diabetic polyneuropathy, hypertension, insulin resistance, bone loss, ischemia-reperfusion injury and conditions related to liver diseases, enhances CMD-induced fatty liver, steatohepatitis and the development of pre-neoplastic hepatic lesions. The enhancing effect of {alpha}-LA on the development of pre-neoplastic lesions appears to occur only in conditions associated with liver damage, such as fatty liver and steatohepatitis caused by a CMD, but not in normal healthy liver.

The CMD causes not only hepatic steatosis but also an associated inflammatory infiltrate. It therefore seems to be a simple and reproducible animal model of fatty liver disease with inflammation and injury that morphologically resembles the group of human disorders known as non-alcoholic steatohepatitis. Similarly to alcoholic steatohepatitis, the early stages of liver disease in the CMD-fed rats are associated with steatosis mostly in acinar zone 3, with latter extension into zone 2. Cyp2E1 is normally localized within a rim of hepatocytes around the terminal hepatic venule in acinar zone 3 (47,48). The increased Cyp2E1 mRNA levels observed in CMD-fed rats (38) suggest that this cytochrome plays an important role in the production of cellular injury in that it could generate ROS and other radicals in this nutritional model of steatohepatitis. The present finding that {alpha}-LA addition to the CMD induces Cyp2E1 mRNA levels, increases LPO and aggravates fat accumulation and necroinflammatory response suggests that concentrations of {alpha}-LA which are presumably harmless for normal liver may increase the production of ROS and the progression from steatosis to steatohepatitis, in the presence of pre-existing liver damage. Furthermore, Cyp2E1 over-expression is known to cause JNK activation (40) which in turns regulates hepatocellular injury, thus further contributing to the development of steatohepatitis. Moreover, the increased hepatic levels of TNF-{alpha}, a candidate molecule in the transition of steatosis to steatohepatitis and a known JNK activator, may also contribute to liver injury caused by co-treatment with CMD + {alpha}-LA. Another interesting finding stemming from this study is the increased expression of COX-2 in CMD + {alpha}-LA-fed rats. Previous studies (39) have shown that the expression and the activity of COX-2 are up-regulated in the CMD model of steatohepatitis; the same studies also showed that specific COX-2 inhibitors ameliorate the CMD-induced steatohepatitis. Our finding that the severity of liver damage induced by {alpha}-LA is accompanied by increased expression of COX-2 is well in agreement with the possible role of COX-2 in the progression from steatosis to steatohepatitis. The fatty liver is predisposed to forms of injury that involve oxidative stress. Liver steatosis induced by a dietary regimen could therefore provide the setting for steatohepatitis. Our results suggest that the addition of {alpha}-LA to the CMD may be the ‘second hit’, which aggravates fatty liver and the necroinflammatory response induced by the dietary regimen. The increased expression of Cyp2E1 mRNA, the production of ROS, the generation of oxidized lipids and their peroxidation products after treatment with {alpha}-LA might be instrumental in worsening and perpetuating the liver damage.

Irrespectively of the mechanisms by which {alpha}-LA enhances the severity of fat accumulation and liver damage caused by the CMD, one of the consequences is an increased chronic hepatocyte turnover, indicated by the increased serum alanine aminotransferase levels, enhanced apoptotic cell death, BrdU incorporation and expression of cell cycle-related proteins. Within this scenario, it is possible to hypothesize the presence of a selective pressure for the initiated hepatocytes which, on one hand, are known to be more resistant to fat accumulation and death, and, on the other hand, can take advantage from the release of growth factors or cytokines, such as TNF-{alpha}, produced as a consequence of the liver damage, and considered to be essential for hepatocyte proliferation (49,50). The finding of a very high labeling index in the GSTP-positive hepatocytes, compared with surrounding non-initiated hepatocytes, strongly supports this hypothesis. Interestingly, in spite of its supposed beneficial effect, at no concentrations {alpha}-LA proved to exert an inhibitory effect on the development of pre-neoplastic lesions.

In conclusion, the present results demonstrate that {alpha}-LA treatment in conditions associated with fatty liver caused by a dietary regimen aggravates liver damage and strongly accelerates the growth of pre-neoplastic lesions. These data also suggest that extreme caution should be taken when considering the therapeutic use of {alpha}-LA in conditions characterized by pre-existing liver damage.


   Funding
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
References
 
Ministero Università e Ricerca (Progetto Nazionale Ricerche, Progetti di Ricerche di Interesse Nazionale and ex-60%); Associazione Italiana Ricerca sul Cancro; Fondazione Banco di Sardegna, Italy.


   Acknowledgments
 
Conflict of Interest Statement: None declared.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 

  1. Llovet JM, et al. Hepatocellular carcinoma. Lancet (2003) 362:1907–1917.[CrossRef][Web of Science][Medline]
  2. Thorgeirsson SS, et al. Functional genomics of hepatocellular carcinoma. Hepatology (2006) 43:S145–S150.[CrossRef][Web of Science][Medline]
  3. Biewenga GP, et al. The pharmacology of the antioxidant lipoic acid. Gen. Pharmacol. (1997) 29:315–331.[Web of Science][Medline]
  4. Roy S, et al. Redox regulation of cell functions by {alpha}-lipoate: biochemical and molecular aspects. Biofactors (1998) 7:263–267.[Medline]
  5. Ziegler DM, et al. Treatment of symptomatic diabetic peripheral neuropathy with the anti-oxidant {alpha}-lipoic acid: a 3-week multicentre randomized controlled trial (ALADIN study). Diabetologia (1995) 38:1425–1433.[CrossRef][Web of Science][Medline]
  6. El Midaoui A, et al. Prevention of hypertension, insulin resistance, and oxidative stress by {alpha}-lipoic acid. Hypertension (2002) 39:303–307.[Abstract/Free Full Text]
  7. Ha H, et al. {alpha}-lipoic acid inhibits inflammatory bone resorption by suppressing prostaglandin E2 synthesis. J. Immunol. (2006) 176:111–117.[Abstract/Free Full Text]
  8. Bludovska M, et al. The influence of {alpha}-lipoic acid on the toxicity of cadmium. Gen. Physiol. Biophys. (1999) 18:28–32.[Medline]
  9. Bustamante J, et al. {alpha}-lipoic acid in liver metabolism and disease. Free Radic. Biol. Med. (1998) 24:1023–1039.[CrossRef][Web of Science][Medline]
  10. Marley R, et al. Lipoic acid prevents development of hyperdynamic circulation in anesthetized rats with biliary cirrhosis. Hepatology (1999) 29:1358–1363.[CrossRef][Web of Science][Medline]
  11. Mantovani G, et al. The impact of different antioxidant agents alone or in combination on reactive oxygen species, antioxidant enzymes and cytokines in a series of advanced cancer patients at different sites: correlation with disease progression. Free Radic. Res. (2003) 37:213–223.[CrossRef][Web of Science][Medline]
  12. Wenzel U, et al. {alpha}-lipoic acid induces apoptosis in human colon cancer cells by increasing mitochondrial respiration with a concomitant O2- generation. Apoptosis (2005) 10:359–368.[CrossRef][Web of Science][Medline]
  13. Sen CK, et al. Fas mediated apoptosis of human Jurkat T-cells: intracellular events and potentiation by redox-active alpha-lipoic acid. Cell Death Differ. (1999) 6:481–491.[CrossRef][Web of Science][Medline]
  14. Van De Mark K, et al. {alpha}-lipoic acid induces p27kip1-dependent cell cycle arrest in non transformed cell lines and apoptosis in tumor cell lines. J. Cell. Physiol. (2003) 194:325–340.[CrossRef][Web of Science][Medline]
  15. Simbula G, et al. Increased ROS generation and p53 activation in {alpha}-lipoic acid-induced apoptosis of hepatoma cells. Apoptosis (2007) 12:113–123.[CrossRef][Web of Science][Medline]
  16. Goldsworthy TL, et al. Models of hepatocarcinogenesis in the rat—contrasts and comparisons. CRC Crit. Rev. Toxicol. (1986) 17:61–89.[Web of Science]
  17. Farber E, et al. The sequential analysis of cancer development. Adv. Cancer Res. (1980) 31:125–226.[Medline]
  18. Ito N, et al. Enhancing effect of various hepatocarcinogens on induction of preneoplastic glutathione S-transferase placental form positive foci in rats—an approach for a new medium term bioassay system. Carcinogenesis (1988) 9:387–394.[Abstract/Free Full Text]
  19. Shinozuka H, et al. Pathology of choline deficiency. In: Nutritional Pathology—Sidransky H, ed. (1985) New York: Marcel Dekker. 279–320.
  20. Newberne PM. Lipotropic factors and oncogenesis. Adv. Exp. Med. Biol. (1986) 206:23–251.
  21. Takahashi S, et al. Progression of carcinogen-induced foci of gamma-glutamyltranspeptidase-positive hepatocytes to hepatoma in rats fed a choline-deficient diet. Int. J. Cancer. (1982) 29:445–450.[Web of Science][Medline]
  22. Newberne PM, et al. Dietary modifiers of cancer. Prog. Clin. Biol. Res. (1988) 258:105–129.
  23. Flier JS, et al. The cellular basis of hepatic fibrosis. Mechanisms and treatment strategies. N. Engl. J. Med. (1993) 328:1828–1835.[Free Full Text]
  24. Tatematsu M, et al. Stable phenotypic expression of glutathione S-transferase placental type and unstable phenotypic expression of gamma-glutamyltransferase in rat liver preneoplastic and neoplastic lesions. Carcinogenesis (1988) 9:215–220.[Abstract/Free Full Text]
  25. Pitot HC, et al. Biochemical markers associated with the stages of promotion and progression during hepatocarcinogenesis in the rat. Environ. Health Perspect. (1991) 93:181–189.[CrossRef][Web of Science][Medline]
  26. Ledda-Columbano GM, et al. Cell proliferation induced by triiodothyronine in rat liver is associated with nodule regression and reduction of hepatocellular carcinoma. Cancer Res. (2000) 60:603–609.[Abstract/Free Full Text]
  27. Chander N, et al. Liver cell turnover in rats fed a choline-devoid diet. Carcinogenesis (1987) 8:669–673.[Abstract/Free Full Text]
  28. Abramoff MD, et al. Image processing with imagej. Biophotonics Int. (2004) 11:36–42.
  29. Ledda-Columbano GM, et al. Induction of acinar cell proliferation by thyroid hormone. J. Endocrinol. (2005) 185:393–399.[Abstract/Free Full Text]
  30. Esterbauer H, et al. Determination of aldehydic lipid peroxidation products: malondialdehyde and 4-hydroxynonenal. Methods Enzymol. (2000) 186:407–421.
  31. Columbano A, et al. The thyroid hormone receptor-β agonist GC-1 induces cell proliferation in rat liver and pancreas. Endocrinology (2006) 147:3211–3218.[Abstract/Free Full Text]
  32. Hagen TM, et al. (R)-{alpha}-lipoic acid-supplemented old rats have improved mitochondrial function, decreased oxidative damage, and increased metabolic rate. FASEB J. (1999) 13:411–418.[Abstract/Free Full Text]
  33. Reddy JK, et al. Lipid metabolism and liver inflammation. II. Fatty liver disease and fatty acid oxidation. Am. J. Physiol. Gastrointest. Liver Physiol. (2005) GI290:852–858.[CrossRef]
  34. Nakae D, et al. Production of both 8-hydroxydeoxyguanosine in liver DNA and {gamma}-glutamyltransferase-positive hepatocellular lesions in rats given a choline deficient, L-amino acid defined diet. Jpn. J. Cancer Res. (1990) 81:1081–1085.[CrossRef][Web of Science]
  35. Tsutsumi M, et al. Genetic polymorphism of cytochrome P4502E1 related to the development of alcoholic liver disease. Gastroenterology (1994) 107:1430–1435.[Web of Science][Medline]
  36. Weltman MD, et al. Hepatic cytochrome P450 2E1 is increased in patients with non-alcoholic steatohepatitis. Hepatology (1998) 27:128–133.[CrossRef][Web of Science][Medline]
  37. Sanyal AJ, et al. Non-alcoholic steatohepatitis: association of insulin resistance and mitochondrial abnormalities. Gastroenterology (2001) 120:1183–1192.[CrossRef][Web of Science][Medline]
  38. Weltman MD, et al. Increased Cyp2E1 expression in a rat model of hepatic steatosis with inflammation. Gastroenterology (1996) 111:1645–1653.[CrossRef][Web of Science][Medline]
  39. Yu J, et al. COX-2 induction in mice with experimental nutritional steatohepatitis: role as pro-inflammatory mediator. Hepatology (2006) 43:826–836.[CrossRef][Web of Science][Medline]
  40. Liu H, et al. Increased cytochrome P-450 2E1 expression sensitises hepatocytes to c-jun mediated cell death from TNF-alpha. Am. J. Physiol. Gastrointest. Liver Physiol. (2002) 282:G257–G266.[Abstract/Free Full Text]
  41. Levy DE, et al. What does Stat3 do? J. Clin. Invest. (2002) 109:1143–1148.[CrossRef][Web of Science][Medline]
  42. Mudter J, et al. Activation pattern of signal transducers and activators of transcription (STAT) factors in inflammatory bowel diseases. Am. J. Gastroenterol. (2005) 100:64–72.[CrossRef][Web of Science][Medline]
  43. Han X, et al. Growth hormone inhibits signal transducer and activator of transcription 3 activation and reduces disease activity in murine colitis. Gastroenterology (2005) 129:185–203.[CrossRef][Medline]
  44. Columbano A, et al. Requirement of cell proliferation for the initiation of liver carcinogenesis as assayed by three different procedures. Cancer Res. (1981) 41:2079–2083.[Abstract/Free Full Text]
  45. Pound AW, et al. Repeated partial hepatectomies as a promoting stimulus for carcinogenic response of liver to nitrosamines in rats. Br. J. Cancer. (1978) 37:585–594.[Web of Science][Medline]
  46. Dragani TA, et al. Enhancing effect of carbon tetrachloride in mouse hepatocarcinogenesis. Cancer Lett. (1986) 31:171–179.[CrossRef][Web of Science][Medline]
  47. Takahashi T, et al. Induction of cytochrome P-4502E1 in the human liver by ethanol is caused by a corresponding increase in encoding messenger RNA. Hepatology (1993) 17:236–245.[CrossRef][Web of Science][Medline]
  48. George J, et al. Differential alterations of cytochrome P450 proteins in livers from patients with severe chronic liver disease. Hepatology (1995) 21:120–128.[CrossRef][Web of Science][Medline]
  49. Cressman DE, et al. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science (1996) 274:1379–1383.[Abstract/Free Full Text]
  50. Yamada Y, et al. Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type I tumor necrosis factor receptor. Proc. Natl Acad. Sci. USA. (1997) 94:1441–1446.[Abstract/Free Full Text]
Received July 20, 2007; revised September 5, 2007; accepted September 6, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
29/1/161    most recent
bgm205v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Perra, A.
Right arrow Articles by Columbano, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perra, A.
Right arrow Articles by Columbano, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?