Skip Navigation


Carcinogenesis Advance Access originally published online on October 4, 2007
Carcinogenesis 2008 29(1):35-43; doi:10.1093/carcin/bgm220
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
29/1/35    most recent
bgm220v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Google Scholar
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Yang, R.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Yang, R.-S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oxfordjournals.org

Involvement of matrix metalloproteinase-9 in stromal cell-derived factor-1/CXCR4 pathway of lung cancer metastasis

Chih-Hsin Tang, Tzu-Wei Tan, Wen-Mei Fu1 and Rong-Sen Yang2,*

Department of Pharmacology, China Medical University, Taichung, 404 Taiwan
1 Department of Pharmacology
2 Department of Orthopaedics, College of Medicine, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei, 100 Taiwan

* To whom correspondence should be addressed. Tel: +886 2 23123456 ext. 3958; Fax: +886 2 23936577; Email: rsyang{at}ntuh.gov.tw Correspondence may also be addressed to Wen-Mei Fu. Tel: +886 2 23123456 ext. 8319; Fax: +886 2 23417930; Email: wenmei{at}ntu.edu.tw


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Lung caner cells have a striking tendency to metastasize to bone. The chemokine stromal cell-derived factor-1 (SDF-1) is constitutively secreted by osteoblasts and bone marrow stromal cells and plays a key role for homing of hematopoietic cells to the bone marrow. Reverse transcriptase–polymerase chain reaction and flow cytometry studies demonstrated SDF-1 receptor (CXCR4) messenger RNA (mRNA) and surface expression of CXCR4 in lung cancer cell lines, especially higher in those with high invasiveness (A549) as compared with lower level in H928 cells and H1299 cells. SDF-1, osteoblast-conditioned medium (OBCM) and stromal cell-conditioned medium all induced the invasiveness of lung cancer cells. Matrix metalloproteinase (MMP)-9 small interfering RNA inhibited the SDF-1{alpha}- or OBCM-induced MMP-9 expression and thereby significantly inhibited the SDF-1{alpha}- or OBCM-induced cell invasion. Furthermore, mitogen-activated protein kinase kinase inhibitor PD98059 suppressed SDF-1{alpha}-induced MMP-9 mRNA expression. Transient transfection with dominant-negative extracellular signal-regulated kinase (ERK) mutant also showed that the ERK-signaling pathway was involved in SDF-1{alpha}-induced MMP-9 expression. Moreover, nuclear factor-{kappa}B (NF-{kappa}B) decoy oligodeoxynucleotide suppressed the MMP-9 promoter activity enhanced by SDF-1{alpha}. Both mitogen-activated protein kinase kinase inhibitor and ERK mutant also antagonized SDF-1{alpha}-induced NF-{kappa}B-driven luciferase promoter activity. Taken together, our results indicated that bone marrow-derived-SDF-1{alpha} enhances the invasiveness of lung cancer cells by increasing MMP-9 expression through the CXCR4/ERK/NF-{kappa}B signal transduction pathway.

Abbreviations: ECM, extracellular matrix; ERK, extracellular signal-regulated kinase; IKK, I{kappa}B kinase; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; MMP, matrix metalloproteinase; mRNA, messenger RNA; NF-{kappa}B, nuclear factor-{kappa}B; NSCLC, non-small cell lung cancer; OBCM, osteoblast-conditioned medium; ODN, oligonucleotide; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; SDF-1, stromal cell-derived factor-1; SDS, sodium dodecyl sulfate; siRNA, small interfering RNA


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Lung cancer ranks as the leading cause of death from cancer worldwide. Approximately 80% of lung cancers can be histologically classified as non-small cell lung cancers (NSCLCs). Most patients present with locally advanced (37%) or metastatic (38%) disease at the time of diagnosis (1). The average 5 year survival rate of these patients with advanced NSCLC remains extremely poor despite advances in chemotherapy. Thus, the high invasiveness of NSCLC to regional lymph nodes, liver, adrenal glands, contralateral lung, brain and bone marrow, etc. may play a key role in its biological virulence (1,2). Bone is one of the common sites for cancer metastasis, particularly including breast, prostate and lung cancers that have predilection for metastasis to bone (3). However, the effects of bone-derived factor on the induction of bone metastasis from lung cancer remain largely unknown.

The invasion of tumor cells is a complex, multistage process. To facilitate the cell motility, invading cells need to change the cell–cell adhesion properties, rearrange the extracellular matrix (ECM) environment, suppress anoikis and re-organize their cytoskeletons (4). Matrix metalloproteinases (MMPs) have important roles in these processes because their proteolytic activities assist in degradation of ECM and basement membrane (5,6). MMPs, cytokines, growth factors and chemokines have been shown to regulate tumor cell invasion through autocrine or paracrine pathways (4). Previous studies demonstrated the expression of MMP-1, MMP-2, MMP-9 and MMP-13 in human lung cancer cells (7,8). Of them, MMP-9 has been found to play a role in the ECM degradation associated with lung cancer metastasis (8,9).

Chemokines, structurally related, small (8–14 kDa) polypeptide signaling molecules, can bind to and activate a family of seven-transmembrane G-protein-coupled receptors, the chemokine receptors (10,11). Chemokines are expressed by many tumor types and can promote mitosis, modulate apoptosis, survival and angiogenesis (12,13). Interaction between the chemokine receptor CXCR4 and its ligand, stromal-cell-derived factor-1{alpha} (SDF-1{alpha} or CXCL12), has been found to play an important role in tumorigenicity, proliferation, metastasis and angiogenesis in many cancers, such as lung cancer, breast cancer, melanoma, glioblastoma, pancreatic cancer, cholangiocarcinoma and basal cell carcinoma cells (1425). Although the mechanisms underlying SDF-1{alpha}/CXCR4-mediated tumor invasion have been studied in some cancers (16,21,22,2629), the role of SDF-1{alpha}/CXCR4 in the process of lung cancer cells metastasizing to bone remains largely unknown.

Bone-derived growth factor and chemokines also play central roles as trophic factors that attract breast, prostate cancer cells to bone tissue (3). The SDF-1, constitutively secreted by human osteoblast and bone marrow stromal cells, has shown its key role for homing of hematopoietic cells to the marrow (30). We hypothesize that lung cancer cells express CXCR4 chemokine receptors that can mediate the homing of lung cancer cells to the bone. This study aimed to examine the role of SDF-1/CXCR4 in tumor metastasizing to bone and elucidate the underlying mechanism.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Materials
Protein A/G beads, anti-mouse and anti-rabbit IgG-conjugated horseradish peroxidase, rabbit polyclonal antibodies specific for p-ERK, p-p38, p-JNK, p-Akt, Akt, extracellular signal-regulated kinase (ERK), p38, c-Jun N-terminal kinase (JNK), p65, PCNA, IKKβ, MMP-9 and MMP-9 small interfering RNA (siRNA) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). PD98059, SB203580, SP600125 and pyrrolidine dithiocarbamate were purchased from Calbiochem (San Diego, CA). SDF-1 siRNA was purchased form Dharmacon (Lafayette, CO). Rabbit polyclonal antibody specific for CXCR4 was purchased from R&D Systems (Minneapolis, MN). Rabbit polyclonal antibodies specific for phosphor-IKK{alpha} (Ser180/181) and phosphor-p65 (Ser536) were purchased from Cell Signaling (Danvers, MA). The recombinant human SDF-1{alpha} was purchased from PeproTech (Rocky Hill, NJ). The p38 dominant-negative mutant was provided by Dr J.Han (Southwestern Medical Center, Dallas, TX). The JNK dominant-negative mutant was provided by Dr M.Karin (University of California, San Diego, CA). The ERK2 dominant-negative mutant was provided by Dr M.Cobb (Southwestern Medical Center). The human full-length CXCR4 was provided by Dr Jun Komano (National Institute of Infectious Diseases, Japan). The constitutively active mitogen-activated protein kinase kinase 1 mutant construct (substitution of the regulatory phosphorylation sites S218D and S222D) as described previously (31) was provided by Dr M.L.Kuo (National Taiwan University, Taipei, Taiwan). pSV-β-galactosidase vector and luciferase assay kit were purchased from Promega (Madison, MA). All other chemicals were obtained from Sigma-Aldrich (St Louis, MO).

Cell culture
The human lung adenocarcinoma cell lines (A549, H928, H1299), human osteosarcoma cell line (MG-63) and murine stromal cell line (M2-10B4) were obtained from the American Type Culture Collection (Rockville, MD). The cells were maintained in RPMI-1640 medium which was supplemented with 20 mM 4-(2-Hydroxyethyl) piperazine-1-ethanesulfonic acid and 10% heat-inactivated fetal calf serum, 2 mM glutamine, penicillin (100 U/ml) and streptomycin (100 µg/ml) at 37°C with 5% CO2.

Preparation of conditioned medium
Human osteosacroma cell (MG-63) or murine stromal cell (M2-10B4) was grown to confluence. On reaching confluence, culture media were changed with RPMI without fetal calf serum. Conditioned media were collected 2 days after the change of media and stored at –70°C until use.

Invasion assay
The chemoinvasion assay was performed using Boyden chambers with filter inserts (pore size, 8 µm) coated with Matrigel (40 µg; Collaborative Biomedical, Becton Dickinson Labware, Lincoln Park, NJ) in 24-well dishes (Nucleopore, Pleasanton, CA). Before performing the invasion assay, cells were pretreated for 30 min with different concentrations of inhibitors, including the CXCR4-neutralizing antibody 12G5, isotype control antibody, AMD 3100, PD98059, SB203580, SP600125 or vehicle control (dimethyl sulfoxide). Approximately, 2 x 104 cells in 100 µl of serum-free RPMI-1640 medium were placed in the upper chamber, and 1 ml of the same medium containing 200 ng/ml SDF-1{alpha} was placed in the lower chamber. The plates were incubated for 24 h at 37°C in 5% CO2, then cells were fixed in methanol for 15 min and stained with 0.05% crystal violet in phosphate-buffered saline (PBS) for 15 min. Cells on the upper side of the filters were removed with cotton-tipped swabs, and the filters were washed with PBS. Cells on the underside of the filters were examined and counted under a microscope. Each clone was plated in triplicate in each experiment, and each experiment was repeated at least three times. The number of invading cells in each experiment was adjusted by the cell viability assay to correct for proliferation effects of the SDF-1{alpha} treatment (corrected invading cell number = counted invading cell number/percentage of viable cells) (32).

Zymography analysis
The supernatants of A549 cells were mixed with sample buffer without reducing agent or heating. The sample was loaded into a gelatin (1 mg/ml) containing sodium dodecyl sulfate (SDS)–polyacrylamide gel and underwent electrophoresis with constant voltage. Afterwards, the gel was washed with 2.5% Triton X-100 to remove SDS, rinsed with 50 mM Tris–HCl, pH 7.5 and then incubated overnight at room temperature with the developing buffer (50 mM Tris–HCl, pH 7.5, 5 mM CaCl2, 1 µM ZnCl2, 0.02% thimerosal, 1% Triton X-100). The zymographic activities were revealed by staining with 1% Coomassie Blue. The sample was also loaded into SDS–polyacrylamide gel and staining with 1% Commassie Blue as loading control.

Flow cytometric analysis
Human lung cancer cells were plated in six-well dishes. The cells were then washed with PBS and detached with trypsin at 37°C. Cells were fixed for 10 min in PBS containing 1% paraformaldehyde. After rinsing in PBS, the cells were incubated with rabbit anti-human antibody against CXCR4 (1:100) for 1 h at 4°C. Cells were then washed again and incubated with fluorescein isothiocyanate-conjugated goat anti-rabbit secondary IgG (1:150; Leinco Technologies, St Louis, MO) for 45 min and analyzed by flow cytometry using FACSCalibur and CellQuest software (BD Biosciences, San Jose, CA) (33).

Western blot analysis
Proteins in the total cell lysate (30 µg of protein) were separated by 10% SDS–polyacrylamide gel electrophoresis and electrotransferred to a polyvinylidene difluoride membrane (Immobilon-P membrane; Millipore, Bedford, MA). After the blot was blocked in a solution of 4% bovine serum albumin, membrane-bound proteins were probed overnight with primary antibodies against CXCR4, MMP-9, p-ERK, p-p38, p-JNK or p-Akt followed by incubation with horseradish peroxidase-conjugated secondary antibodies for 1 h. Antibody-bound protein bands were detected with enhanced chemiluminescence reagents (Amersham Pharmacia Biotech, Piscataway, NJ) and photographed with Kodak X-OMAT LS film (Eastman Kodak, Rochester, NY). Quantitative data were obtained using a computing densitometer and ImageQuant software (Molecular Dynamics, Sunnyvale, CA).

Oligonucleotide transfection
Cells were cultured to confluence; the complete medium was replaced with Opti-MEM (Invitrogen, Ghent, Belgium) containing the anti-sense phosphorothioate oligonucleotides (ODNs) (5 µg/ml) that had been pre-incubated with Lipofectamine 2000 (10 µg/ml) (Invitrogen) for 30 min. The cells were washed after 24 h of incubation at 37°C and washed prior to the addition of medium containing SDF-1{alpha}. All anti-sense ODNs were synthesized and high-pressure liquid chromatography purified by MDBio (Taipei, Taiwan). The sequences used are as follows: p65 anti-sense ODN, GGGGAACAGTTCGTCCATGGC and missense ODN, GCCATGGACGAACTGTTCCCC (34).

Generation of DNA constructs encoding a siRNA against human CXCR4
ODNs against human CXCR4 genes were generated and cloned into a pSilencer 3.1-H1 vector (Ambion, Austin, TX), as described (32,35). We used the Lipofectamine 2000 reagent to transfect the cells with pSilencer 3.1-H1-siCXCR4 or pSilencer 3.1-H1-siCXCR4-mut. Twenty-four hours after transfection, cells were replated in RPMI-1640 with 10% fetal calf serum.

Synthesis of nuclear factor-{kappa}B and AP-1 decoy ODNs
We used a phosphorothioate double-stranded decoy ODN carrying the nuclear factor-{kappa}B (NF-{kappa}B)/Rel-consensus sequence 5'-CCTTGAA GGGATTTCCCTCC-3'/3'-GGAACTTCCCTAAAGGGAGG-5'. The activator protein-1 decoy ODN sequence was 5'-TGTCTGACTCATGTC-3'/3'-ACAGACTGAGTACAG-5'. The mutated (scrambled) form 5'-TTGCCGTACCTGACTTAGCC-3'/3'-AACGGCATGGACTGAATCGG-5' was used as a control. ODN (5 µM) was mixed with Lipofectamine 2000 (10 µg/ml) for 25 min at room temperature, and the mixture was added to cells in serum-free medium. After 24 h of transient transfection, the cells were used for the following experiments (36).

MMP-9 promoter assay
We generated promoter constructs of human MMP-9 genes according to the previous reports (36). The primers used for polymerase chain reactions (PCRs) for MMP-9 promoter construct were as follows: 5' primer, 5'-ACAATCGAGCTCCTGAAGGAAGAGAGTAAGC-3' (forward/SacI; nucleotides); the 3' primer, 5'-AATCCCAAGCTTATGGTGAGGGCAGAGGTG-3' (reverse/HindIII; nucleotides). The pGL3-Basic vector containing a polyadenylation signal upstream from the luciferase gene was used to construct expression vectors by subcoloning PCR-amplified DNA to MMP-9 promoter into the SacI/HindIII site of the pGL3-Basic vector. The PCR products were confirmed on the basis of their size as determined by electrophoresis and DNA sequencing. A549 cells were transiently transfected with MMP-9 promoter plasmid using Lipofectamine 2000 reagent. Luciferase activity was measured with the Luciferase Reporter Assay system (Promega) as described by the manufacturer, using a Turner Designs model TD-70/20 Luminometer (37).

Messenger RNA analysis by reverse transcriptase–PCR
Total RNA was extracted from cancer cells using a TRIzol kit (MDBio). The reverse transcription reaction was performed using 2 µg of total RNA that was reversely transcribed into cDNA using oligo(dT) primer, then amplified for 33 cycles using two ODN primers: MMP-1 sense CGACTCTAGAAACACAAGAGCAAGA and anti-sense AAGGTTAGCTTACTGTCACACGCTT; MMP-2 sense GTGCTGAAGGACACACTAAAGAAGA and anti-sense TTGCCATCCTTCTCAAAGTTGTAGC; MMP-9 sense CACTGTCCACCCCTCAGAGC anti-sense GCCACTTGTCGGCGATAAGC; MMP-13 sense TGCTCGCATTCTCCTTCAGGA and anti-sense ATGCATCCAGGGGTCCTGGC; CXCR4 sense AATCTTCCTGCCCACCATCT and anti-sense GACGCCAACATAGACCACCT; glyceraldehyde-3-phosphate dehydrogenase sense ACCACAGTCCATGCCATCAC and anti-sense TCCACCACCCTGTTGCTGTA.

Each PCR cycle was carried out for 30 s at 94°C, 30 s at 55°C and 1 min at 68°C.

PCR products were then separated electrophoretically in a 2% agarose DNA gel and stained with ethidium bromide (32,36).

Statistics
The values given are means ± SEM. The significance of difference between the experimental groups and controls was assessed by Student's t-test. The difference is significant if the P value is <0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Expression of CXCR4 messenger RNA and surface protein in human lung cancer cell lines
SDF-1 is a powerful chemoattractant cytokine that stimulates directional migration of hematopoietic and non-hematopoietic cells. We examined human lung cancer cell lines for expression of the SDF-1 receptor (CXCR4) by reverse transcriptase–PCR, western blot and flow cytometry, respectively. CXCR4 messenger RNA (mRNA) was detected in human lung cancer cell lines (Figure 1A). Western blot and flow cytometry revealed a higher level expression of CXCR4 on A549 cells and lower level on H928 cells (Figure 1A and B). In addition, A549 cells were more invasive than H928 and H1299 cells (Figure 1C). Over-expression of human full-length CXCR4 also increased the chemoinvasion in H928, H1299 and A549 cells (supplementary Figure S1 is available at Carcinogenesis Online). Thus, expression of CXCR4 was associated with an invasive and/or metastatic phenotype of lung cancer cell lines.


Figure 1
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Expression of CXCR4 by different human lung cancer cell lines. Total RNA or proteins were extracted from H928, H1299 and A549 cells lines and subjected to western blot or reverse transcriptase–PCR analysis for CXCR4 (A). Human lung cancer cell lines were cultured for 2 days, and the cell surface expression CXCR4 was analyzed by flow cytometry (B). The results showed a significantly higher expression of CXCR4 in A549 cell lines as compared with H928 or H1299 cell lines. The invasion activity of each cell line measured in vitro with the Boyden chamber after 24 h showed a significantly higher invasion activity in A549 cell lines as compared with H928 or H1299 cells (C). Results are expressed as the mean ± SEM (n = 4).

 
SDF-1{alpha}/CXCR4 interaction directs the chemoinvasion of lung cancer cells
The importance of the interaction between SDF-1{alpha} and CXCR4 for lung cancer cell invasiveness was examined using the Boyden chamber assay. SDF-1{alpha} dose dependently directed the chemoinvasion of lung cancer cells (A549 cell) (Figure 2A). It has been demonstrated that human osteoblasts and bone marrow stromal cells are the key elements in the bone that express SDF-1 (30). Both osteoblast-conditioned medium (OBCM) and stromal cell-conditioned medium also supported the invasion activity of lung cancer cells (Figure 2A). In addition, pretreatment of cells with the CXCR4-neutralizing antibody (12G5) or a specific inhibitor, AnorMED (AMD) 3100, inhibited SDF-1{alpha}-induced cells invasion (Figure 2B). Transient transfection of small siRNA against CXCR4, but not a mutant form of siCXCR4 (siCXCR4-mut), effectively inhibited A549 cells chemoinvasion directed by SDF-1{alpha} (Figures 2C–E). It is well established that osteoblasts and stromal cells can synthesize and secrete SDF-1{alpha}, which play important roles in prostate cancer metastasizing to bone (30). Human osteoblasts cells (MG-63) were transfeted with control or SDF-1 siRNA, and then their OBCM was collected. The expression of SDF-1 was suppressed by transfection with SDF-1 siRNA (Figure 2F). Additionally, SDF-1 siRNA could markedly block the OBCM-induced chemoinvasion in A549 cells (Figure 2G). Meanwhile, stromal cell-conditioned medium from stromal cells transfected with SDF-1 siRNA exerted similar inhibitory effect on the invasion of A549 cells (Figure 2H). These data suggest that SDF-1 secreted from bone cells (including osteoblasts and stromal cells) plays a key role in lung cancer cell metastasizing to bone.


Figure 2
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. SDF-1{alpha}/CXCR4-directed chemoinvasion of human lung cancer cells. A549 cells were incubated with various concentrations of SDF-1{alpha}, osteoblast-conditioned medium (OBCM) or stromal cell-conditioned medium (SCCM), and in vitro invasion activities measured with the Boyden chamber after 24 h showed all increase the invasion of A549 cells in a dose-dependent manner (A). Cells were pretreated with CXCR-4-neutralizing 12G5 antibody, AMD 3100 and isotype antibody for 30 min followed by stimulation with SDF-1{alpha} (200 ng/ml). The in vitro invasion activity measured after 24 h showed that CXCR-4-neutralizing 12G5 antibody and AMD 3100 could inhibit the activities (B). Cells were transfected with siCXCR4 or siCXCR4-mut for 24 h; the reverse transcriptase–PCR and western blot analysis showed that RNA or protein levels of CXCR4 were suppressed by treatment with siCXCR4 (C). Cells were transfected with siCXCR4 or siCXCR4-mut siRNA for 24 h followed by stimulation with SDF-1{alpha} (200 ng/ml) or OBCM (75%). The in vitro invasion measured with the Boyden chamber after 24 h showed the suppressed invasion activities by siCXCR4 in both conditions (D and E). Osteoblasts (MG63) were transfected with SDF-1{alpha} or control siRNA for 24 h. The RNA or protein levels of SDF-1{alpha} determined by using reverse transcriptase–PCR and western blot analysis were suppressed after transfection with SDF-1 siRNA (F). Osteoblasts or stromal cells were transfected with SDF-1{alpha} or control siRNA for 24 h, the medium was collected as conditioned medium, and in vitro invasion was measured with the Boyden chamber after 24 h. SDF-1 siRNA markedly suppressed the OBCM- or SCCM-induced chemoinvasion in A549 cells (G and H). Results are expressed as the mean ± SEM. *P < 0.05 compared with control; #P < 0.05 compared with OBCM- or SCCM-treated group.

 
Involvement of MMP-9 in the SDF-1{alpha}/CXCR4-directed lung cancer cells chemoinvasion
Previous studies have shown a significant expression of MMP-1, -2, -9 and -13 in lung cancer cells (7,8). We therefore, hypothesized that any of these human lung cancer cells-associated MMPs may be involved in SDF-1{alpha}/CXCR4-directed lung cancer cells chemoinvasion. Reverse transcriptase–PCR analysis showed that SDF-1{alpha} significantly increased the expression of MMP-9 mRNA, starting at 2 h and peaking at 12 h (Figure 3A). SDF-1{alpha} also slightly increased the expression of MMP-13 mRNA in A549 cells (Figure 3A). Furthermore, SDF-1{alpha} further increased protein expression of MMP-9 in A549 cells in a time-dependent manner (Figure 3B). MMP-9 expression was also increased in the supernatant, and its enzyme activity was up-regulated at 4 h and peaked at 24 h (Figure 3B). MMP-9 transcription and gelatinase activity was abolished by SDF-1{alpha} inhibitors, including AMD 3100, 12G5 Ab and siCXCR4, whereas a control antibody and siCXCR4-mut had no effect (Figure 3C), confirming the involvement of SDF-1{alpha} in MMP-9 regulation. Cells were transfected with MMP-9 or control siRNA for 24 h; the reverse transcriptase–PCR and western blot analysis showed that the SDF-1{alpha}-induced expression of RNA or protein levels of MMP-9 was suppressed by transfection with MMP-9 siRNA (Figure 3D). MMP-9 siRNA specifically inhibited the expression of MMP-9 but not MMP-1, -2 and -13 (supplementary Figure S2 is available at Carcinogenesis Online). SDF-1{alpha}/CXCR4-directed lung cancer cells chemoinvasion was significantly inhibited by a selective MMP-9 siRNA but not by the control siRNA (Figure 3E), demonstrating the role of MMP-9 in this invasion process. In addition, MMP-9 siRNA also antagonized OBCM-induced chemoinvasion in A549 cells (Figure 3F).


Figure 3
View larger version (47K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. SDF-1{alpha}/CXCR4-directed chemoinvasion of human lung cancer cells involves up-regulation of MMP-9. A549 cells were incubated with SDF-1{alpha} (200 ng/ml) for indicated time intervals, cell lysates were then collected and the mRNA level of MMP-1, -2, -9 and -13 was determined using reverse transcriptase–PCR (A). Both MMP-9 mRNA and MMP-13 mRNA were increased by SDF-1{alpha}. Cells were incubated with SDF-1{alpha} (200 ng/ml) for indicated time intervals. The cultured medium and cell lysates were then collected. Both the protein level of MMP-9 in supernatant determined by western blot analysis and the enzyme activity of MMP-9 in cell lysates and supernatant determined using zymography were increased in a time-dependent manner (B). Cells were pretreated with AMD 3100 (500 ng/ml), 12G5 antibody (10 µg/ml) and isotype antibody for 30 min or transfected with siCXCR4-mut and siCXCR4 siRNA for 24 h followed by stimulation with SDF-1{alpha} (200 ng/ml) for 24 h, and the mRNA level and enzyme activity of MMP-9 was determined by using reverse transcriptase–PCR and zymography analysis, respectively. MMP-9 transcription and gelatinase activity were abolished by SDF-1{alpha} inhibitors, including AMD 3100, 12G5 Ab and siCXCR4, whereas a control antibody and siCXCR4-mut had no effect (C). Cells were transfected with MMP-9 or control siRNA for 24 h, the reverse transcriptase–PCR and western blot analysis showed the inhibitory effect of MMP-9 siRNA on the SDF-1{alpha}-induced expression of the MMP-9 mRNA or protein (D). Cells were transfected with MMP-9 or control siRNA for 24 h followed by stimulation with SDF-1{alpha} (200 ng/ml) or OBCM (75%), and in vitro invasion measured with the Boyden chamber after 24 h showed the inhibitory effects of the MMP-9 siRNA in the cell invasion activity induced by SDF-1{alpha} (E and F). Results are expressed as the mean ± SEM. *P < 0.05 compared with control; #P < 0.05 compared with SDF-1{alpha}-treated group.

 
ERK1/2 and NF-{kappa}B-signaling pathways are involved in the SDF-1{alpha}-mediated MMP-9 up-regulation and chemoinvasion of the lung cancer cells
As SDF-1{alpha}/CXCR4 interaction has been shown to activate several signaling pathways, including phosphatidylinositol 3-kinase/protein kinase B (Akt) and mitogen-activated protein kinase (MAPK), in various cancer cell lines (17,1921), we performed western blot analysis to elucidate the signal transduction mechanisms involved in the SDF-1{alpha}-induced up-regulation of MMP-9. SDF-1{alpha} activated the ERK1/2 pathway in A549 cells, as evidenced by the increase in phosphorylated p42 and p44 (p-ERK1/2) at 15 min and peaked at 60 min (Figure 4A). Other signaling pathways including JNK, p38 MAPK and Akt were not activated up to 4 h after treatment. SDF-1{alpha}-induced mRNA expression and gelatinase activity of MMP-9 were greatly reduced by treatment with PD98059, a specific mitogen-activated protein kinase kinase inhibitor but was not affected by either SB203580 (a p38 MAPK inhibitor) or SP600125 (a JNK inhibitor; Figure 4B). In addition, transfection of cells with ERK2 mutant but not p38 and JNK mutant also inhibited SDF-1{alpha}-induced MMP-9 activity (Figure 4C). Transfection with ERK2 mutant did not affect the proliferation and distribution of cell cycle in A549 cells (supplementary Figure S4 is available at Carcinogenesis Online). These data suggest that transfection with ERK2 mutant did not affect the proliferation or induce transformed state in A549 cells. On the other hand, over-expression of constitutively active mitogen-activated protein kinase kinase 1 also increased the chemoinvasion in H928, H1299 and A549 cells (supplementary Figure S1 is available at Carcinogenesis Online). Because the promoter region of human MMP-9 contains a NF-{kappa}B-binding site and phosphorylation of ERK can lead to NF-{kappa}B activation (38), we further examined the activation of I{kappa}B kinase (IKK) and NF-{kappa}B component p65 after SDF-1{alpha} treatment. As shown in Figure 4D, treatment of A549 cells with SDF-1{alpha} resulted in a time-dependent phosphorylation of IKK at Ser180/181 and p65 at Ser536. SDF-1{alpha} also induced the nuclear accumulation of phosphorylated p65 in the nucleus (Figure 4E). SDF-1{alpha}-induced mRNA expression and gelatinase activity of MMP-9 were inhibited by p65 anti-sense ODN but not by missense ODN (Figure 4F). SDF-1{alpha}/CRCX4-directed A549 chemoinvasion was effectively inhibited by PD98059, ERK2 mutant and p65 anti-sense ODN, but not by SB203580, SP600125 or p38 and JNK mutant or p65 missense ODN (Figure 4G). These results indicate that ERK/NF-{kappa}B-signaling pathway is involved in SDF-1{alpha}-induced MMP-9 expression and chemoinvasion.


Figure 4
View larger version (53K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. Signal transduction mechanisms involved in SDF-1{alpha}-mediated MMP-9 up-regulation in human lung cancer cells. (A) Cells were incubated with SDF-1{alpha} (200 ng/ml) for indicated time intervals, and p-ERK, p-p38, p-JNK or p-Akt expression was determined by western blot analysis. SDF-1{alpha} activated the extracellular signal-related kinase 1/2 (ERK1/2) pathway in A549 cells, as evidenced by the increase in phosphorylated p42 and p44 (p-ERK1/2) at 15 min and peaked at 60 min, but not JNK, p38 MAPK. (B and C) Cells were pretreated for 30 min with PD98059 (30 µM), SB203580 (10 µM) and SP600125 (10 µM) or transfected with dominant-negative (DN) mutant of ERK, p38 and JNK for 24 h followed by stimulation with SDF-1{alpha} (200 ng/ml) for 24 h, the mRNA level and enzyme activity of MMP-9 was determined by using reverse transcriptase–PCR and zymography analysis, respectively. SDF-1{alpha}-induced mRNA expression and gelatinase activity of MMP-9 were greatly reduced by PD98059, but not by SB203580 or SP600125. Transfection of cells with ERK2 mutant, but not p38 and JNK mutant, inhibited SDF-1{alpha}-induced MMP-9 activity. (D) Cells were incubated with SDF-1{alpha} (200 ng/ml) for indicated time intervals, and p-IKK or p-p65 was determined by western blot analysis. Treatment of A549 cells with SDF-1{alpha} resulted in a time-dependent phosphorylation of IKK at Ser180/181 and p65 at Ser536. (E) Cells were incubated with SDF-1{alpha} (200 ng/ml) for indicated time intervals, and nuclear accumulation of phosphorylated p65 in the nucleus was increased by SDF-1{alpha} time dependently. (F) Anti-sense of p65 oligonucleotide (AS ODN), but not missense oligonucleotide (MS ODN), abolished SDF-1{alpha}-induced up-regulation of MMP-9 mRNA and gelatinase activity in human A549 cells. (G) Cells were pretreated for 30 min with PD98059 (30 µM), SB203580 (10 µM) and SP600125 (10 µM) or transfected with dominant-negative mutant of ERK, p38 and JNK or p65 AS ODN and MS ODN for 24 h followed by stimulation with SDF-1{alpha} (200 ng/ml), and in vitro invasion was measured with the Boyden chamber after 24 h. The results showed that SDF-1{alpha}/CRCX4-directed A549 chemoinvasion was inhibited by PD98059, ERK2 mutant and p65 AS ODN, but not by SB203580, SP600125 or p38 and JNK mutant, or p65 MS ODN. Results are expressed as the mean ± SEM. *P < 0.05 compared with control; #P < 0.05 compared with SDF-1{alpha}-treated group.

 
ERK signal transduction-mediated NF-{kappa}B activation is involved in SDF-1{alpha}-induced MMP-9 expression
The regulatory effect of SDF-1 effect on the expression of MMP-9 was investigated at the transcriptional level using a luciferase reporter plasmid containing a 0.7 kb segment at the 5'-flanking region of the human MMP-9 promoter region. There are NF-{kappa}B- and AP-1-binding sites on this MMP-9 promoter region (36). Treatment with SDF-1{alpha} led to a 3.0-fold increase in MMP-9 promoter activity in A549 cells (Figure 5A). The increase of MMP-9 promoter activity by SDF-1{alpha} was antagonized by cis element decoy agonist NF-{kappa}B-binding site (decoy NF-{kappa}B ODN) but not by AP-1-binding site (decoy AP-1 ODN) or scrambled decoy (ODN) (Figure 5A). Our next step was to test whether ERK signaling is involved in SDF-1{alpha}-induced NF-{kappa}B activity, using a NF-{kappa}B-binding site-driven luciferase activity assay. As shown in Figure 5B, pretreatment with PD98059 or transfection with ERK mutant of A549 cells inhibited the SDF-1{alpha}-induced increase in NF-{kappa}B promoter activity. In addition, pretreatment with PD98059 (10 or 30 µM) also inhibited the SDF-1{alpha}-induced chemoinvasion of lung cancer cells, MMP-9 and NF-{kappa}B-driven promoter activity (supplementary Figure S3A and B is available at Carcinogenesis Online). The high concentration of PD98059 (30 µM) did not affect the cell viability of A549 cells (supplementary Figure S3C is available at Carcinogenesis Online). Pretreatment of cells with PD98059 (10 or 30 µM) completely inhibited SDF-1{alpha}-induced ERK phosphorylation (supplementary Figure S3E is available at Carcinogenesis Online). These data suggest that ERK-signaling pathway is involved in SDF-1{alpha}-induced NF-{kappa}B activation. Finally, the involvement of ERK signaling and NF-{kappa}B in SDF-1{alpha}-induced MMP-9 expression was confirmed by the measurement of promoter activity of MMP-9 by luciferase assay. The SDF-1{alpha}-induced increase in MMP-9 promoter activity was inhibited by pretreatment with PD98059 or PDTC (NF-{kappa}B inhibitor) or transfection with ERK2 mutant (Figure 5C). In addition, pretreatment of A549 cells with PD98059 or PDTC also inhibited OBCM or stromal cell-conditioned medium-increased MMP-9 luciferase activity (Figure 5D). Taken together, these data suggest that ERK/NF-{kappa}B-signaling pathway is required for SDF-1{alpha}-induced MMP-9 expression and chemoinvasion in lung cancer cells.


Figure 5
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. SDF-1{alpha} induces MMP-9 up-regulation through NF-{kappa}B activation. (A) The MMP-9 promoter activity was evaluated by transfection with the MMP-9-Luc luciferase expression vector. Cells were transfected with MMP-9 promoter plasmid for 24 h, and were pretreated with NF-{kappa}B ODN, AP-1 ODN or scramble ODN for 30 min before incubation with SDF-1{alpha} (200 ng/ml) for 24 h. The SDF-1{alpha}-induced MMP-9 promoter activity was antagonized by cis element decoy agonist NF-{kappa}B-binding site (decoy NF-{kappa}B ODN) but not by AP-1-binding site (decoy AP-1 ODN) or scrambled decoy (ODN). (B) Cells were pretreated with PD98059 (30 µM) for 30 min or co-transfected with NF-{kappa}B-Luc and with ERK mutant for 24 h before incubation with SDF-1{alpha} (200 ng/ml) for 24 h. Pretreatment of A549 cells with PD98059 or transfection with ERK mutant suppressed the SDF-1{alpha}-induced increase in NF-{kappa}B luciferase activity. (C) Cells were pretreated with PD98059 (30 µM) and PDTC (60 µM) for 30 min or co-transfected with MMP-9-Luc and with ERK mutant for 24 h before incubation with SDF-1{alpha} (200 ng/ml) or OBCM (75%) for 24 h. Luciferase activity was measured, and the results were normalized to the β-galactosidase activity. Pretreatment with PD98059 or PDTC (NF-{kappa}B inhibitor) or transfection with ERK2 mutant suppressed the SDF-1{alpha}-induced increase in MMP-9 luciferase activity (C) and pretreatment of A549 cells with PD98059 or PDTC also inhibited OBCM or stromal cell-conditioned medium-increased MMP-9 luciferase activity (D). Data are expressed as the mean ± SEM for three independent experiments performed in triplicate. *P < 0.05 compared with control; #P < 0.05 compared with SDF-1{alpha}- or OBCM-treated group.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Lung cancer is by far the most common cause of cancer-related death in the world (39). This high mortality is probably attributable to early metastasis, principally spreading malignant cells to many tissues including bone, especially for NSCLC (3). Accordingly, there is a growing interest in early detecting and screening of lung cancer as well as investigating the possible mechanisms of metatstasis. We hypothesized that SDF-1 and its CXCR4 receptor would help to direct the bone-specific metastasis of lung cancer cells. We found that human lung cancer cells express CXCR4, whereas SDF-1{alpha} is expressed by osteoblasts and stromal cells. One of the mechanisms underlying SDF-1{alpha}/CXCR4-directed chemoinvasion was transcriptional up-regulation of MMP-9 and activation of ERK and NF-{kappa}B pathways.

Enzymatic degradation of ECM is one of the crucial steps in cancer invasion and metastasis. In human lung cancer, MMP-1, -2, -9 and -13 have been found to correlate with malignant grade and metastasis (7,8). Our data show that the enhanced invasiveness is specific for gelatin, the substrate of MMP-9 (gelatinase B). MMP-9 is synthesized by cancer cells and plays an important role in tumor cell invasion, metastasis and angiogenesis in lung cancer cells (9). Previous studies have shown that SDF-1{alpha}/CXCR4 interactions modulate cell migration and invasion in several cancer cells (2124,2629,40). SDF-1{alpha}-mediated invasion may involve the activation and secretion of MMP-2 and/or MMP-9 (21,27), membrane-type 1 MMP (MT1-MMP; MMP-14) (22,26) and MT2-MMP (28). Prostate cancer cells have also been shown to migrate and invade through ECM components in response to SDF-1{alpha}–CXCR4 interactions, which were associated with enhanced expressions of mRNAs and active proteins of MMP-1, -2, -3, -9, -11 and MT1-MMP (MMP-14) in PC3 cells, as well as enhanced expressions of mRNAs and active proteins of MMP-1, -2 and -10 in LNCaP cells (40). It has been reported that MMP-13 plays important role in SDF-1{alpha}-induced chemoinvasion in human basal cell carcinoma cells (32). In this study, we found that SDF-1{alpha} slightly induced the MMP-13 expression in lung cancer cells. Whether MMP-13 is involved in lung cancer cells metastasizing to bone needs further investigation. In contrast to this report, we found that SDF-1{alpha} induced MMP-9 expression and secretion in human cancer cells without significantly changing the expression of MMP-1, -2 and -13 mRNAs, which were MMPs expressed in human lung cancer cells (7,8). In addition, the inhibition of SDF-1{alpha}-enhanced MMP-9 protein expression with siRNA significantly suppressed SDF-1{alpha}-induced invasion. Therefore, MMP-9 may be the SDF-1{alpha}-responsive mediator, and it causes the degradation of ECM that may lead to subsequent cancer invasion and metastasis.

A variety of growth factors stimulate the expression of MMP genes via signal transduction pathways that converge to activate NF-{kappa}B complex of transcription factors. MAPK pathways ERK1/2, JNK and p38 induce the expression of NF-{kappa}B transcription factors (41). We found that SDF-1{alpha} enhanced ERK1/2 phosphorylation without obvious changes of the phosphorylation of Akt and other MAPK pathways (e.g. JNK and p38 MAPK pathways) in human lung cancer cells. Previous studies have revealed that SDF-1{alpha} treatment activates ERK1/2 in human lung cancer cells, astrocytes and glioblastoma cells (17,19,20,42). The SDF-1{alpha}-directed lung cancers invasion was effectively inhibited by PD98059, but not by SB203580 and SP600125. This was further confirmed by the results that the dominant-negative mutant of ERK, but not p38 and JNK, inhibited the enhancement of MMP-9 expression by SDF-1{alpha}. Recently, hepatitis B viral HBx was shown to induce MMP-9 gene expression through the activation of the ERK and Akt pathways (43). Yao et al. (44) demonstrated that minocycline exerted its inhibitory effect on angiogenesis by suppressing MMP-9 mRNA transcription and down-regulating both ERK and Akt signal pathways. Liang et al. (45) suggested that ERK pathway was required for the interleukin-1-induced MMP-9 expression. Our data indicate that ERK might play an important role in the expression of MMP-9 and invasiveness of human lung cancer cells.

There are multiple transcription factor consensus binding motifs in the MMP-9 promoter, including NF-{kappa}B, SP-1, Ets, AP-1 and a retinoblastoma-binding element (46). To date, two transcription factors (NF-{kappa}B and AP-1) appear to be responsive to the SDF-1 (32,47). In this study, NF-{kappa}B but not AP-1, modulated the SDF-1{alpha}-induced MMP-9 activity in lung cancer cells on zymography. We further demonstrated that ERK was involved in the SDF-1{alpha}-induced NF-{kappa}B activity in lung cancer cells. This pathway also exists in the other cell models. Huang (38) showed the inhibitory effects of carnosol on the migration and invasion of melanoma cells mainly resulted from a reduced MMP-9 expression, which was mediated through suppressing the ERK1/2, Akt, p38 and JNK pathways and inhibiting NF-{kappa}B-binding activities. Moreover, SDF-1{alpha} regulating prostate cancer cells migration also acts through ERK-dependent NF-{kappa}B activation (48).

In conclusion, we present here a novel mechanism of SDF-1{alpha}/CXCR4-directed invasion of lung cancer cells by up-regulation of both MMP-9 mRNA and MMP-9 active protein. The identification of SDF-1{alpha} from bone (including osteoblasts and bone marrow stromal cells) as a potential stimulatory factor of MMP-9 during human cancer cell invasion to bone may help understand the mechanisms involved in the aggressive potential of human lung cancer cells (Figure 6). In addition, the identification of SDF-1{alpha}/CXCR4 interaction as an important factor in the invasiveness of human lung cancer cells may implicate potential therapeutic approaches for bone metastasis from lung cancer.


Figure 6
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. Schematic presentation of the signaling pathways involved in SDF-1{alpha}-induced MMP-9 expression in lung cancer cells. SDF-1{alpha} from bone (including osteoblasts and bone marrow stromal cells) acts through CXCR4 to activate MAPK, especially ERK, leading to the phosphorylation of IKK and p65, resulting in the activation of NF-{kappa}B element on the human MMP-9 promoter and the initiation of MMP-9 expression. This MMP-9 induction increases the cell invasion of lung cancer cells.

 

    Supplementary material
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Supplementary Figures S1–4 can be found at http://carcin.oxfordjournals.org/


    Funding
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
National Science Council of Taiwan (96-2320-B-039-028-MY3); China Medical University (CMU 95-309).


    Acknowledgments
 
We thank Dr J.Han for providing p38 dominant-negative mutant, Dr M.Karin for providing JNK dominant-negative mutant, Dr M.Cobb for providing ERK2 dominant-negative mutant, Dr Jun Komano for providing human full-length CXCR4 and Dr M.L.Kuo for providing constitutively active mitogen-activated protein kinase kinase 1.

Conflict of Interest statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 

  1. Jemal A, et al. Cancer statistics, 2005. CA Cancer J. Clin. (2005) 55:10–30.[Abstract/Free Full Text]
  2. Gridelli C, et al. Treatment of non-small-cell lung cancer: state of the art and development of new biologic agents. Oncogene (2003) 22:6629–6638.[CrossRef][Web of Science][Medline]
  3. Mundy GR. Metastasis to bone: causes, consequences and therapeutic opportunities. Nat. Rev. Cancer (2002) 2:584–593.[CrossRef][Web of Science][Medline]
  4. Woodhouse EC, et al. General mechanisms of metastasis. Cancer (1997) 80:1529–1537.[CrossRef][Web of Science][Medline]
  5. Egeblad M, et al. New functions for the matrix metalloproteinases in cancer progression. Nat. Rev. Cancer (2002) 2:161–174.[Web of Science][Medline]
  6. Kerkelä E, et al. Matrix metalloproteinases in tumor progression: focus on basal and squamous cell skin cancer. Exp. Dermatol. (2003) 12:109–125.[CrossRef][Web of Science][Medline]
  7. Ohbayashi H. Matrix metalloproteinases in lung diseases. Curr. Protein Pept. Sci. (2002) 3:409–421.[CrossRef][Web of Science][Medline]
  8. Hsu CP, et al. Matrix metalloproteinase-13 expression is associated with bone marrow microinvolvement and prognosis in non-small cell lung cancer. Lung Cancer (2006) 52:349–357.[CrossRef][Web of Science][Medline]
  9. Rao JS, et al. Inhibition of invasion, angiogenesis, tumor growth, and metastasis by adenovirus-mediated transfer of antisense uPAR and MMP-9 in non-small cell lung cancer cells. Mol. Cancer Ther. (2005) 4:1399–1408.[Abstract/Free Full Text]
  10. Murphy PM. Chemokine receptors: structure, function and role in microbial pathogenesis. Cytokine Growth Factor Rev. (1996) 7:47–64.[CrossRef][Medline]
  11. Zlotnik A, et al. Chemokines: a new classification system and their role in immunity. Immunity (2002) 12:121–127.[CrossRef]
  12. Zhou Y, et al. CXCR4 is a major chemokine receptor on glioma cells and mediates their survival. J. Biol. Chem. (2002) 277:49481–49487.[Abstract/Free Full Text]
  13. Burger JA, et al. CXCR4: a key receptor in the crosstalk between tumor cells and their microenvironment. Blood (2006) 107:1761–1767.[Abstract/Free Full Text]
  14. Müller A, et al. Involvement of chemokine receptors in breast cancer metastasis. Nature (2001) 410:50–56.[CrossRef][Medline]
  15. Strieter RM. Chemokines: not just leukocyte chemoattractants in the promotion of cancer. Nat. Immunol. (2001) 2:285–286.[CrossRef][Web of Science][Medline]
  16. Bachelder RE, et al. Vascular endothelial growth factor promotes breast carcinoma invasion in an autocrine manner by regulating the chemokine receptor CXCR4. Cancer Res. (2002) 62:7203–7206.[Abstract/Free Full Text]
  17. Kijima T, et al. Regulation of cellular proliferation, cytoskeletal function, and signal transduction through CXCR4 and c-Kit in small cell lung cancer cells. Cancer Res. (2002) 62:6304–6311.[Abstract/Free Full Text]
  18. Payne AS, et al. The role of chemokines in melanoma tumor growth and metastasis. J. Invest. Dermatol. (2002) 118:915–922.[CrossRef][Web of Science][Medline]
  19. Barbero S, et al. Stromal cell-derived factor 1{alpha} stimulates human glioblastoma cell growth through the activation of both extracellular signal-regulated kinases 1/2 and Akt. Cancer Res. (2002) 63:1969–1974.[Web of Science]
  20. Phillips RJ, et al. The stromal derived factor-1/CXCL12-CXC chemokine receptor 4 biological axis in non-small cell lung cancer metastases. Am. J. Respir. Crit. Care Med. (2003) 167:1676–1686.[Abstract/Free Full Text]
  21. Fernandis AZ, et al. Regulation of CXCR4-mediated chemotaxis and chemoinvasion of breast cancer cells. Oncogene (2004) 23:157–167.[CrossRef][Web of Science][Medline]
  22. Bartolomé RA, et al. Stromal cell-derived factor-1 {alpha} promotes melanoma cell invasion across basement membranes involving stimulation of membrane-type 1 matrix metalloproteinase and Rho GTPase activities. Cancer Res. (2004) 64:2534–2543.[Abstract/Free Full Text]
  23. Saur D, et al. CXCR4 expression increases liver and lung metastasis in a mouse model of pancreatic cancer. Gastroenterology (2005) 129:1237–1250.[CrossRef][Medline]
  24. Ohira S, et al. Possible regulation of migration of intrahepatic cholangiocarcinoma cells by interaction of CXCR4 expressed in carcinoma cells with tumor necrosis factor-{alpha} and stromal-derived factor-1 released in stroma. Am. J. Pathol. (2006) 168:1155–1168.[Abstract/Free Full Text]
  25. Chen GS, et al. CXC chemokine receptor CXCR4 expression enhances tumorigenesis and angiogenesis of basal cell carcinoma. Br. J. Dermatol. (2006) 154:910–918.[CrossRef][Web of Science][Medline]
  26. Bartolomé RA, et al. Activation of Vav/Rho GTPase signaling by CXCL12 controls membrane-type matrix metalloproteinase-dependent melanoma cell invasion. Cancer Res. (2006) 66:248–258.[Abstract/Free Full Text]
  27. Brand S, et al. CXCR4 and CXCL12 are inversely expressed in colorectal cancer cells and modulate cancer cell migration, invasion and MMP-9 activation. Exp. Cell Res. (2005) 310:117–130.[CrossRef][Web of Science][Medline]
  28. Zhang J, et al. The chemokine stromal cell derived factor-1 (CXCL12) promotes glioma invasiveness through MT2-matrix metalloproteinase. Carcinogenesis (2005) 26:2069–2077.[Abstract/Free Full Text]
  29. Menu E, et al. The involvement of stromal derived factor 1a in homing and progression of multiple myeloma in the 5TMM model. Haematologica (2006) 91:605–612.[Abstract/Free Full Text]
  30. Taichman RS, et al. Use of the stromal cell-derived factor-1/CXCR4 pathway in prostate cancer metastasis to bone. Cancer Res. (2002) 62:1832–1837.[Abstract/Free Full Text]
  31. Brunet A, et al. Constitutively active mutants of MAP kinase kinase (MEK1) induce growth factor-relaxation and oncogenicity when expressed in fibroblasts. Oncogene (1994) 9:3379–3387.[Web of Science][Medline]
  32. Chu CY, et al. Involvement of matrix metalloproteinase-13 in stromal-cell-derived factor 1alpha-directed invasion of human basal cell carcinoma cells. Oncogene (2007) 26:2491–2501.[CrossRef][Web of Science][Medline]
  33. Tang CH, et al. Prostaglandin E2 stimulates fibronectin expression through EP1 receptor, phospholipase C, protein kinase C alpha, and c-Src pathway in primary cultured rat osteoblasts. J. Biol. Chem. (2005) 280:22907–22916.[Abstract/Free Full Text]
  34. Shi XZ, et al. Transcriptional regulation of inflammatory mediators secreted by human colonic circular smooth muscle cells. Am. J. Physiol. Gastrointest. Liver Physiol. (2005) 289:G274–G284.[Abstract/Free Full Text]
  35. Lapteva N, et al. CXCR4 knockdown by small interfering RNA abrogates breast tumor growth in vivo. Cancer Gene Ther. (2005) 12:84–89.[CrossRef][Web of Science][Medline]
  36. Cheng JC, et al. Radiation-enhanced hepatocellular carcinoma cell invasion with MMP-9 expression through PI3K/Akt/NF-kappaB signal transduction pathway. Oncogene (2006) 53:7009–7018.
  37. Tang CH, et al. Ultrasound stimulates cyclooxygenase-2 expression and increases bone formation through integrin, focal adhesion kinase, phosphatidylinositol 3-kinase, and Akt pathway in osteoblasts. Mol. Pharmacol. (2006) 69:2047–2057.[Abstract/Free Full Text]
  38. Huang SC. Carnosol inhibits the invasion of B16/F10 mouse melanoma cells by suppressing metalloproteinase-9 through down-regulating nuclear factor-kappa B and c-Jun. Biochem. Pharmacol. (2005) 69:221–232.[CrossRef][Web of Science][Medline]
  39. Greenlee RT, et al. Cancer statistics. CA Cancer J. Clin. (2001) 51:15–36.[Abstract/Free Full Text]
  40. Singh S, et al. CXCL12–CXCR4 interactions modulate prostate cancer cell migration, metalloproteinase expression and invasion. Lab. Invest. (2004) 84:1666–1676.[CrossRef][Web of Science][Medline]
  41. Katiyar SK, et al. Obesity increases the risk of UV radiation-induced oxidative stress and activation of MAPK and NF-kappaB signaling. Free Radic. Biol. Med. (2007) 42:299–310.[CrossRef][Web of Science][Medline]
  42. Bajetto A, et al. Stromal cell-derived factor-1{alpha} induces astrocyte proliferation through the activation of extracellular signal-regulated kinases 1/2 pathway. J. Neurochem. (2001) 77:1226–1236.[CrossRef][Web of Science][Medline]
  43. Chung TW, et al. Novel and therapeutic effect of caffeic acid and caffeic acid phenyl ester on hepatocarcinoma cells: complete regression of hepatoma growth and metastasis by dual mechanism. FASEB J. (2004) 18:1123–1125.[Abstract/Free Full Text]
  44. Yao JS, et al. Minocycline exerts multiple inhibitory effects on vascular endothelial growth factor-induced smooth muscle cell migration: the role of ERK1/2, PI3K, and matrix metalloproteinases. Circ. Res. (2004) 95:364–371.[Abstract/Free Full Text]
  45. Liang KC, et al. Interleukin-1beta induces MMP-9 expression via p42/p44 MAPK, p38 MAPK, JNK, and nuclear factor-kappa B signaling pathways in human tracheal smooth muscle cells. J. Cell Physiol. (2007) 211:759–770.[CrossRef][Web of Science][Medline]
  46. Sato H, et al. Regulatory mechanism of 92 kDa type IV collagenase gene expression which is associated with invasiveness of tumor cells. Oncogene (1993) 8:395–405.[Web of Science][Medline]
  47. Han Y, et al. TNF-alpha mediates SDF-1 alpha-induced NF-kappa B activation and cytotoxic effects in primary astrocytes. J. Clin. Invest. (2001) 108:25–435.[CrossRef][Web of Science][Medline]
  48. Kukreja P, et al. Up-regulation of CXCR4 expression in PC-3 cells by stromal-derived factor-1alpha (CXCL12) increases endothelial adhesion and transendothelial migration: role of MEK/ERK signaling pathway-dependent NF-kappaB activation. Cancer Res. (2005) 65:9891–9898.[Abstract/Free Full Text]
Received June 9, 2007; revised August 23, 2007; accepted September 21, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
Q. Li, J. Liu, M. Michaud, M. L. Schwartz, and J. A. Madri
Strain Differences in Behavioral and Cellular Responses to Perinatal Hypoxia and Relationships to Neural Stem Cell Survival and Self-Renewal: Modeling the Neurovascular Niche
Am. J. Pathol., November 1, 2009; 175(5): 2133 - 2146.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Y.-C. Chiu, D.-C. Shieh, K.-M. Tong, C.-P. Chen, K.-C. Huang, P.-C. Chen, Y.-C. Fong, H.-C. Hsu, and C.-H. Tang
Involvement of AdipoR receptor in adiponectin-induced motility and {alpha}2{beta}1 integrin upregulation in human chondrosarcoma cells
Carcinogenesis, October 1, 2009; 30(10): 1651 - 1659.
[Abstract] [Full Text] [PDF]


Home page
Anticancer ResHome page
J. SAFRANEK, M. PESTA, L. HOLUBEC, V. KULDA, J. DRESLEROVA, J. VRZALOVA, O. TOPOLCAN, M. PESEK, J. FINEK, and V. TRESKA
Expression of MMP-7, MMP-9, TIMP-1 and TIMP-2 mRNA in Lung Tissue of Patients with Non-small Cell Lung Cancer (NSCLC) and Benign Pulmonary Disease
Anticancer Res, July 1, 2009; 29(7): 2513 - 2517.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. Dubey and C. A. Powell
Update in Lung Cancer 2008
Am. J. Respir. Crit. Care Med., May 15, 2009; 179(10): 860 - 868.
[Full Text] [PDF]


Home page
CarcinogenesisHome page
S.-N. Yang, H.-T. Chen, H.-K. Tsou, C.-Y. Huang, W.-H. Yang, C.-M. Su, Y.-C. Fong, W.-P. Tseng, and C.-H. Tang
Leptin enhances cell migration in human chondrosarcoma cells through OBRl leptin receptor
Carcinogenesis, April 1, 2009; 30(4): 566 - 574.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
T.-W. Tan, W.-H. Yang, Y.-T. Lin, S.-F. Hsu, T.-M. Li, S.-T. Kao, W.-C. Chen, Y.-C. Fong, and C.-H. Tang
Cyr61 increases migration and MMP-13 expression via {alpha}v{beta}3 integrin, FAK, ERK and AP-1-dependent pathway in human chondrosarcoma cells
Carcinogenesis, February 1, 2009; 30(2): 258 - 268.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
C.-H. Tang, J.-Y. Chuang, Y.-C. Fong, M.-C. Maa, T.-D. Way, and C.-H. Hung
Bone-derived SDF-1 stimulates IL-6 release via CXCR4, ERK and NF-{kappa}B pathways and promotes osteoclastogenesis in human oral cancer cells
Carcinogenesis, August 1, 2008; 29(8): 1483 - 1492.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
29/1/35    most recent
bgm220v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Google Scholar
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Yang, R.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Yang, R.-S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?