Skip Navigation


Carcinogenesis Advance Access originally published online on November 28, 2007
Carcinogenesis 2008 29(2):381-389; doi:10.1093/carcin/bgm271
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
29/2/381    most recent
bgm271v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Trincheri, N. F.
Right arrow Articles by Isidoro, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trincheri, N. F.
Right arrow Articles by Isidoro, C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Resveratrol-induced apoptosis depends on the lipid kinase activity of Vps34 and on the formation of autophagolysosomes

Nicol F. Trincheri, Carlo Follo, Giuseppina Nicotra, Claudia Peracchio, Roberta Castino and Ciro Isidoro*

Laboratorio di Patologia Molecolare, Dipartimento di Scienze Mediche, Università del Piemonte Orientale ‘A. Avogadro’, Via Solaroli 17, 28100 Novara, Italy

* To whom correspondence should be addressed. Tel: +39 321 660607; Fax: +39 321620421; Email: isidoro{at}med.unipmn.it


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
In human colorectal DLD1 cancer cells, the dietary bioflavonoid resveratrol (RV) rapidly induced autophagy. This effect was reversible (on removal of the drug) and was associated with increased expression and cytosolic redistribution of the proteins Beclin1 and LC3 II. Supplementing the cells with asparagine (Asn) abrogated the Beclin-dependent autophagy. When applied acutely (2 h), RV was not toxic; however, reiterate chronic (48 h) exposure to RV eventually led to annexin V- and terminal deoxinucleotidyl transferase-mediated dUTP-biotin nick end labeling-positive cell death. This toxic effect was autophagy dependent, as it was prevented either by Asn, by expressing a dominant-negative lipid kinase-deficient class III phosphoinositide 3-phosphate kinase, or by RNA interference knockdown of Beclin1. Lamp2b silencing abolished the fusion of autophagosomes with lysosomes and preserved cell viability despite the ongoing formation of autophagosomes in cells chronically exposed to RV. The pan-caspase inhibitor benzyloxycarbonyl-Val–Ala–Asp-fluoromethylketone inhibited RV-induced cell death, but not autophagy. These results uncover a novel pathway of RV cytotoxicity in which autophagy plays a dual role: (i) at first, it acts as a prosurvival stress response and (ii) at a later time, it switches to a caspase-dependent apoptosis pathway. The present data also indicate that genetic or epigenetic inactivation of autophagy proteins in cancer cells may confer resistance to RV-mediated killing.

Abbreviations: Asn, asparagine; GFP, green fluorescent protein; MDC, monodansylcadaverine; PBS, phosphate-buffered saline; PI3K, phosphoinositide 3-phosphate kinase; RV, resveratrol; siRNA, small interference RNA; TUNEL, terminal deoxinucleotidyl transferase-mediated dUTP-biotin nick end labeling; ZVAD-fmk, benzyloxycarbonyl-Val–Ala–Asp-fluoromethylketone


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 Funding
 References
 
Resveratrol (RV) (3,4',5-trihydroxy-trans-stilbene) is a polyphenolic antioxidant compound present in grapes, red wine, berries, peanuts and other alimentary products (1,2). In 1997, Pezzuto et al. provided the first compendious evidence that RV possesses chemopreventive activity against the three steps of carcinogenesis (i.e. initiation, promotion and progression) in an animal model of skin cancer (3). The fact that ~70 to 90% of colorectal cancers seems associated with dietary habits stimulates the interest on dietary factors that can exert cancer chemopreventive action on the intestinal mucosa (4). In this respect, RV is particularly appealing as preliminary in vitro and in vivo studies have shown no overt toxicity toward normal cells when administered at doses high enough to achieve a pharmacological effect (5,6). In addition, although it is fast and extensively metabolized in the body, in intestinal mucosa a 30-fold enrichment of RV over serum concentration can be reached (7). Several in vivo studies have shown that RV can actively contrast the development and/or progression of colorectal cancers (8,9) and in vitro studies have confirmed the ability of RV (at concentration comparable with that found in some foods) to halt cell proliferation and to induce enterocyte-like differentiation and cell death of human colon carcinoma cells (10–18). In ovarian cancer cells, RV was shown to induce both autophagocytosis and caspase-independent cell death (19). Yet, it remained unexplained whether the induction of autophagy by RV represented an epiphenomenal stress response or it was actively involved in the toxic mechanism of RV. Autophagy preserves cell survival under unfavorable environmental conditions by ensuring the lysosomal degradation of aged or damaged proteins, membranes and cytoplasmic structures (20). Whether this pathway contributes to or counteracts the toxic outcome of chemotherapy drug treatments is still a matter of investigation. Autophagy might confer resistance to chemotherapy drugs in cancer cells by actively removing the proteins and the organelles that are damaged under antiblastic treatment (21,22). Still, the toxic effects of some anticancer drugs have been associated with induction of autophagy (23,24). In this context, the identification of the molecules implicated in the toxic pathways activated by RV would favor the optimization of its chemopreventive and curative potential. We therefore investigated on the possible involvement of autophagy, and on its regulatory pathway and functional role, in the cytotoxic mechanism of RV in cultured human colorectal cancer cells. In the present study, we report the following findings: (i) autophagy is rapidly and reversibly induced by an acute exposure to RV; (ii) the prolonged exposure to RV eventually activates a caspase-mediated cell death pathway and (iii) genetic inactivation of the autophagy proteins class III phosphoinositide 3-phosphate kinase (PI3K), Beclin1 and Lamp2b abrogates RV toxicity. These data emphasize the role of autophagy in the cellular response to RV and suggest that optimization of its anticarcinogenic activity can be achieved through genetic or pharmacologic modulation of the function of autophagy proteins. The present study also reveals the strict relationship between autophagy and apoptosis in the execution of the death program triggered by this chemotherapy drug.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 Funding
 References
 
Unless otherwise specified, all reagents were from Sigma-Aldrich Corp., St Louis, MO.

Cell cultures, treatments and evaluation of cytotoxicity
Human colorectal cancer DLD1 cells were cultivated in standard culture conditions (37°C; 95% air: 5% CO2) in Dulbecco's modified minimal essential medium supplemented with 10% fetal bovine serum (Invitrogen Corp., Carlsbad, CA), 2 mM L-glutamine and 1% penicillin–streptomycin solution. Cells were seeded and let adhere on sterile plastic dishes for 24 h prior to any treatment. Treatments included 100 µM RV, 50 mM asparagine (Asn) and 30 µM ZVAD(OMe)-fmk (ZVAD) (Alexis Laboratories, San Diego, CA). Asn and ZVAD (benzyloxycarbonyl-Val–Ala–Asp) were added to the medium 3 h prior the start of RV treatment. In experiments lasting 48 h, the culture medium was changed and the substances were readded after the first 24 h of incubation. At designated time points, adherent viable (trypan blue-excluding) cells were counted. Cell death was assessed by cytofluorometry analysis of cells labeled either with annexin V–fluorescein isothiocyanate (Alexis Laboratories) or propidium iodide; for this purpose, adherent cells were trypsinized and mixed with the suspended cells recovered from the medium (18).

Small interference RNA transfection
Posttranscriptional silencing of Beclin1 and Lamp2b expression was achieved by the small interference RNA (siRNA) technology. Duplexes of 27-nucleotide siRNA including two 3'-overhanging TT were synthesized by MWG Biotech AG (Washington, DC). An inefficient CD9 oligonucleotide corresponding to the AGGUAGUGUAAUCGCCUUG sequence was used as a negative control of transfection (referred to as ‘sham’). The sense strands of siRNA targeting Beclin1 and Lamp2b messenger RNAs were GGAACUCACAGCUCCAUUACUUACCAC and AAGAGUGUUCGCUGGAUGAUGACACCA, respectively. Transfection was performed with Lipofectamine 2000 (Invitrogen Corp.). Afterward, the transfection mixture was removed and cells were incubated for further 24 h in fresh medium prior to any treatment.

PI3K III dominant-negative adenoviral vector
The recombinant adenoviral vector directing the synthesis of the dominant-negative form of Vps34 (the yeast homolog of class III PI3K), which is devoid of lipid kinase activity, was kindly provided by Dr D.Murphy (University of Bristol). The vector also bears the coding sequence for the enhanced green fluorescent protein (GFP), thus allowing to monitor the efficiency of cell transfection. As a control, sham infection was performed with an empty paired adenoviral vector.

Western blotting analysis
Expression of proteins of interest was assessed by standard western blotting procedure (18). The filter was probed with the following antibodies: a rabbit polyclonal anti-Beclin1 (Santa Cruz Biotechnology, CA); a polyclonal anti-MAPLC3 (Santa Cruz Biotechnology) and a mouse monoclonal antibody specific for β-actin. Immunocomplexes were revealed by incubation with peroxidase-conjugated goat-anti-rabbit or goat-anti-mouse antibody, as appropriate, and subsequent peroxidase-induced chemiluminescence reaction (Bio-Rad, Hercules, CA). Intensity of the bands was estimated by densitometry analysis (Quantity One software).

Immunofluorescence studies
Cells grown and treated on coverslips were fixed with methanol for 20 min and permeabilized with 0.2% Triton X-100 in phosphate-buffered saline (PBS) for 15 min. The following primary antibodies were used: a polyclonal anti-Lamp1 (BD Biosciences, San Jose, CA) and a polyclonal anti-MAPLC3 (Santa Cruz Biotechnology). Fluorescein isothiocyanate- or Tetramethylrhodamine isothiocyanate-conjugated secondary antibodies against rabbit IgG were used. As negative control, the primary antibody was omitted.

Terminal deoxinucleotidyl transferase-mediated dUTP-biotin nick end labeling staining
Apoptotic cells were revealed by in situ terminal deoxinucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay performed with the ‘In situ Cell Death Detection’ fluorescent Kit (Roche Diagnostics Corporation Indianapolis, IN) following manufacturer's instructions.

Fluorescence microscope imaging
Coverslips were mounted in mowiol (1% in PBS). Images were captured with a Zeiss fluorescence microscope equipped with a digital camera or with Leica DMIRE2 confocal fluorescence microscope (Leica Microsystems AG, Wetzlad, Germany) equipped with Leica Confocal Software v. 2.61. Three coverslips were prepared for each experimental condition and were independently examined by two investigators. Representative images are shown.

Fluorescence assessment of autophagy
Autophagolysosomes were detected with both the fluorescent dye monodansylcadaverine (MDC) (25) and with the colocalization of LC3 (autophagy marker) and Lamp1 (lysosomal marker). Living cells were incubated with 0.05 mM MDC in PBS at 37°C for 15 min. After incubation, cells were washed twice with PBS and immediately analyzed by fluorescence microscopy (excitation: 380–420, barrier filter 450 nm). Induction of autophagic vacuoles (AV) formation was directly monitored in living cells transiently transfected with a plasmid encoding the fluorescence chimeric protein GFP–LC3 or Beclin–GFP. Microtubule to vacuole translocation of LC3 is associated with limited proteolysis and lipidation of its C-terminus (26). Therefore, the fusion protein is made so that GFP is placed at the N-terminus of LC3. The DNA encoding human LC3 was cloned by polymerase chain reaction from the total cDNA of human OVCAR-3 cells (sense primer 5'-CAACAAGCTTCACCATGCCGTCGGAGAAGACC-3' and antisense primer 5'-AGATCTCGAGTTACACTGACAATTTCATCCCG-3'). The cDNA was subcloned into the expression vector pEGFPC2 (Clontech Laboratories, Mountain View, CA). The cDNA of Beclin1 was cloned by polymerase chain reaction from the total cDNA of human OVCAR-3 cells (sense primer 5'-GCCCGAATTCGGGATGGAAGGGTCTAAGA-3' and antisense primer 5'-GCCCGGGATCCTTTTCAGACTGCAGCAAATC-3') and it was subcloned into the expression vector pEGFPN1 (Clontech Laboratories). LC3 and Beclin1 DNAs were checked by automated sequencing.

Statistical analysis
All experiments were independently replicated at least three times. Data are presented as means ± SD. The Microsoft Excel XLStats software was used.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 Funding
 References
 
Autophagy is an early and reversible stress response to RV
To monitor the induction of autophagy by RV, we employed DLD1-transfected cells that transiently express the chimeric fluorescent protein GFP–LC3 or Beclin1–GFP. LC3 is the mammalian equivalent of yeast atg 8 and is normally associated with the cytoskeleton; on induction of autophagy, this protein translocates onto the membrane of the nascent AV (26). Images in Figure 1A show that both endogenous LC3 and transfected GFP–LC3 assume a punctate vacuolar-like localization in RV-treated cells. Cytosol to vacuole translocation of LC3 is associated with proteolytic processing and subsequent lipidation of the C-terminus of the precursor MAPLC3, a process leading to the 16 kDa LC3 II isoform (26,27). This process in fact occurred in RV-treated cells (Figure 1B). Beclin1, the homolog of yeast Vps30 (also known as atg 6), interacts with class III PI3K (the homolog of yeast Vps34) and UVRAG to start the recruitment of autophagy proteins on the membrane of the preautophagosomal structure (28,29). We therefore also monitored the localization of Beclin1 in cells transiently expressing the Beclin–GFP fluorescent chimera. Beclin-positive aggregates were soon detectable after 15 min of exposure to RV (Figure 1C). To see whether the autophagy process triggered by a short exposure to RV lasted for long time, DLD1 cells were exposed to RV for 2 h, and then the cells were washed and further incubated in fresh medium in the absence or the presence of RV and collected at 24 and 48 h. In parallel, cells were exposed to RV throughout the 24 or 48 h period of incubation. In the latter case, the medium was replaced and RV was readded at 24 h, to avoid aspecific induction of autophagy due to nutrient consumption. The presence of autophagolysosomes was visualized by labeling the cells with the autofluorescent dye MDC (25,30). A 2 h incubation with RV led to the accumulation of autophagolysosomes, as indicated by the increased MDC staining (Figure 1D). On removal of RV, the cell recovered from the toxic stress and downregulated autophagy to (basal) control level within 24 h. In contrast, the chronic presence of RV sustained the autophagy process, as demonstrated by the intense MDC labeling of cells exposed to RV for 24 and 48 h (Figure 1D). Form these data, we conclude that (i) autophagy induced by RV has the characteristics of a rapid and reversible stress response and (ii) 100 µM RV retains its stimulatory activity on autophagy for at least 24 h.


Figure 1
View larger version (92K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. RV rapidly induces an autophagy response. (A) Untransfected and GFP–LC3-transfected DLD1 cells plated on coverslips were exposed to 100 µM RV for 1 and 2 h. RV provokes the rapid changes in LC3 distribution from a diffuse cytoplasmic staining to a vacuolar-like staining. (B) Western blotting analysis of MAPLC3 processing in DLD1 cells. On RV treatment, the vacuolar-associated 16 kDa LC3 II isoform is rapidly generated (a representative gel, of three, is shown). (C) DLD1 cells were transfected with a plasmid encoding Beclin–GFP and exposed to 100 µM RV for the time indicated. Vacuolar-like aggregates of Beclin1 could be detected after a 15 min exposure to RV. (D) DLD1 cells plated on coverslips were exposed to 100 µM RV for 24 or 48 h (refreshing the medium and readding RV at 24 h) or for 2 h and then incubated in fresh medium (without RV) and collected at 24 or 48 h. Cells were then stained with MDC and immediately imaged under the fluorescence microscope. Uptake and accumulation of MDC reflect the presence of autophagolysosomes. The experiment reveals that induction of autophagy is an early and reversible response to RV. All imaging studies were replicated in at least three independent experiments.

 
Asn prevents the hyperregulation of Beclin-dependent autophagy induced by chronic exposure to RV
To confirm the induction of autophagy by RV, we attempted to interfere with the process using the inhibitor 3-methyladenine (31). This drug, at appropriate concentrations (5–10 mM), effectively inhibited the RV-induced formation of Beclin-positive macrocomplexes (data not shown), yet it revealed itself toxic in prolonged incubation (19), thus precluding its use in further experiments. Extra supplementation of certain amino acids has been proved to downregulate autophagy (32,33). Fifty micromolar of Asn prevented the formation of Beclin–GFP macrocomplexes in cells exposed for 2 h to RV (Figure 2A). Further, the content of Beclin1 greatly increased in cells chronically exposed to RV, yet this effect was not observed in cells cotreated with Asn (Figure 2B). Asn also prevented the vacuolar localization of GFP–LC3 and the accumulation of AVs positive for Beclin1, Rab24 and LC3 in cells chronically exposed (for 24 and 48 h) to RV (Figure 3C below and data not shown). As this effect was somehow unexpected, we investigated at biochemical level the inhibitory effect of Asn on AV formation. A western blotting analysis showed that the proteolytic generation of the AV-associated 16 kDa LC3 II isoform was abolished in cells exposed to 100 µM RV in the presence of 50 mM Asn (Figure 2C). Thus, raising the intracellular concentration of Asn efficiently impaired the induction of autophagy by RV at a very early step.


Figure 2
View larger version (51K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. Asn prevents the induction of Beclin-dependent autophagy by RV. (A) Beclin–GFP-transfected DLD1 cells were exposed for 2 h to 100 µM RV in the absence or the presence of 50 mM Asn. Images (representative of four independent experiments) show that the vacuolar-like localization of Beclin–GFP induced by RV does not occur in the presence of Asn. (B) Western blotting analysis (one of three is shown) of Beclin1 expression in cells exposed to RV for 24 or 48 h in the absence or the presence of Asn. RV induces the accumulation of Beclin1 protein (at 24 h this effect is higher than at 48 h). Asn prevents the cellular accumulation of Beclin1 induced by RV. The effects of RV and Asn on Beclin1 expression were quantitated by western blotting densitometry (data are given as average ± SD of three separate experiments and refer to the ratio of Beclin versus actin, that is assumed as 1 in control cells). (C) Western blotting analysis (one of the two gels is shown) of LC3 II expression in cells exposed to RV for 24 h in the absence or the presence of Asn. The result indicates that the 16 kDa LC3 II isoform is not generated in cells exposed to RV in the presence of Asn.

 


Figure 3
View larger version (43K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3. Asn prevents the toxic effect induced by chronic administration of RV. (A) Annexin V–fluorescein isothiocyanate flow cytometry profiles of cells exposed to 100 µM RV for 48 h in the absence (none) or the presence of Asn or ZVAD-fmk or the two inhibitors together, as indicated. Inhibition of caspases or of autophagy elicited complete protection against RV toxicity, and no synergistic protection was attained by cotreating with both inhibitors. The cytometry profiles shown are representative of three independent experiments. (B) MDC staining of DLD1 cells incubated for 2–48 h with RV and in the absence or the presence of Asn or ZVAD-fmk. (C) Immunolabeling of LC3 (marker of AV) and Lamp1 (marker of endosomes and lysosomes) in DLD1 cells exposed to 100 µM RV for 48 h in the absence (none) or the presence of Asn or ZVAD-fmk. Arrows point to LC3–Lamp1 double-positive organelles that represent newly formed autophagolysosomes. The images in panels B and C confirm the inability of the pan-caspases inhibitor to prevent the formation and accumulation of autophagolysosomes induced by RV, whereas Asn maintains its inhibitory effect on autophagy induction in cells exposed to RV for as long as 48 h. All images shown are representative of at least three separate experiments.

 
Asn prevents apoptosis induced by RV
We have recently shown that chronic and reiterate administration of 100 µM RV induces caspase-dependent apoptosis of DLD1 cells through a pathway driven by lysosomal cathepsin D and bax (18). Although a 24 h incubation with RV provoked cell growth arrest and no apparent cell death, the incubation with RV for further 24 h produced ~50% cell death in the monolayer (18). We asked whether the induction of autophagy by RV was finalized to protect the cells (thus accounting for the ~50% of cells that survived at the end of the treatment) or was part of the death pathway (thus accounting for the ~50% of cells that succumbed at the end of the treatment). Hyperactivation of autophagy is in fact per se deleterious for the cell, as excessive self-digestion ends up in autophagic cell death (34,35). To better assess the real contribution of apoptosis and autophagy in the cytotoxic mechanism of RV, DLD1 cells were exposed to 100 µM RV for up to 48 h in the absence or the presence of the pan-caspase inhibitor ZVAD-fluoromethylketone (fmk) and/or of the amino acid Asn. Cell death was assessed by counting the viable and necrotic cells and by cytofluorometry of cells labeled with annexin V–fluorescein isothiocyanate, which is assumed as an early marker of apoptosis (36). In agreement with the published data (18), cell counting data (data not shown) and cytofluorometry quantification of annexin V-positive cells confirmed the occurrence of ~50% cell loss (compared with day 0 cell density) in the RV-exposed culture; cell death was completely abrogated by cotreating with ZVAD-fmk or Asn or both the inhibitors (Figure 3A). We then looked at the effect of these inhibitors on the regulation of autophagy. Fluorescence localization of LC3 in GFP–LC3-expressing cells (data not shown) and MDC staining of autophagolysosomes (Figure 3B) demonstrated the inability of ZVAD-fmk to halt RV-induced autophagy, whereas Asn confirmed its ability to prevent the early formation of AVs. Consistently, LC3- and Lamp1-positive vacuoles (which bona fide correspond to newly formed autophagolysosomes) accumulated in cells treated with RV regardless of the concomitant presence of the pan-caspases inhibitor, whereas the cotreatment with Asn did not lead to the formation of LC3-positive vacuoles (Figure 3C).

Genetic downregulation of Beclin1 abrogates the formation of autophagosomes and apoptosis induced by RV
The findings that Asn was able to prevent the hyperregulation of Beclin1 expression, autophagy and cytotoxicity by RV are suggestive of a functional link between Beclin-dependent autophagy and caspase-dependent apoptosis. We tested this hypothesis. The expression of Beclin1 protein was knocked down through the expression of a specific siRNA (Figure 4A). Under this condition the formation of autophagolysosomes, identified as LC3–Lamp1 double-positive vacuoles (Figure 4B) and as MDC-positive acidic vacuoles (Figure 4C), was impaired in the cells exposed to RV for 48 h. Cell counting (data not shown) and cytofluorometry data (Figure 4D) demonstrated that although control (sham transfected) cells were largely sensitive to a 48 h treatment with RV, Beclin1–siRNA-transfected DLD1 cells were not. To definitely implicate Beclin-dependent autophagy in RV-induced apoptosis, we stained Beclin1 knocked down cultures with the TUNEL technique, which evidences the presence of nicked DNA that accumulates in dying cells. On treatment with RV, TUNEL-positive cells were detectable in sham-transfected, but not in Beclin–siRNA-transfected, cultures (Figure 4E).


Figure 4
View larger version (52K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4. siRNA-mediated silencing of Beclin1 prevents RV-induced apoptosis. DLD1 cells were transfected with an inefficient duplex oligoRNA (sham) or with an siRNA specific for Beclin1. (A) Western blotting (one of the three is shown) analysis demonstrates the efficient knock down of Beclin1 protein expression attained with the specific siRNA. (B and C) The cells, plated on coverslips, were exposed to 100 µM RV for 48 h and immunolabeled for LC3 and Lamp1 (B) or stained with MDC (C). The images (representative of three independent experiments) confirm that silencing the expression of Beclin1 prevents the accumulation of AVs and of autophagolysosomes in RV-treated cells. Arrows in B point to newly formed autophagolysosomes that are LC3–Lamp1 double positive. (D) The cells plated in Petri dishes were exposed to 100 µM RV for 48 h and then trypsinized, counted and labeled with annexin V–fluorescein isothiocyanate for flow cytometry evaluation of cell death. Data demonstrate that a complete protection against RV cytotoxicity was obtained by knocking down the expression of Beclin1. These data were confirmed in three other experiments. (E) Cells plated on coverslips were exposed to RV for 48 h and then stained with the TUNEL technique. The images (representative of four separate experiments) show that in sham-infected cultures, but not in Beclin1-silenced cultures, RV provokes the appearance of TUNEL-positive cells.

 
RV toxicity depends on the lipid kinase activity of class III PI3K
We further investigated the molecular pathways through which RV induces both the upregulation of autophagy and cell death. The interaction of Vps34–class III PI3K with Atg6–Beclin1 is a key step for membrane nucleation and formation of the AV at the level of the preautophagosomal structure (28,37). We asked about the need of PI3K III activity for the formation of beclin macrocomplexes under RV treatment. To overcome the unspecific toxic effects of 3-methyladenine, we interfered with the activation of PI3K III by ectopic overexpression of its dominant negative. To this end, we employed a recombinant adenoviral vector coding for a mutant Vps34 protein devoid of lipid kinase activity (Ad-Vps34dn). Adherent DLD1 cells were sham- or Ad-Vps34dn infected and then incubated for 48 h with or without RV. On average, >90% of cells were effectively infected, as estimated by GFP staining (Figure 5A, lateral lower panels). Despite the chronic exposure to RV, the ectopic expression of Vps34dn completely prevented the induction of autophagy, as demonstrated by LC3 immunolabeling (Figure 5A) and MDC staining (Figure 5B), and contemporarily inhibited the occurrence of cell death, as demonstrated by the lack of annexin V labeling (Figure 5C). Cell counting data confirmed the full protection attained by Vps34dn expression toward RV cytotoxicity (data not shown).


Figure 5
View larger version (37K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5. Ectopic expression of a PI3K III dominant negative protects from RV cytotoxicity. DLD1 cells (adherent either on coverslips or Petri dishes) were infected with the recombinant vector Ad-Vps34dn (which directs the expression of a lipid kinase-deficient mutant of class III PI3K) or with an empty adenoviral vector (sham) and then exposed to 100 µM RV for 48 h. At the end, cells on coverslips were immunolabeled for LC3 (A) or stained with MDC (B) and observed under the fluorescence microscope. Efficient translation of the transgene is monitored by GFP in the monolayers shown in the lateral lower panels of (A). LC3-positive vacuoles can be appreciated in sham-infected cells exposed to RV (arrows in the upper right panel). The experiment demonstrates that expression of Vps34dn efficiently abolished the induction of autophagy by RV. (C) At the end of the treatment, the cells were labeled with annexin V–fluorescein isothiocyanate and analyzed by flow cytometry. The cytofluorometry profiles demonstrate that in Ad-Vps34dn-infected cultures RV did not induce annexin V-positive cell death. In a parallel set of cultures, adherent viable cells were counted. The data (not shown) confirmed the protection attained by Vps34dn against RV cytotoxicity. All data shown were reproduced in three separate experiments.

 
Genetic downregulation of Lamp2b abrogates the formation of autophagolysosomes and cell death induced by RV
An important point is to determine whether autophagy-dependent cell death associated with RV exposure is due to the excessive accumulation of AVs and/or of autophagolysosomes in the cell. To address this issue, we interfered with the last step of autophagy, i.e. the formation of the autophagolysosome. Both Lamp1 and Lamp2 proteins are involved in the process of reciprocal recognition and fusion of AVs and endosomal–lysosomal organelles (38). We were able to inhibit the AV–lysosome fusion by siRNA-mediated knockdown of Lamp2b, as indicated by immunofluorescence costaining of LC3 and Lamp1, which, respectively, identifies AVs and endosomal–lysosomal organelles (Figure 6A). MDC staining further proved that the formation of autophagolysosomes by RV was impaired in DLD1 cells transfected with an siRNA targeting Lamp2b (Figure 6B). We then assessed the toxic effect of RV under this condition. Cytofluorometry data (and cell counting data, not shown) demonstrated that silencing Lamp2b prevents the induction of annexin V-positive cell death by chronic and reiterate exposure to RV (Figure 6C).


Figure 6
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 6. siRNA-mediated silencing of Lamp2b prevents autophagolysosome formation and cell death induced by RV. Sham- and Lamp2b–siRNA-transfected cells were incubated for 48 h with 100 µM RV and at the end cells were assayed by immunofluorescence for the formation of AVs (LC3 positive) and of autophagolysosomes (LC3–Lamp1 and MDC positive) and for occurrence of annexin V-positive cell death. (A) Images show that siRNA-mediated knock down of Lamp2b abolishes the formation of vacuoles double positive for both LC3 and Lamp1, which are seen in sham-infected cells treated with RV (arrows). (B) The cells were stained with MDC. The images confirm that silencing the expression of Lamp2b is sufficient to prevent the accumulation of acidic autophagolysosomes in RV-treated cells. (C). The cells were labeled with annexin V–fluorescein isothiocyanate and analyzed by flow cytometry. Data demonstrate that the complete protection against RV cytotoxicity obtained by knocking down the expression Lamp2b. All data shown were reproduced in three separate experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
Funding
 References
 
Autophagy is a lysosomal-mediated degradative pathway that plays a major role in cell and tissue homeostasis. How and to what extent autophagy contributes to cancer development and progression/regression is still a matter of investigation (39,40). Defective autophagy favors tumorigenesis, and genes involved in the regulation of autophagy, such as Beclin1 and phosphatase and tensin homolog deleted on chromosome ten, are frequently mutated in carcinomas and are therefore regarded as oncosuppressors (41–43). On the other hand, functional autophagy helps the cancer cell to survive when the blood supply is reduced, thus preventing necrosis and inflammation-associated tumor progression (44). The clarification of the real contribution of autophagy in the cellular response to anticarcinogenic drugs is of obvious utility when designing chemotherapy and chemopreventive pharmacological strategies. The present work aimed at clarifying the role of autophagy in the cytotoxic mechanism activated by RV, a drug that was shown to exert chemopreventive activity in colon carcinogenesis (8,9). Here, we show that the proapoptotic activity of RV in DLD1 colorectal cancer cells is mediated by proteins involved in the regulation and execution of autophagy. In DLD1 cells, RV promptly induced autophagy, which was reversible and not harmful when the exposition to the drug was temporally limited. The reiterate and prolonged incubation with RV led to a cell death with the morphological and biochemical features of apoptosis (annexin V positive, TUNEL positive and caspase mediated), yet it was dependent on the lipid kinase activity of class III PI3K. The signaling pathway linking RV and activation of class III PI3K definitely deserves further studies. Of note, raising the intracellular concentration of Asn in RV-treated cells resulted in the inhibition of the processing and delocalization of LC3 and abolished the increase in the expression of Beclin1 macrocomplexes, indicating that the sensor for this amino acid acts at the very early step of AV formation. Posttranscriptional downregulation of Beclin1 and Lamp2b, which, respectively, led to inhibition of AV and autophagolysosome formation and also protected the cells from RV toxicity. It is to note that the Lamp2b silencing condition inhibited the formation of autophagolysosomes and determined the accumulation of AVs in RV-treated cells, yet it did not precipitate an autophagic cell death, as was shown to occur in starved cells (45). Inhibition of autophagy prevented the occurrence of TUNEL-positive cell death, whereas inhibition of caspases, though saving the cells, did not impair autophagy in RV-treated cells. Again, in this latter condition, autophagic cell death did not occur despite the chronic exposure to RV and ongoing autophagy. These observations suggest that the autophagy and apoptosis pathways were not independent, rather they were strictly linked and merged at the execution point, the caspases acting as death executioners downstream autophagy. We have shown previously that RV induces the cytosolic relocation of cathepsin D, which in turn activates the bax-mitochondrial intrinsic pathway of caspase-dependent cell death (18). Taken together with the present findings, we propose a model of RV cytotoxicity in which initially autophagy represents an adaptive response with prosurvival function, but on chronic intoxication autophagy is hyperstimulated and the lysosomal membrane becomes permeable, thus allowing the cytosolic relocation of proapoptotic cathepsins. These observations support the usefulness of RV for the treatment of colon cancer. Yet, the relative high concentrations (10–100 µM) of RV required to elicit in vitro the desired effect (10,13,14,18, this study) raises the question as whether such concentrations can be achieved in vivo in the target organ. Pharmacokinetic studies in animals and humans indicate that RV is avidly metabolized in the body, a factor that limits the availability of the drug at target organs remote from the site of absorption (2,6). In humans, a single oral dose of 5 g yielded (after 1.5 h) a systemic concentration of only 2.4 µM (6). It is possible that repeated administrations would eventually produce systemic concentrations of RV commensurate with cancer chemopreventive effects. In addition, topic administration and tissue-specific deconjugation of RV metabolites could contribute to local rise of RV concentrations. Thus, it is conceivable that reiterate administrations of RV that assure a sufficient local concentration of the drug or of its active metabolites will at the end produce the desired toxic effect. Accordingly, in animal models the beneficial effects of RV were seen on chronic administration of low doses, compatible with a daily dietary dosage in humans (8,9,46). The results of the present study, showing the dual role of autophagy, protective versus toxic in acute and chronic treatment with RV, respectively, are compatible with this mode of dosage. The results here reported also implicate that improvement of the anticarcinogenic effects of RV can be obtained through genetic or epigenetic modulation of proteins involved in the regulation and/or execution of autophagy and predict that, conversely, the inactivation of such proteins in cancer cells might confer resistance to RV-mediated killing.


   Funding
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
References
 
Università del Piemonte Orientale, Regione Piemonte (Ricerca Sanitaria Finalizzata), Fondazione Cassa di Risparmio di Torino; Lega per la Lotta contro i Tumori (sez. Novara).


   Acknowledgments
 
The authors wish to thank Prof. Dr D.Murphy (University of Bristol) for kindly providing the recombinant adenoviral vector encoding for Vps34 dominant negative.

Conflict of Interest Statement: None declared.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 

  1. Fremont L. Biological effects of resveratrol. Life Sci. (2000) 14:663–673.
  2. Baur JA, et al. Therapeutic potential of resveratrol: the in vivo evidence. Nat. Rev. Drug Discov. (2006) 5:493–506.[CrossRef][Web of Science][Medline]
  3. Jang M, et al. Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science (1997) 275:218–220.[Abstract/Free Full Text]
  4. Schatzkin A, et al. Chemo- and dietary prevention of colorectal cancer. Eur. J. Cancer (1995) 31A:1198–1204.[CrossRef]
  5. Gusman J, et al. A reappraisal of the potential chemopreventive and chemotherapeutic properties of resveratrol. Carcinogenesis (2001) 22:1111–1117.[Abstract/Free Full Text]
  6. Boocock DJ, et al. Phase I dose escalation pharmacokinetic study in healthy volunteers of resveratrol, a potential cancer chemopreventive agent. Cancer Epidemiol. Biomarkers Prev. (2007) 16:1246–1252.[Abstract/Free Full Text]
  7. Sale S, et al. Pharmacokinetic in mice and growth-inhibitory properties of the putative cancer chemopreventive agent resveratrol and the synthetic analogue trans 3,4,5,4'-tetramethoxystilbene. Br. J. Cancer (2004) 90:736–744.[CrossRef][Medline]
  8. Tessitore L, et al. Resveratrol depresses the growth of colorectal aberrant crypt foci by affecting bax and p21(CIP) expression. Carcinogenesis (2000) 21:1619–1622.[Abstract/Free Full Text]
  9. Schneider Y, et al. Resveratrol inhibits intestinal tumorigenesis and modulates host-defense-related gene expression in an animal model of human familial adenomatous polyposis. Nutr. Cancer (2001) 39:102–107.[CrossRef][Web of Science][Medline]
  10. Wolter F, et al. Down-regulation of the cyclin D1/Cdk4 complex occurs during resveratrol-induced cell cycle arrest in colon cancer cell lines. J. Nutr. (2001) 131:2197–2203.[Abstract/Free Full Text]
  11. Schneider Y, et al. Anti-proliferative effect of resveratrol, a natural component of grapes and wine, on human colonic cancer cells. Cancer Lett. (2000) 158:85–91.[CrossRef][Web of Science][Medline]
  12. Wolter F, et al. Resveratrol enhances the differentiation induced by butyrate in caco-2 colon cancer cells. J. Nutr. (2002) 132:2082–2086.[Abstract/Free Full Text]
  13. Liang YC, et al. Resveratrol-induced G2 arrest through the inhibition of CDK7 and p34CDC2 kinases in colon carcinoma HT29 cells. Biochem. Pharmacol. (2003) 65:1053–1060.[CrossRef][Medline]
  14. Mahyar-Roemer M, et al. Resveratrol induces colon tumor cell apoptosis independently of p53 and preceded by epithelial differentiation, mitochondrial proliferation and membrane potential collapse. Int. J. Cancer (2001) 94:615–622.[CrossRef][Web of Science][Medline]
  15. Mahyar-Roemer M, et al. Role of Bax in resveratrol-induced apoptosis of colorectal carcinoma cells. BMC Cancer (2002) 2:27.[CrossRef][Medline]
  16. Mohan J, et al. Caspase-2 triggers Bax-Bak-dependent and -independent cell death in colon cancer cells treated with resveratrol. J. Biol. Chem. (2006) 281:17599–17611.[Abstract/Free Full Text]
  17. Lee KW, et al. The role of polyphenols in cancer chemoprevention. Biofactors (2006) 26:105–121.[Web of Science][Medline]
  18. Trincheri NF, et al. Resveratrol induces cell death in colorectal cancer cells by a novel pathway involving lysosomal cathepsin D. Carcinogenesis (2007) 28:922–931.[Abstract/Free Full Text]
  19. Opipari AW Jr, et al. Resveratrol-induced autophagocytosis in ovarian cancer cells. Cancer Res. (2004) 64:696–703.[Abstract/Free Full Text]
  20. Yorimitsu T, et al. Autophagy: molecular machinery for self-eating. Cell Death Differ. (2005) 12:1542–1552.[CrossRef][Web of Science][Medline]
  21. Abedin MJ, et al. Autophagy delays apoptotic death in breast cancer cells following DNA damage. Cell Death Differ. (2007) 14:500–510.[CrossRef][Medline]
  22. Amaravadi RK, et al. Autophagy inhibition enhances therapy-induced apoptosis in a Myc-induced model of lymphoma. J. Clin. Invest. (2007) 117:326–336.[CrossRef][Medline]
  23. Bursch W, et al. Active cell death induced by the anti-estrogens tamoxifen and ICI 164 384 in human mammary carcinoma cells (MCF-7) in culture: the role of autophagy. Carcinogenesis (1996) 17:1595–1607.[Abstract/Free Full Text]
  24. Kessel D, et al. Initiation of apoptosis and autophagy by the Bcl-2 antagonist HA 1a-1. Cancer Lett. (2007) 249:294–299.[CrossRef][Medline]
  25. Munafo DB, et al. A novel assay to study autophagy: regulation of autophagosome vacuole size by amino acid deprivation. J. Cell Sci. (2001) 114:3619–3629.[Web of Science][Medline]
  26. Kabeya Y, et al. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J. (2000) 19:5720–5728.[CrossRef][Web of Science][Medline]
  27. Mizushima N, et al. Dissection of autophagosome formation using Apg5-deficient mouse embryonic stem cells. J. Cell Biol. (2001) 152:657–668.[Abstract/Free Full Text]
  28. Kihara A, et al. Beclin-phosphatidylinositol 3-kinase complex functions at the trans-Golgi network. EMBO Rep. (2001) 2:330–335.[CrossRef][Web of Science][Medline]
  29. Liang C, et al. Autophagic and tumor suppressor activity of a novel Beclin1-binding protein UVRAG. Nat. Cell Biol. (2006) 8:688–699.[CrossRef][Web of Science][Medline]
  30. Bampton ET, et al. The dynamics of autophagy visualized in live cells: from autophagosome formation to fusion with endo/lysosomes. Autophagy (2005) 1:23–36.[Medline]
  31. Seglen PO, et al. 3-Methyladenine: specific inhibitor of autophagic/lysosomal protein degradation in isolated rat hepatocytes. Proc. Natl Acad. Sci. USA (1982) 79:1889–1892.[Abstract/Free Full Text]
  32. Seglen PO, et al. Amino acid inhibition of the autophagic/lysosomal pathway of protein degradation in isolated rat hepatocytes. Biochim. Biophys. Acta (1980) 1:103–118.
  33. Hoyvik H, et al. Inhibition of autophagic-lysosomal delivery and autophagic lactolysis by asparagine. J. Cell Biol. (1991) 6:1305–1312.
  34. Bursch W. The autophagosomal-lysosomal compartment in programmed cell death. Cell Death Differ. (2001) 8:569–581.[CrossRef][Web of Science][Medline]
  35. Levine B, et al. Autophagy in cell death: an innocent convict? J. Clin. Invest. (2005) 115:2679–2688.[CrossRef][Web of Science][Medline]
  36. Martin SJ, et al. Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl. J. Exp. Med. (1995) 5:1545–1556.
  37. Suzuki K, et al. The pre-autophagosomal structure organized by concerted functions of APG genes is essential for autophagosome formation. EMBO J. (2001) 20:5971–5981.[CrossRef][Web of Science][Medline]
  38. Eskelinen EL. Roles of LAMP-1 and LAMP-2 in lysosome biogenesis and autophagy. Mol. Aspects Med. (2006) 27:495–502.[CrossRef][Medline]
  39. Ogier-Denis E, et al. Autophagy: a barrier or an adaptive response to cancer. Biochim. Biophys. Acta (2003) 2:113–128.
  40. Shengkan J, et al. Role of autophagy in cancer: management stress. Autophagy (2007) 3:28–31.[Medline]
  41. Liang XH, et al. Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature (1999) 402:672–676.[CrossRef][Medline]
  42. Di Cristofano A, et al. The multiple roles of PTEN in tumor suppression. Cell (2000) 100:387–390.[CrossRef][Web of Science][Medline]
  43. Qu X, et al. Promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene. J. Clin. Invest. (2003) 112:1809–1820.[CrossRef][Web of Science][Medline]
  44. Degenhardt K, et al. Autophagy promotes tumor cell survival and restricts necrosis, inflammation, and tumorigenesis. Cancer Cell (2006) 10:51–64.[CrossRef][Medline]
  45. Gonzalez-Polo RA, et al. The apoptosis/autophagy paradox: autophagic vacuolization before apoptotic death. J. Cell Sci. (2005) 118:3091–3102.[Abstract/Free Full Text]
  46. Baur JA, et al. Resveratrol improves health and survival of mice on a high-calorie diet. Nature (2006) 444:337–342.[CrossRef][Medline]
Received July 26, 2007; revised November 20, 2007; accepted November 21, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
K. Singletary and J. Milner
Diet, Autophagy, and Cancer: A Review
Cancer Epidemiol. Biomarkers Prev., July 1, 2008; 17(7): 1596 - 1610.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
29/2/381    most recent
bgm271v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Trincheri, N. F.
Right arrow Articles by Isidoro, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trincheri, N. F.
Right arrow Articles by Isidoro, C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?