Carcinogenesis Advance Access originally published online on January 3, 2008
Carcinogenesis 2008 29(3):510-518; doi:10.1093/carcin/bgm280
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The transglutaminase 2 gene (TGM2), a potential molecular marker for chemotherapeutic drug sensitivity, is epigenetically silenced in breast cancer
Department of Biochemistry and Molecular Biology and University of Florida Shands Cancer Center Program in Cancer Genetics, Epigenetics and Tumor Virology
1 Department of Pathology, Immunology and Laboratory Medicine, University of Florida College of Medicine, Box 100245, Gainesville, FL 32610, USA
* To whom correspondence should be addressed. Tel: 352 273 5458; Fax: 352 392 1445; Email: kdbrown1{at}ufl.edu
| Abstract |
|---|
|
|
|---|
Tissue transglutaminase (TG2) is a ubiquitously expressed enzyme capable of catalyzing protein cross-links. TG2-dependent cross-links are important in extracellular matrix integrity and it has been proposed that this TG2 activity establishes a barrier to tumor spread. Furthermore, TG2 controls sensitivity to the chemotherapeutic drug doxorubicin. Both doxorubicin sensitivity and TG2 expression are highly variable in cultured human breast cancer cell lines and inspection of the human gene (termed TGM2) determined that a canonical CpG island exists within its 5' flank. These features, when combined with its potential tumor suppressor activity, make TG2 an attractive candidate for epigenetic silencing. Consistent with this, we observed that culturing breast tumor cells with the DNA demethylating agent 5-aza-2'-deoxycytidine (5-azadC) resulted in a robust increase in TG2 expression. Analysis of DNA harvested from cultured lines and primary breast tumor samples indicated that TGM2 often displays aberrant hypermethylation and that there is a statistically significant correlation between gene methylation and reduced expression. Finally, we observed that doxorubicin-resistant MCF-7/ADR cells do not show TGM2 silencing but that doxorubicin-sensitive MCF-7 cells do and that culturing MCF-7 cells on 5-azadC and subsequently restoring TG2 expression reduced sensitivity to doxorubicin. This work indicates that the TGM2 gene is a target for epigenetic silencing in breast cancer and suggests that this aberrant molecular event is a potential marker for chemotherapeutic drug sensitivity.
Abbreviations: 5-azadC, 5-aza-2'-deoxycytidine; BGS, bisulfite genomic sequencing; DCIS, ductal carcinoma in situ; ECM, extracellular matrix; gDNA, genomic DNA; IBC, invasive breast carcinoma; M, methylated; MSP, methylation-specific polymerase chain reaction; PCR, polymerase chain reaction; qPCR, quantitative polymerase chain reaction; RT–PCR, reverse transcription–polymerase chain reaction; TG2, type 2 transglutaminase
| Introduction |
|---|
|
|
|---|
Cancer-associated changes in cellular phenotype most often stem from dysregulation of gene expression and/or protein function attributable to alterations within the genome (1). One prominent mechanism for these effects is de novo methylation and transcriptional silencing of genes in cancer cells. Cytosine methylation leading to gene silencing occurs at clustered 5'-CG-3' dinucleotides (termed CpG islands) generally located within gene promoters and/or the 5' flanking region (2). Aberrant CpG methylation events that arise during tumorigenesis are part of a more complex set of epigenetic events that result in the transformation of chromatin from a transcriptionally active to an inactive state (3). It is now widely accepted that epigenetic gene silencing is either a causative or a correlative event in tumor development (4–6).
Transglutaminases are a family of enzymes that catalyze the formation of a covalent bond between a free epsilon-amino group of a lysine residue and the gamma-carboxyl group of a glutamine residue (7). Functionally, transglutaminases cross-link proteins thus creating proteinaceous structures resistant to proteolytic and mechanical degradation. Perhaps, the most enigmatic of the transglutaminases is type 2 transglutaminase, also referred to as TG2. TG2 is a ubiquitously expressed protein comprised of a single
76 kD polypeptide and, like other transglutaminases, exhibits Ca2+-dependent protein cross-linking activity. However, evidence gathered indicates that TG2 is a multifunctional protein. This feature seemingly stems, in part, from the fact that this protein localizes to the cytosol and nucleus and can be exported from the cell (8). In accordance with its transglutaminase activity, extracellular pools of TG2 bind to and cross-link numerous components of the extracellular matrix (ECM) such as fibronectin, vitronectin, collagen, fibrin, laminin, osteonectin and osteopontin (9). This has led to the view that TG2 cross-linking renders the ECM resistant to mechanical and proteolytic degradation and stabilizes cell–ECM interaction (10) and wound healing (11). TG2 has also been shown to function as either a proapoptotic (12) or an antiapoptotic (13–15) molecule. Another enigmatic feature of TG2 is that elevated expression of this molecule renders cells resistant to the cytotoxic effects of doxorubicin (16), although the mechanism for this drug resistance remains controversial.
Based on published reports as well as our own observations that doxorubicin sensitivity and TG2 expression are variable among cultured breast tumor cell lines and supported by an earlier study that TG2 expression is influenced by cytosine methylation in a small panel of leukemia lines (17), we hypothesized that the gene encoding TG2 (termed TGM2) could be a target for epigenetic silencing in breast carcinoma. Consistent with this notion, we now report that the 5' flank of the TGM2 gene is superimposed on a dense CpG island and the culture of breast tumor lines that display low TG2 expression with the global DNA demethylating agent 5-aza-2'-deoxycytidine (5-azadC) dramatically increased expression of this gene. We further show that analysis of genomic DNA (gDNA) from both cultured cells and primary breast tumors confirmed that this gene is silenced via aberrant hypermethylation in this tumor type. Finally, we document that the methylation status of TGM2 influences doxorubicin sensitivity in doxorubicin-resistant and -sensitive MCF-7 cells establishing TGM2 methylation as a potential molecular marker for sensitivity to this chemotherapeutic drug.
| Materials and methods |
|---|
|
|
|---|
Cell culture and drug treatment
The breast tumor and mammary epithelium-derived cell lines were maintained as described previously (18). The doxorubicin-resistant MCF-7 derivative, MCF-7/ADR cell line, was obtained from Dr A.R. Safa (Medical University of South Carolina) and routinely cultured in complete medium containing 1 µg/ml doxorubicin, however, was cultured without doxorubicin for 2 weeks prior to experimentation.
5-azadC treatment was conducted as outlined previously (19). Briefly, cells were seeded at low density (
20% confluence) and cultured for 24 h. The next day, 5-azadC was added to the medium to final concentration of 5 µM and cells were cultured for an additional 24 h. The third day, medium was removed and cells were washed with phosphate-buffered saline three times, then fresh growth medium was added and cells were cultured for another 24 h. In total, three of these 5-azadC treatment cycles were conducted prior to harvesting cells. 5-azadC (Sigma, St Louis, MO) was freshly prepared as a 5 mM stock solution in phosphate-buffered saline prior to use.
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and immunoblotting
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and immunoblotting were performed using established protocols (20). TG2 mouse monoclonal antibody (Ab-3) was purchased from Labvision Corp. (Fremount, CA), and mouse monoclonal anti-tubulin (DM1A) was the generous gift of Dr D.W. Cleveland (University of California, San Diego).
Reverse transcription–polymerase chain reaction
RNA extraction from cultured cells and tissues and first-strand cDNA synthesis was conducted as outlined previously (18). The human TG2-specific primers used are (F) 5'- TAAGAGATGCTGTGGAGGAG -3' and (R) 5'-CGAGCCCTGGTAGATAAA-3'. The thermocycling conditions used were 1 cycle (95°C, 5 min); 35 cycles (94°C, 30 s; 58°C, 45 s; 72°C, 60 s) and final extension at 72°C for 10 min. Human reduced form of guanosine adenine dinucleotide phosphate (GAPDH) served as a control for RNA integrity and was amplified using primers (F) 5'-ACCACAGTCCATGCCATCAC-3' and (R) 5'-TCCACCACCCTGTTGCTGA-3'. Polymerase chain reaction (PCR) products were analyzed by electrophoresis on 10% polyacrylamide gels followed by staining with ethidium bromide.
Quantitative polymerase chain reaction
SYBR green PCR master mix (Applied Biosystems, Foster City, CA) was used for quantitative polymerase chain reaction (qPCR). In total, 2 µl of cDNA was added to final 20 µl PCR reaction volume using above-outlined reverse transcription–polymerase chain reaction (RT–PCR) primer sets for both TG2 and GAPDH. Thermocycling conditions used for qPCR were 1 cycle (95°C, 10 min) and 40 cycles (95°C, 15 s; 58°C, 30 s; 72°C, 30 s). Thermocycling was conducted using a Bio-Rad MiniOpticon System (Bio-Rad Laboratories, Hercules, CA) and CT was calculated using supplied software. TG2 transcript abundance relative to GAPDH transcript abundance (
CT) was calculated and subsequently used to calculate changes (
) in TG2 gene expression.
DNA extraction from human breast tumors and normal tissues
Fresh-frozen archival breast tumors were obtained from the University of Florida Shands Cancer Center Molecular Tissue Bank. All specimens and pertinent patient information were treated in accordance with policies of the Institutional Review Board of the University of Florida Health Sciences Center. Tumors analyzed in this study were examined by a surgical pathologist and identified as invasive breast adenocarcinoma (stage II or III). Where indicated, matched normal breast tissue was obtained from disease-free surgical margin. gDNA was isolated from these samples, as well as cultured cell lines, using a Qiagen blood and cell culture DNA kit (Qiagen Inc., Valencia, VA) and stored at –20°C prior to use.
Archival blocks of formalin-fixed, paraffin-embedded breast tumors were obtained from Department of Pathology, University of Florida Shands Hospital, in accordance with Institutional Review Board policy. All tumors were confirmed by histological examination to contain both invasive breast carcinoma (IBC) and ductal carcinoma in situ (DCIS) lesions. For each tumor, 10–15 sections were cut and DNA extracted with EX-WAX DNA extraction kit (Chemicon Inc., Temecula, CA) following the manufacturer's protocol.
Sodium bisulfite DNA conversion and methylation-specific polymerase chain reaction
DNA was bisulfite converted and methylation-specific polymerase chain reaction (MSP) reactions were conducted as outlined previously (18). MSP primers specific for methylated (M) TGM2 gene are the forward primer (MF) 5'-GGGTTATAAGTTAGCGTCGTTTTTC-3' and reverse primer (MR) 5'-GAAACCC CTAAATAACGACTACGATA-3'. MSP primers specific for unmethylated (U) TGM2 gene are the forward primer (UF) 5'-GGGTTATAAGTTAGTGTTGTTTTTTG-3' and the reverse primer (UR) 5'-AAAACCCCTAAATAACAACTACAATA-3'. PCR conditions used were 1 cycle (95°C, 15 min); 38 cycles [94°C, 30 s; 60°C (for M primer set) or 56°C (for U primer set), 30 s] and final extension at 72°C for 10 min. Human placental gDNA (Biochain Institute, Hayward, CA) either unmodified or methylated in vitro with SssI methylase (NEB, Ipswich, MA) was used as validation controls.
Bisulfite genomic sequencing
Bisulfite genomic sequencing (BGS) was conducted as outlined previously (21). A 362 bp segment (nucleotide # –294 to +68, translational start site = +1) was amplified from bisulfite-converted gDNA. The primer sequences used for BGS are (UBF) 5'-TTGGGTTAGTTGTGTGTTTTTGTT-3' and (UBR) 5'-AATCCTAACCCCCAATACCCC-3'. Thermocycling conditions used were: 1 cycle (95°C, 15 min); 40 cycles (94°C, 30 s; 55°C, 45 s; 72°C, 1 min) and final extension at 72°C for 10 min. Amplicons were subcloned into the plasmid pCR4-TOPO (Invitrogen, Carlsbad, CA) and recombinants identified by EcoRI digestion and subsequently sequenced using vector-encoded T7 primer.
Immunohistochemistry
TG2 immunostaining was carried out using a previously established protocol (18). Briefly, sections of formalin-fixed, paraffin-embedded human breast tumors were sequentially incubated with mouse monoclonal TG2 antibody (Ab-3), horseradish peroxidase-conjugated anti-mouse IgG, developed with a buffered solution containing 3,3'-diamino-benzidine tetrahydrochloride and counterstained with hematoxylin. As a non-specific antibody control, serial sections were incubated with purified mouse IgG (Sigma). Photomicrographs were taken on a Leica microscope equipped with a digital camera.
Cell transfection
A full-length human TG2 cDNA clone was subcloned into the expression vector pcDNA3-Myc as described previously (15). Cells were seeded into 6-well tissue culture plates and then transfected with 5 µg of plasmid with Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. Cells were subsequently selected with 500 µg/ml G418 (Sigma) for 2 weeks. Subsequently, individual colonies were picked, expanded and screened by immunoblotting.
Cell viability assays
Cell viability was determined using MTT assays as described previously (22). Briefly, cells were seeded into 96-well tissue culture plates at a density of 5 x 103 cells/well. The next day, cells were washed two times with phosphate-buffered saline, fresh medium was added to the wells and indicated concentration of doxorubicin (Sigma) was added. Forty-eight hours after drug addition, 10 µl of 5 mg/ml (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (Sigma) was added to each well and incubated for 1 h at 37°C. The solution was subsequently removed, 100 µl of dimethyl sulfoxide was added to each well and the plate was read using a Bio-Rad microplate reader.
Statistical analysis
The results of cell viability (determined by MTT) and TG2 transcript abundance (determined by qPCR) measurements were expressed as calculated means with standard deviation (SD). A two-tailed Student's t-test was used to compare measurements taken from two samples for statistical significance. When comparing quantitative gene methylation results (obtained by determining the percent methylation of all 35 CpGs present in the BGS amplicon in five individual clones) and gene expression (determined by qPCR), the non-parametric Spearman correlation coefficient (rs) was calculated. All statistical analysis was conducted using software (ver15) developed by SPSS (Chicago, IL). In all cases, a P value of <0.05 was considered significant.
| Results |
|---|
|
|
|---|
Decreased TG2 expression in cultured breast cancer cells correlates with TGM2 gene methylation
Several published reports indicate that TG2 expression is variable among cultured human breast tumor lines (16,23,24). To examine this in a large panel of breast tumor cell lines, we subjected extracts from MDA-MB-231, MDA-MB-468, MCF-7, SK-BR-3, MDA-MB-435S, BT-549 and T-47D cells to immunoblot analysis with anti-TG2 (Figure 1A). As controls, two human non-tumor mammary epithelial cell lines, MCF-10A and 184B5, were included. This side-by-side analysis readily detected expression of the
75 kD TG2 protein in both control lines as well as extracts of MDA-MB-231 cells. In the other breast tumor lines assayed (MDA-MB-468, MCF-7, SK-BR-3, MDA-MB-435S, BT-549 and T-47D), we observed notably reduced or undetectable expression of TG2.
|
Since TG2 expression has been linked to doxorubicin sensitivity, we also conducted viability assays on this panel of cultured human breast tumor lines treated with this drug. These results indicate that most lines show similar levels of sensitivity to doxorubicin (Figure 1B). However, MDA-MB-231 cells, which show higher levels of TG2 expression, show significantly less sensitivity to doxorubicin than the other cell lines tested confirming that sensitivity to this drug corresponds to TG2 expression.
Lu and Davies (17) observed that TG2 expression in human leukemia lines was controlled, in part, by DNA methylation. Therefore, we hypothesized that the low level of TG2 expression we observed in most cell lines stems from aberrant methylation of CpG dinucleotides within the TG2 gene (termed TGM2). As an initial test of this hypothesis, these breast tumor cells were cultured in the presence or absence of the DNA demethylating agent 5-azadC and RT–PCR assays to examine TG2 expression conducted. Paralleling immunoblot results, we observed that MDA-MB-231 cells displayed expression of the TG2 transcript and that the relative abundance of this transcript was unaltered by culture on 5-azadC (Figure 1C). In contrast, TG2 transcript abundance in the other six breast tumor lines was either very low or subdetectable in untreated cells; however, gene expression was notably increased following culture on 5-azadC.
To quantify changes in gene expression, qPCR was performed. Consistent with our RT–PCR results, we measured an insignificant (1.1-fold, ±0.2 SD, n = 4) increase in TG2 mRNA in 5-azadC-treated MDA-MB-231 cells (Figure 1D). Conversely, culturing MDA-MB-468 cells with 5-azadC resulted in an 18.9-fold (±3.4 SD, n = 4) increase in TG2 transcript abundance compared with untreated cultures of this cell line (Figure 1D). Similarly, statistically significant (P < 0.01, Student's t-test) increases in TG2 transcripts were measured in T-47D (10.6-fold, ±2.1 SD, n = 4), MCF-7 (22.9-fold, ±4.3 SD, n = 4), BT-549 (142.0-fold, ±8.9 SD, n = 4), MDA-MB-435S (90.5-fold, ±7.8 SD, n = 4) and SK-BR-3 (37.0-fold, ±4.5 SD, n = 4) cells.
To directly examine TGM2 gene hypermethylation, we first inspected the architecture of the human TGM2 gene using public genome sequence databases. We observed that the TGM2 gene maps to chromosome 20.q11.23, consistent with the location of this gene as previously determined by fluorescence in situ hybridization (25). Inspection of the 5' flanking region of the TGM2 gene showed this region to be unusually CG rich (Figure 2A). As originally described by Gardinier-Garden and Frommer (26), a 316 bp segment of this region of the genome (bp –284 to +32, translational start site = +1) that contains 35 CpG dinucleotides meets the criteria of a canonical CpG island. This CpG island overlaps both the transcriptional and the translational start sites of the TGM2 gene. Aberrant cytosine methylation within CpG islands that encompass both the 5' flanking region and transcriptional start site of a silenced gene is commonly observed in cancer cell genomes (27,28); thus, the architecture of TGM2 marks this gene as a potential candidate for epigenetic silencing.
|
To directly assess CpG methylation in human breast cancer cell lines, we developed a set of oligonucleotide primers useful in MSP (29) and BGS (30) analyses (Figure 2A). For MSP, oligonucleotide primers were designed to amplify a segment of the TGM2 CpG island existing in either an M or a U state based on the modification status of CpG dinucleotides following sodium bisulfite modification. The primers designed to amplify U TGM2 gene sequence yield a 183 bp amplicon spanning from nucleotide # –133 to +50, and the M primer set yield a 182 bp amplicon spanning from nucleotide # –132 to +50. Amplification of the TGM2 gene from bisulfite-treated human placental gDNA was observed using the U-specific primer set but not with the M-specific primer set (Figure 2B). Conversely, when this gDNA was methylated in vitro using SssI methylase and subsequently subjected to bisulfite modification prior to PCR, we observed amplification of the M-specific amplicon but not the U-specific product, and amplification with either primer set was strictly dependent on bisulfite modification of the target DNA. Sequence analysis of both the U and the M amplicons indicated that these primer sets specifically amplify the targeted portion of the TGM2 gene (data not shown). These validation experiments indicate that our MSP primers specifically amplify bisulfite-treated human gDNA in a manner that clearly ascertains the methylation status of the TGM2 gene.
RT–PCR and MSP analysis were subsequently conducted on 184B5 and MCF-10A cells (Figure 2C). RT–PCR analysis of these two normal (non-tumor) control lines indicated that each expresses detectable levels of TGM2 transcript. Additionally, MSP analysis determined that the TGM2 gene is unmethylated in both these cell lines.
gDNA was harvested from our panel of breast cancer cell lines cultured either in the absence or in the presence of 5-azadC and used in MSP assays. We observed amplification of the U-specific, but not the M-specific, amplicon in MDA-MB-231 DNA, indicating that the TGM2 gene is unmethylated in this cell line (Figure 2D). Analysis of T-47D and MBA-MD-468 cells not cultured on 5-azadC showed amplification with both U- and M-specific amplicons indicating the presence of both M and U DNA in these samples. In non-treated cultures of MCF-7, BT-549, MDA-MB-435S and SK-BR-3, we observed exclusive amplification with the M-specific primer set. MSP analysis conducted on these lines after treatment with 5-azadC indicated a clear increase in the amplification of the U-specific product, consistent with demethylation of the TGM2 gene.
To quantitatively assess TGM2 methylation, bisulfite-modified gDNA from these breast cancer lines was analyzed by BGS. This entailed sequencing amplicons obtained using primers designed to regions of the TGM2 gene within the CpG island (see Figure 2A) and devoid of CpG dinucleotides; thus, amplification of bisulfite-modified gDNA proceeds in a manner unbiased by gene methylation status. Following PCR, the 362 bp BGS amplicon was subsequently subcloned into a vector, recombinants were identified, multiple clones were sequenced and the methylation status of the 35 CpG dinucleotides within this region of the genome was determined (30). Results from BGS analysis of MDA-MB-231, MCF-7, MDA-MB-468, BT-549, MDA-MB-435S and SK-BR-3 (with and without culture on 5-azadC) are shown (Figure 2E). MDA-MB-231 cells, which contain a U TGM2 gene as judged by MSP, showed very limited CpG methylation (0.6% of the CpG analyzed) by BGS. Alternatively, BT-549 (70.8%), MCF-7 (33.1%), MDA-MB-435S (73.1%), MDA-MB-468 (25.1%) and untreated SK-BR-3 (37.1%) displayed dense methylation of the CpG island of the TGM2 gene. Further, sparse methylation of the TGM2 gene was observed when gDNA was harvested and analyzed from SK-BR-3 cells cultured in the presence of 5-azadC (5.7%). When gDNA harvested from the control MCF-10A and 184B5 lines was analyzed by BGS, we did not observe any methylation within the CpG island of the TGM2 gene in these cells (see supplementary Figure S1 available at Carcinogenesis online).
To compare TG2 expression with TGM2 gene methylation, we calculated the relative TG2 transcript abundance (as measured by qPCR) using TG2 expression in the non-tumor cell line MCF-10A as the reference. This revealed that the breast tumor line MDA-MB-231, which does not show aberrant CpG methylation within the TGM2 gene, expresses
2-fold higher levels of TG2 than MCF-10A (Figure 3D). Conversely, other breast cancer lines displaying aberrant methylation of the TGM2 gene showed markedly reduced TG2 expression compared with MCF-10A. Analysis of this set of breast tumor lines indicated that the correlation between reduced expression and increased TGM2 methylation (as scored by BGS) is statistically significant [Spearman correlation coefficient (rs) = –0.91, n = 7, P < 0.01].
|
Thus, based on several molecular analyses of cultured breast cancer cell lines, we conclude that the TGM2 gene is a target for CpG hypermethylation and that reduced expression of TG2 correlates with this aberrant epigenetic event.
Aberrant methylation of the TGM2 gene is common in primary human breast tumors
Nine fresh-frozen, locally IBC tumors (stage II or III) and normal breast tissue from the same patient were obtained from the University of Florida Shands Cancer Center Molecular Tissue Bank. gDNA was extracted from these samples, bisulfite modified and used in MSP reactions. Representative data from four of these samples, designated BrCa-11, 12, 13 and 14, are shown (Figure 3A). In all normal breast tissue samples, we observed exclusive amplification of the U-specific amplicon indicating that the TGM2 gene is not methylated in normal mammary tissue. In tumor BrCa-13, we only observed exclusive amplification of the U-specific amplicon, indicating that the TGM2 gene is not methylated in this tumor sample. Conversely, in tumors BrCa-11, 12 and 14, amplification of the M-specific amplicon was detected indicating that CpG methylation of the TGM2 gene also occurs in primary breast tumors. In total, MSP analysis indicated aberrant TGM2 CpG methylation in four of these frozen tumor samples, whereas the remaining five showed no evidence of CpG methylation (see supplementary Table S2 available at Carcinogenesis online).
Total RNA was also harvested from these frozen tumor/normal tissue samples, cDNA was synthesized and qPCR reactions were performed to measure relative TG2 and GAPDH transcript abundance. Again, representative data shown for tumors BrCa-11 through 14 indicate that in tumors BrCa-11, 12 and 14, relative TG2 transcript abundance was significantly reduced (P < 0.01) compared with patient-matched normal tissue samples (Figure 3B). In contrast, TG2 expression was roughly equivalent in tumor and matched normal tissues in sample BrCa-13.
Again, a statistical approach was used to compare TG2 expression with TGM2 gene methylation in this panel of nine frozen matched tumor/normal breast samples. Analysis of this set of breast tumors indicated a statistically significant correlation between reduced expression and increased CpG methylation (rs = –0.85, n = 9, P < 0.01). The results obtained from this qPCR and TGM2 methylation analysis of matched frozen and normal breast samples indicate that, similar to what we have documented in cultured cell lines, reduced TG2 expression correlates with aberrant methylation of the TGM2 gene in breast tumors.
Figure 3C shows representative MSP data obtained from 11 additional IBC tumor samples for which no matched normal samples were available. In tumor samples BrCa-02, 04, 16, 17 and 21, we observed amplification with only the U-specific primer set indicating a lack of TGM2 gene hypermethylation in these tumor samples. Tumor samples BrCa-06, 09 and 22 only showed amplification with the M-specific primer set, whereas BrCa-18 and 20 show amplification with both U- and M-specific primer sets. Of the 45 IBC tumors analyzed during this study, we observed that 20 (44.4%) displayed aberrant methylation of the TGM2 gene as judged by MSP (supplementary Table S2 available at Carcinogenesis online), leading us to conclude that hypermethylation of the TGM2 gene is a frequent event in invasive breast tumors.
BGS was again conducted to examine TGM2 gene methylation in a detailed manner. In the normal breast tissue from patient BrCa-14, we observed limited methylation (2.3%) of the CpG island associated with the TGM2 gene (Figure 3D). Similarly, we observed no methylation of the TGM2 gene in tumor samples BrCa-04 and 13. These results are in accordance with MSP results observed on these tumors and this normal breast tissue sample. In tumor BrCa-06, 09 and 14, we detected extensive CpG methylation clustered in close proximity to the translational start site of the TGM2 gene (70.8%, 38.3% and 37.7%, respectively). Of note, diminished CpG methylation was detected in the region of the CpG island investigated that lies farthest upstream from the transcriptional start site of TGM2. Nevertheless, the results of this experiment clearly indicate that the CpG island present at the 5' flank of the human TGM2 gene is subject to dense methylation in breast tumors. Moreover, since dense TGM2 methylation is not observed in normal breast tissues such as BrCa-14N (Figure 3D) and other normal tissues examined (data not shown), TGM2 hypermethylation in tumor tissues is an aberrant, disease-associated event.
We next examined TG2 expression in 10 different archival breast tumor samples by immunohistochemistry and, in general, found tumors to have three types of staining patterns. In some patient samples, such as BrCa-101, we observed prominent staining of normal ductal epithelium, DCIS and regions of IBC (Figure 4A). When this tumor was incubated with non-specific purified mouse IgG, we observed no staining (Figure 4A), confirming the specificity of the staining using anti-TG2. In other tumors, such as BrCa-104, strong staining was observed in normal mammary ductal epithelium; however, moderate staining was evident in both DCIS and IBC lesions (Figure 4B). Yet other tumors, such as BrCa-109, displayed sharply reduced staining in both DCIS and IBC lesions (Figure 4C).
|
Following immunohistochemistry analysis, gDNA was extracted from each of these tumor specimens, bisulfite modified and used in MSP assays. MSP analysis of DNA extracted from tumor BrCa-101 indicated that this tumor contains U TGM2 and no M-specific PCR amplicon was detected (Figure 4A). MSP analysis of tumor BrCa-104 showed amplification of both U- and M-specific TGM2 amplicons indicating some level of TG2 silencing in this tumor (Figure 4B). MSP analysis of DNA extracted from tumor BrCa-109 displayed strong amplification of the TGM2 M-specific amplicon and relatively weak amplification of the U-specific amplicon (Figure 4C). Of note, in tumors such as BrCa-109 that display hallmarks consistent with epigenetic silencing of TG2 expression, we have observed regions of the tumor that express abundant TG2 as judged by immunohistochemistry (data not shown). This suggests heterogeneous TG2 silencing within individual breast tumors. Nevertheless, our findings indicate that methylation of the TGM2 gene correlates with reduced expression of TG2 in situ and that this aberrant molecular event can occur at a relatively early stage in the process of breast tumor progression.
Epigenetic silencing of the TGM2 gene results in heightened doxorubicin sensitivity in cultured breast tumor lines
Others have documented that derivatives of MCF-7 cells that demonstrate doxorubicin resistance (designated MCF-7/ADR) express higher levels of TG2 than parental MCF-7 cells that retain sensitivity to this drug (16). Based on our studies, we hypothesized that this difference in TG2 expression was attributable to differences in the methylation status of the TGM2 gene in these cells. To test this, MSP was conducted on MCF-7, MCF-7/ADR and MCF-7 cells treated with 5-azadC. This analysis indicated, although MCF-7 shows TGM2 hypermethylation that can be partially reversed by 5-azadC, that MCF-7/ADR cells do not display methylation of TGM2 (Figure 5A). Furthermore, whereas BGS analysis confirmed that the TGM2 gene is densely methylated in MCF-7 (see Figure 2E), this gene was significantly demethylated in MCF-7 treated with 5-azadC and very low levels of methylation were scored in MCF-7/ADR cells (see supplementary Figure S1 available at Carcinogenesis online). Immunoblotting showed that TG2 expression is markedly lower in MCF-7 cells compared with MCF-7/ADR and that 5-azadC treatment clearly raises the TG2 expression level in MCF-7 cells but not to the level observed in MCF-7/ADR cells or MCF-7 cells stably transfected with a recombinant human TG2 expression construct (Figure 5B).
|
Next, the effect of 5-azadC treatment on the sensitivity of MCF-7 to doxorubicin was examined. As expected, we observed that MCF-7/ADR cells show significantly less sensitivity to this drug than MCF-7 (Figure 5C) as judged by MTT viability assays 48 h after drug addition. We also observed that 5-azadC treatment of MCF-7 cells resulted in a statistically significant (P < 0.01, Student's t-test) increase in doxorubicin resistance; however, 5-azadC-induced resistance was lower than that exhibited by MCF-7/ADR cells. This partial complementation of the doxorubicin-sensitive phenotype of MCF-7 cells may perhaps be due to the lower level of TG2 expression exhibited by the 5-azadC-treated MCF-7 compared with MCF-7/ADR cells, suggesting that the level of TG2 expression quantitatively influences doxorubicin sensitivity. In addition to these experiments, and consistent with the findings of others (23), we observed that expression of recombinant human TG2 in MCF-7 cells also reduces sensitivity to doxorubicin.
| Discussion |
|---|
|
|
|---|
We have documented that cultured human breast tumor cell lines often show reduced expression of the TG2 protein. TG2 expression is restored by culturing these cells in the presence of the global demethylating agent 5-azadC, consistent with DNA methylation controlling expression of the TGM2 gene. Using a variety of approaches, we confirmed that the CpG island present at the 5' flank of the human TGM2 gene is subject to dense methylation in both cultured cells and primary breast tumors. Moreover, this aberrant CpG methylation is associated with reduced TG2 expression. The frequency at which this aberrant event was encountered in primary breast tumors (
44%) indicates that epigenetic silencing of the TGM2 gene is a common event in this tumor type. Owing to the multifunctional nature of the TG2 protein, there are several ways in which loss of TG2 expression through epigenetic silencing could impact the process of tumorigenesis and, indeed, several lines of evidence implicate TG2 as a tumor suppressor (31–34). One such way is through suppression of its proposed proapoptotic function given the prominent role that dysregulation of apoptotic mechanisms play in tumorigenesis by allowing cells to extend life span (35). Rodolfo et al. (12) observed that TG2 possesses an eight amino acid region sharing >70% of identity with the BH3 domain of the Bcl-2 family, thus placing TG2 in a growing family of proapoptotic BH3-only proteins (36). In support of this assertion, cell-permeable TG2-BH3 peptide was observed to induce a conformational change and translocation of Bax to the mitochondria and promote release of cytochrome c. In addition, TG2-induced Bax polymerization may occur when the cytosolic level of Ca2+ is increased during apoptosis resulting in stabilization of the apoptosis-promoting conformation of Bax and prolonging cytochrome c release. In this view, TG2 would apparently act both as an upstream regulator of the apoptotic response and as an intensifier of the process by prolonging Bax activity (37).
Another mechanism by which TG2 silencing may contribute to tumor development is through its proposed function as a barrier to tumor spread by promoting ECM cross-linking, rendering the ECM resistant to mechanical and proteolytic degradation and stabilizing cell–ECM interaction (10). Maintenance of ECM integrity has a distinctly important role in breast cancer since the majority of breast cancers are adenocarcinomas that develop from the ductal epithelium of the mammary gland. Although cells that comprise a DCIS lesion are tumor cells and free to infiltrate ductal structure, this type of lesion is physically constrained, in part, by the basement membrane surrounding the duct. DCIS lesions that acquire an invasive capability can break through this barrier and invade surrounding stroma resulting in a more serious invasive tumor. Our observation that TG2 expression can be diminished in DCIS lesions suggests that reduced expression of this gene may help facilitate breast tumor invasiveness.
TG2 also facilitates the incorporation of transforming growth factor-β into the ECM (38) and loss of extracellular TG2 activity could potentially negatively impact transforming growth factor-β function as a tumor suppressor (39). More recently, the atypical G protein-coupled receptor and metastasis suppressor, GPR56, was shown to bind TG2 suggesting yet another mechanism by which loss of TG2 would favor tumor progression (33). Furthermore, ECM stiffness, which would potentially be influenced by TG2-induced cross-linking, is gaining acceptance as a key regulator of cell behavior and may play an integral role in the process of tumorigenesis and invasion (40,41). Thus, although the exact mechanism(s) by which TG2 functions to limit tumorigenesis remains unclear, it is reasonable to conclude that epigenetic silencing of TGM2 would contribute to the carcinogenic process by severely reducing its ability to suppress tumor growth and/or metastasis.
Consistent with the observations originally made by Mehta (16), we have documented that doxorubicin-resistant MCF-7/ADR cells display heightened TG2 expression when compared with the parental, doxorubicin-sensitive MCF-7 line. We extended this study by documenting that MCF-7 cells have hypermethylated the TGM2 gene and hence silenced TG2 expression, whereas MCF-7/ADR cells have not silenced this gene. This finding argues that the difference in doxorubicin sensitivity between MCF-7 and MCF-7/ADR cells does not stem from overexpression of TG2 in MCF-7/ADR per se, but rather an aberrant molecular event within the MCF-7 line resulting in abnormally low TG2 expression. Taken together, the conclusion drawn is that epigenetic silencing of TG2 results in a doxorubicin-sensitive phenotype in MCF-7 cells.
Various mechanistic models have been proposed to explain the molecular mechanism by which TG2 influences sensitivity to doxorubicin (23,24,42,43). Although the exact mechanism(s) by which TG2 controls sensitivity to this drug remains an active topic for investigation, it is clear that TG2 expression status exerts control over the cytotoxic response to doxorubicin. Since doxorubicin (adriamycin) is a common, and effective, drug for treating breast cancer as either a neoadjuvant and/or an adjuvant therapeutic, our findings have potential clinical relevance given that doxorubicin has well-documented adverse cardiac side-effects (44) and that anthracycline resistance is commonly encountered in breast tumors (45).
| Supplementary material |
|---|
|
|
|---|
Supplementary material can be found at http://carcin.oxfordjournals.org/
| Funding |
|---|
|
|
|---|
National Institutes of Health (R01 CA102289 [GenBank] and R21 CA102220 [GenBank] ) to K.D.B.
| Acknowledgments |
|---|
The authors thank Drs Michael Kladde and Mandy Robertson for helpful comments on this manuscript.
Conflict of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Weinberg RA. How cancer arises. Sci. Am. (1996) 275:62–70.[Web of Science][Medline]
- Bird AP, et al. Methylation-induced repression—belts, braces, and chromatin. Cell (1999) 99:451–454.[CrossRef][Web of Science][Medline]
- Wolffe AP. Chromatin remodeling: why it is important in cancer. Oncogene (2001) 20:2988–2990.[CrossRef][Web of Science][Medline]
- Esteller M. Cancer epigenetics: DNA methylation and chromatin alterations in human cancer. Adv. Exp. Med. Biol. (2003) 532:39–49.[Web of Science][Medline]
- Jones PA, et al. The fundamental role of epigenetic events in cancer. Nat. Rev. Genet. (2002) 3:415–428.[Web of Science][Medline]
- Robertson KD. DNA methylation and human disease. Nat. Rev. Genet. (2005) 6:597–610.[CrossRef][Web of Science][Medline]
- Lorand L, et al. Transglutaminases. Mol. Cell. Biochem. (1984) 58:9–35.[CrossRef][Web of Science][Medline]
- Chen JS, et al. Tissue transglutaminase: an enzyme with a split personality. Int. J. Biochem. Cell. Biol. (1999) 31:817–836.[CrossRef][Web of Science][Medline]
- Aeschlimann D, et al. Protein crosslinking in assembly and remodelling of extracellular matrices: the role of transglutaminases. Connect. Tissue Res. (2000) 41:1–27.[Web of Science][Medline]
- Zemskov EA, et al. The role of tissue transglutaminase in cell-matrix interactions. Front. Biosci. (2006) 11:1057–1076.[Web of Science][Medline]
- Telci D, et al. Tissue transglutaminase (TG2)—a wound response enzyme. Front. Biosci. (2006) 11:867–882.[CrossRef][Web of Science][Medline]
- Rodolfo C, et al. Tissue transglutaminase is a multifunctional BH3-only protein. J. Biol. Chem. (2004) 279:54783–54792.
[Abstract/Free Full Text] - Boehm JE, et al. Tissue transglutaminase protects against apoptosis by modifying the tumor suppressor protein p110 Rb. J. Biol. Chem. (2002) 277:20127–20130.
[Abstract/Free Full Text] - Milakovic T, et al. Intracellular localization and activity state of tissue transglutaminase differentially impacts cell death. J. Biol. Chem. (2004) 279:8715–8722.
[Abstract/Free Full Text] - Yamaguchi H, et al. Tissue transglutaminase serves as an inhibitor of apoptosis by cross-linking caspase 3 in thapsigargin-treated cells. Mol. Cell Biol. (2006) 26:569–579.
[Abstract/Free Full Text] - Mehta K. High levels of transglutaminase expression in doxorubicin-resistant human breast carcinoma cells. Int. J. Cancer (1994) 58:400–406.[Web of Science][Medline]
- Lu S, et al. Regulation of the expression of the tissue transglutaminase gene by DNA methylation. Proc. Natl Acad. Sci. USA (1997) 94:4692–4697.
[Abstract/Free Full Text] - Ai L, et al. Epigenetic silencing of the tumor suppressor cystatin M occurs during breast cancer progression. Cancer Res. (2006) 66:7899–7909.
[Abstract/Free Full Text] - Kim WJ, et al. Aberrant methylation of the ATM promoter correlates with increased radiosensitivity in a human colorectal tumor cell line. Oncogene (2002) 21:3864–3871.[CrossRef][Web of Science][Medline]
- Adamson AW, et al. Methylator-induced, mismatch repair-dependent G2 arrest is activated through Chk1 and Chk2. Mol. Biol. Cell (2005) 16:1513–1526.
[Abstract/Free Full Text] - Vo QN, et al. The ATM gene is a target for epigenetic silencing in locally advanced breast cancer. Oncogene (2004) 23:9432–9437.[CrossRef][Web of Science][Medline]
- Kim WJ, et al. The monofunctional alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine triggers apoptosis through p53-dependent and -independent pathways. Toxicol. Appl. Pharmacol. (2005) 202:84–98.[CrossRef][Web of Science][Medline]
- Herman JF, et al. Implications of increased tissue transglutaminase (TG2) expression in drug-resistant breast cancer (MCF-7) cells. Oncogene (2006) 25:3049–3058.[CrossRef][Web of Science][Medline]
- Kim DS, et al. Reversal of drug resistance in breast cancer cells by transglutaminase 2 inhibition and nuclear factor-kappaB inactivation. Cancer Res. (2006) 66:10936–10943.
[Abstract/Free Full Text] - Gentile V, et al. The human tissue transglutaminase gene maps on chromosome 20q12 by in situ fluorescence hybridization. Genomics (1994) 20:295–297.[CrossRef][Web of Science][Medline]
- Gardiner-Garden M, et al. CpG islands in vertebrate genomes. J. Mol. Biol. (1987) 196:261–282.[CrossRef][Web of Science][Medline]
- Feltus FA, et al. Predicting aberrant CpG island methylation. Proc. Natl Acad. Sci. USA (2003) 100:12253–12258.
[Abstract/Free Full Text] - Ushijima T. Detection and interpretation of altered methylation patterns in cancer cells. Nat. Rev. Cancer (2005) 5:223–231.[CrossRef][Web of Science][Medline]
- Herman JG, et al. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl Acad. Sci. USA (1996) 93:9821–9826.
[Abstract/Free Full Text] - Frommer M, et al. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl Acad. Sci. USA (1992) 89:1827–1831.
[Abstract/Free Full Text] - Haroon ZA, et al. Tissue transglutaminase is expressed as a host response to tumor invasion and inhibits tumor growth. Lab. Invest. (1999) 79:1679–1686.[Web of Science][Medline]
- Johnson TS, et al. Transfection of tissue transglutaminase into a highly malignant hamster fibrosarcoma leads to a reduced incidence of primary tumour growth. Oncogene (1994) 9:2935–2942.[Web of Science][Medline]
- Xu L, et al. GPR56, an atypical G protein-coupled receptor, binds tissue transglutaminase, TG2, and inhibits melanoma tumor growth and metastasis. Proc. Natl Acad. Sci. USA (2006) 103:9023–9028.
[Abstract/Free Full Text] - Jones RA, et al. Matrix changes induced by transglutaminase 2 lead to inhibition of angiogenesis and tumor growth. Cell Death Differ. (2006) 13:1442–1453.[CrossRef][Web of Science][Medline]
- Reed JC. Dysregulation of apoptosis in cancer. J. Clin. Oncol. (1999) 17:2941–2953.
[Abstract/Free Full Text] - Willis SN, et al. Life in the balance: how BH3-only proteins induce apoptosis. Curr. Opin. Cell Biol. (2005) 17:617–625.[CrossRef][Web of Science][Medline]
- Fesus L, et al. Transglutaminase 2 in the balance of cell death and survival. FEBS Lett. (2005) 579:3297–3302.[CrossRef][Web of Science][Medline]
- Verderio E, et al. Regulation of cell surface tissue transglutaminase: effects on matrix storage of latent transforming growth factor-beta binding protein-1. J. Histochem. Cytochem. (1999) 47:1417–1432.
[Abstract/Free Full Text] - Jakowlew SB. Transforming growth factor-beta in cancer and metastasis. Cancer Metastasis Rev. (2006) 25:435–457.[CrossRef][Web of Science][Medline]
- Discher DE, et al. Tissue cells feel and respond to the stiffness of their substrate. Science (2005) 310:1139–1143.
[Abstract/Free Full Text] - Huang S, et al. Cell tension, matrix mechanics, and cancer development. Cancer Cell (2005) 8:175–176.[CrossRef][Web of Science][Medline]
- Fok JY, et al. Implications of tissue transglutaminase expression in malignant melanoma. Mol. Cancer Ther. (2006) 5:1493–1503.
[Abstract/Free Full Text] - Mann AP, et al. Overexpression of tissue transglutaminase leads to constitutive activation of nuclear factor-{kappa}B in cancer cells: delineation of a novel pathway. Cancer Res. (2006) 66:8788–8795.
[Abstract/Free Full Text] - Perez EA. Doxorubicin and paclitaxel in the treatment of advanced breast cancer: efficacy and cardiac considerations. Cancer Invest. (2001) 19:155–164.[CrossRef][Web of Science][Medline]
- Hortobagyi GN. Management of breast cancer: status and future trends. Semin. Oncol. (1995) 22:101–107.[Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. E. Iismaa, B. M. Mearns, L. Lorand, and R. M. Graham Transglutaminases and Disease: Lessons From Genetically Engineered Mouse Models and Inherited Disorders Physiol Rev, July 1, 2009; 89(3): 991 - 1023. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





