Skip Navigation


Carcinogenesis Advance Access originally published online on January 3, 2008
Carcinogenesis 2008 29(3):528-535; doi:10.1093/carcin/bgm289
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
29/3/528    most recent
bgm289v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Finger, E. C.
Right arrow Articles by Blobe, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Finger, E. C.
Right arrow Articles by Blobe, G. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

TβRIII suppresses non-small cell lung cancer invasiveness and tumorigenicity

Elizabeth C. Finger1,{dagger}, Ryan S. Turley2,{dagger}, Mei Dong2, Tam How2, Timothy A. Fields3 and Gerard C. Blobe1,2,*

1 Department of Pharmacology and Cancer Biology
2 Department of Medicine
3 Department of Pathology, Duke University Medical Center, 221B MSRB Research Drive, Durham, NC 27710, USA

* To whom correspondence should be addressed. Tel: +1 919 668 1352; Fax: +1 919 668 2458; Email: blobe001{at}mc.duke.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
The transforming growth factor-β (TGF-β) superfamily has essential roles in lung development, regulating cell proliferation, branching morphogenesis, differentiation and apoptosis. Although most lung cancers become resistant to the tumor suppressor effects of TGF-β, and loss or mutation of one of the components of the TGF-β signaling pathway, including TβRII, Smad2 and Smad4 have been reported, mutations are not common in non-small cell lung cancer (NSCLC). Here we demonstrate that the TGF-β superfamily co-receptor, the type III TGF-β receptor (TβRIII or betaglycan) is lost in the majority of NSCLC specimens at the mRNA and protein levels, with loss correlating with increased tumor grade and disease progression. Loss of heterozygosity at the TGFBR3 genomic locus occurs in 38.5% of NSCLC specimens and correlates with decreased TβRIII expression, suggesting loss of heterozygosity as one mechanism for TβRIII loss. In the H460 cell model of NSCLC, restoring TβRIII expression decreased colony formation in soft agar. In the A549 cell model of NSCLC, restoring TβRIII expression significantly decreased cellular migration and invasion through Matrigel, in the presence and absence of TGF-β1, and decreased tumorigenicity in vivo. In a reciprocal manner, shRNA-mediated silencing of endogenous TβRIII expression enhanced invasion through Matrigel. Mechanistically, TβRIII functions, at least in part, through undergoing ectodomain shedding, generating soluble TβRIII, which is able to inhibit cellular invasiveness. Taken together, these results support TβRIII as a novel tumor suppressor gene that is commonly lost in NSCLC resulting in a functional increase in cellular migration, invasion and anchorage-independent growth of lung cancer cells.

Abbreviations: FBS, fetal bovine serum; LOH, loss of heterozygosity; PCR, polymerase chain reaction; TGF-β, transforming growth factor-β; TβRIII, type-III TGF-β receptor


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
The transforming growth factor-β (TGF-β) superfamily is composed of >30 polypeptide growth factors that regulate essential processes including cell proliferation, differentiation, adhesion, angiogenesis and embryonic development (15). Three highly conserved and tissue-specific TGF-β isoforms signal through heteromeric complexes of three cell-surface receptors, the type III TGF-β receptor (TβRIII or betaglycan), the type II TGF-β receptor (TβRII) and the type I TGF-β receptor (TβRI). Upon ligand binding, the constitutively active TβRII transphosphorylates the GS region of TβRI to activate its kinase function. TβRI can then phosphorylate C-terminal serine residues on transcription factors known as Smads, specifically the receptor Smads, Smad2 and Smad3, which then associates with the common Smad, Smad4. This association allows translocation of the complex into the nucleus and transcription of target genes. This classical Smad-dependent TGF-β signaling results in negative regulation of cell proliferation in epithelial, endothelial and hematopoietic cells (1,6).

TβRIII, the most abundantly expressed TGF-β receptor, is an 849 amino acid heparan sulfate proteoglycan with a short cytoplasmic tail that fundamentally contributes to TGF-β signaling, resulting in either inhibition or enhancement of signaling, through mechanisms yet to be defined (2,7,8). TβRIII is classically thought to function as a TGF-β superfamily co-receptor, presenting ligand to the signaling receptors (9). Recent studies have suggested an essential, non-redundant role for TβRIII in mediating and regulating signaling through TβRII and TβRI as well as potentially signaling independently of TβRII and TβRI. Importantly, TβRIII null embryos are not viable and die between embryonic day 16.5 and birth with hepatic and cardiovascular defects (10). An essential role for TβRIII has also been demonstrated in mesenchymal transformation in chick embryonic heart development (11,12) and in mediating TGF-β resistance in intestinal goblet cells (13). We have defined essential roles for the cytoplasmic domain of TβRIII in mediating TGF-β signaling independent of the ligand presentation role (11), along with regulating cell-surface levels of TβRIII and TβRII through interactions with GAIP-interacting protein, C terminus (GIPC) (14) and β-arrestin2 (11).

The TGF-β signaling pathway has an essential role in lung development through its regulation of angiogenesis, proliferation and differentiation (15). Although many lung cancers become resistant to the homeostatic effects of TGF-β, the mechanism by which this occurs is not known. Loss or mutation of one of the components of the TGF-β signaling pathway, including TβRII, Smad2 and Smad4 have been reported previously; however, these mutations are not common in non-small cell lung cancer (NSCLC) (16). Smad2 and Smad4 mutations have been found in only 5–10% of lung cancers and most NSCLC express both TβRI and TβRII (1719). Given that the expression and functional significance of TβRIII in lung cancer have not been established and that TβRIII has an emerging role in regulating TGF-β signaling, here we investigate the role of TβRIII in NSCLC.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
cDNA array
A filter array containing normalized cDNA from 21 lung cancers and corresponding normal tissues (Cancer Profiling Array I, Clontech, Mountain View, CA) was probed with [32P]-labeled cDNA probes for TβRIII following methods recommended by the manufacturer. In the 21 lung cancer samples, there were 11 squamous cell, 5 adenocarcinoma (one including squamous cell features), 3 bronchioloalveolar adenocarcinoma and 2 malignant carcinoid tumors. The TβRIII cDNA probe was polymerase chain reaction (PCR) amplified using the forward primer, gtagtgggttggccagatggt, and reverse primer, ctgctgtctcccctgtgtg. Purified PCR products (25 ng) were labeled by random-primed DNA labeling using [32P]-dCTP following the manufacturer's protocol (Roche Molecular Biochemicals, Indianapolis, IN). Labeled cDNA probe was purified on BD CHROMA SPIN+STE-100 column (BD Bioscience Clontech, Mountain View, CA). Images were acquired using a phosphorimager, and subsequent data analysis was performed using NIH Image J software. The densitometry units for the TβRIII probed array (with background subtracted) were normalized to densitometry units for a control ubiquitin probed array (with background subtracted). A ratio (normal/tumor) of 1.8 or higher was considered significant.

DNA extraction and microsatellite–PCR loss of heterozygosity analysis
Fifteen patients' lung tumor samples along with patient-matched normal lung tissues (paraffin embedded) were obtained from the DUKE Cancer Tissue Bank. DNA was extracted as previously described (20). Microsatellite markers, D1S1588, D1S188 and D1S2804, in which the forward primer was synthesized with a 5' fluorescent tag (Integrated DNA Technology), were used in PCRs with the genomic DNA and analyzed for loss of heterozygosity (LOH) by sequencing and analysis on high melting temperature agarose gels, as described previously (20).

Cell culture and reagents
A549 and H460 cells were generously provided by Dr Michael Kelley's Laboratory (Duke University). Both cell types were maintained in RPMI 1640 media supplemented with 10% fetal bovine serum (FBS). Cells were passaged at 37°C in 5% CO2.

Stable cell lines
Using two 10 cm plates per cell type, A549 and H460 cells were plated in RPMI 1640 media supplemented with 10% FBS and grown to 80% confluency in each dish. In one 10 cm plate, 10 µg full-length, HA-tagged human TβRIII was transfected using Fugene according to the manufacturer's protocol. The empty vector pcDNA3.1 was transfected in the other dish following the same transfection protocol. After 48 h, selection was performed as described previously (20).

Monolayer wound healing, fibronectin transwell and Matrigel invasion assays
Performed as described previously, with the exception of 20 000–25 000 A549 cells stably expressing pcDNA3.1 or TβRIII utilized for fibronection transwell motility assays and 50 000–100 000 cells of A549 stable cells lines for Matrigel invasion assays (20). Experiments requiring adenovirus infection utilized A549-Neo cells initially plated in six-well dishes and infected with shTβRIII or shEND (control) 48–72 h prior to plating on Matrigel filters. Knockdown of TβRIII expression was confirmed at these time points by 125I-TGF-β1 binding and cross-linking.

Colony formation in soft agar
The 12- or 24-well plates were coated with a 1.6% agarose, 2x Dulbecco's modified Eagle's medium and FBS solution and allowed to solidify to form the base agar with a final concentration of 0.71% agarose. H460 cells were counted and 1 x 104 or 1 x 105 cells (per triplicate) were added to a master mix containing 2x Dulbecco's modified Eagle's medium, 1% agarose, FBS and RPMI (containing 10% serum and 500 µg/ml G418) with the final top agar concentration of 0.4% agarose. The plates were put at 4°C for 10 min to solidify the top agar and then incubated at 37°C in 5% CO2 for 7 to 14 days. Cells were examined with a x4 objective and also stained with a 0.02% crystal violet solution overnight and colonies were counted using Adobe Photoshop.

Tumorigenicity in nude mice
A total of 200 000 A549-Neo or A549-RIII cells were suspended in 100 µl sterile phosphate-buffered saline and injected subcutaneously into both flanks of 4- to 6-week-old female Balb/cAnNcr-Nu/Nu mice (NCI-Frederick). The A549-Neo group was composed of six mice and the A549-RIII group was composed of seven mice. Tumor volume was measured every 3 days in two dimensions using calipers. Tumor volume was determined using the following formula: volume = 0.52 x L x W2, where L represents the larger dimension and W the smaller dimension. Weight of the mice was also monitored every 3 days.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Loss of TβRIII expression in NSCLC
To investigate whether TβRIII expression was altered in NSCLC specimens, we initially analyzed a cDNA array containing 21 human NSCLC samples with matched normal controls (Figure 1A). Across all specimens, we observed a 2.4-fold decrease in TβRIII mRNA expression in tumor versus normal samples (P < 0.01, two-tailed t-test) (Figure 1B). TβRIII mRNA expression levels were reduced in 66.7% (14/21) of the NSCLC samples, including in 80% (4/5) of the adenocarcinoma specimens, 100% (3/3) of the bronchioalveolar adenocarcinoma specimens, 54.5% (6/11) of the squamous cell carcinoma specimens and 50% (1/2) of the malignant carcinoid specimens (Figure 1C). To confirm decreased expression of TβRIII in these subtypes of NSCLC, we examined expression at the protein level by performing immunohistochemical analysis for TβRIII protein expression on a commercially available lung cancer tissue array containing 56 cases of NSCLC tumor along with matched normal lung tissue. TβRIII staining intensity for each core lung tissue sample was scored on scale of 0–4 by three independent observers, including a board certified pathologist, where a score of 0 corresponds to no staining, 1 to trace staining, 2 to low levels, 3 to medium levels and 4 to high levels of specific staining (Figure 2A). Overall, there was a significant decrease in TβRIII staining in the tumor tissues (N = 46) compared with normal tissues (N = 29) (Figure 2B, P < 0.0001, two-tailed t-test). When broken down by histological subtype, there was also a significant decrease in TβRIII staining in adenocarcinoma specimens (n = 18) compared with normal tissues (Figure 2B, P = 0.017, two-tailed t-test) and in squamous cell carcinoma specimens (n = 26) compared with normal tissues (Figure 2B, P < 0.0001, two-tailed t-test). Further analysis of the squamous cell carcinoma specimens demonstrated a significant decrease in TβRIII expression with increasing tumor grade (Figure 2C, P < 0.001, analysis of variance). To directly assess the role of loss of TβRIII expression in NSCLC progression, we assessed matched tissue sets for which matching normal lung and NSCLC specimens were available for analysis (Figure 2D). The majority of matched pairs that had specific staining (74%, 17/23) demonstrated a change in TβRIII expression, with a decrease in 88% (15/17) of the pairs (Figure 2D).


Figure 1
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Decreased TβRIII expression in NSCLC specimens. (A) The portion of an array (Cancer Profiling Array I, Clontech) containing normalized cDNA from 21 NSCLCs (T) and corresponding normal tissues (N) probed with [32P]-labeled human TβRIII cDNA is shown. (B) Quantitative data were obtained by analyzing the array with NIH Image J software. Mean TβRIII expression values ± SEM for all normal versus all cancer tissues are shown, P < 0.01, independent two-tailed t-test. (C) Quantitative data were summarized by fold decrease (N/T) for each histological subgroup and expressed as mean ± SEM.

 


Figure 2
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Decreased TβRIII protein expression during NSCLC progression. (A) Representative immunohistochemical staining for TβRIII expression for both normal and tumor tissues are shown. Immunoreactivity for TβRIII was scored on a 0–4 scale, 0 (no staining) and 4 (high levels of staining). (B) Mean TβRIII expression of all normal lung tissue cores (N = 29), compared with mean TβRIII expression in all tumors (P < 0.0001, N = 46), and mean TβRIII expression in adenocarcinoma (P = 0.017, N = 18) or squamous cell lung cancers (P < 0.0001, N = 26), respectively. (C) Squamous cell carcinoma specimens were divided based on grade and mean TβRIII expression in tumor-matched normal specimens, in Grade 2 tumors and Grade 3/4 tumors were calculated, P < 0.001. (D) Individual patient's matched normal and invasive NSCLC IHC TβRIII scores. All normals between 3 and 4 scored a 3.5. Bars, SEM.

 
As TβRIII protein levels correlated with the TβRIII mRNA levels, we examined publicly available databases for additional confirmation of loss of TβRIII expression in NSCLC specimens. Using four previously published gene profiling studies of benign lung and lung cancer specimens publicly available through the Gene Expression Omnibus repository and the Oncomine Gene Profiling Databases (www.oncomine.org), we established that mean TβRIII mRNA levels were decreased in adenocarcinoma lung tumor tissue as compared with normal lung tissue in all four studies (Supplementary Figure 1A available at Carcinogenesis Online) (2124). Moreover, combining all four studies in a meta-analysis, we calculated the combined standard difference in means to be –1.58 ± 0.183 (95% confidence interval –1.94 to –1.22, P < 0.0001, Supplementary Figure 1B available at Carcinogenesis Online), confirming loss of TβRIII expression in adenocarcinoma as compared with benign lung. There was a similar statistically significant decrease in TβRIII mRNA levels in squamous cell carcinoma samples relative to normal controls (data not shown). In two of the four studies, TβRIII expression was also available for well versus poorly differentiated tumors. A meta-analysis of these two studies revealed decreased TβRIII expression in poorly differentiated lung cancers relative to well-differentiated lung cancers, with a standard difference in means of –1.09 ± 0.31 (95% confidence interval –1.69 to –0.49, P < 0.0001, Supplementary Figure 1C available at Carcinogenesis Online). One additional study by Raponi et al. (25) demonstrated a trend (P = 0.056) toward decreased TβRIII expression with decreased squamous cell carcinoma patients' 5-year survival. Taken together, these results support decreased TβRIII expression in NSCLC at both the message and protein level, with decreased expression correlating with NSCLC progression and increasing tumor grade, and a trend towards decreased survival.

Loss of heterozygosity at the TGFBR3 genomic locus
The short arm of chromosome 1, where TGFBR3 is located, exhibits loss of heterozygosity in a number of human cancers, including lung cancer (26). Here, we explored whether LOH represents a mechanism for decreased TβRIII expression in human lung cancer. We first performed PCR-based LOH analysis using three microsatellite markers (D1S1588, D1S188 and D1S2804) that are informative for the TGFBR3 genomic locus at 1p32 on 15 NSCLC patients' tumor-matched normal tissue specimens. Using these three markers (informative for 13/15 samples) in two experimental methods (sequencing and PCR gel analysis), we established that 38.5% (5/13) of our samples displayed LOH at the TGFBR3 genomic locus (Figure 3A, data not shown). To establish whether LOH correlated with loss of TβRIII expression at the protein level, we examined TβRIII expression by immunohistochemistry on these tissues and confirmed that a decrease in TβRIII protein expression correlated with LOH at the TGFBR3 genomic locus in every sample (5/5, Figure 3B and C; the colour version of Figure 3 is available at Carcinogenesis Online). In addition, the other eight tumor samples demonstrated a decrease in TβRIII protein expression compared with their matched normal counterparts, suggesting there could be other methods for this loss, including epigenetic regulation, which we have previously demonstrated in breast and prostate cancer (20,27).


Figure 3
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Loss of heterozygosity of the TGFBR3 genomic locus correlates with decreased expression in NSCLC. (A) Genomic DNA was extracted from 15 patient tumor-matched normal lung tissue samples to examine the TGFBR3 locus through PCR-based LOH analysis using three microsatellite markers, with these PCR products analyzed using an ABI sequencer. Graphically represented are a matched normal (top)/tumor (bottom) sample, from which peak areas were determined and an LOH ratio was ascertained, demonstrating LOH of the TGFBR3 locus on chromosome 1p32 in the tumor sample. (B–C) Loss of TβRIII protein expression in the tissue specimens exhibiting LOH at the TGFBR3 genomic locus was confirmed by immunohistochemistry, with high TβRIII expression in normal lung tissue (B), and loss of expression in the corresponding NSCLC specimen (C), indicated by arrows.

 
TβRIII expression does not affect lung cancer cell proliferation
To examine the effects of altered TβRIII expression on NSCLC cells, we initially screened a number of NSCLC cell lines for TGF-β responsiveness and TGF-β receptor levels. We chose to focus on two adherent NSCLC cell lines, A549 and H460, which are commonly used and express relatively normal levels of TβRII and TβRI, but low to normal levels of TβRIII. We then created stable cell lines for both A549 and H460 expressing TβRIII (A549-RIII, H460-RIII) and control cell lines expressing empty vector, pcDNA3.1 (A549-Neo, H460-Neo) and confirmed increased TβRIII expression in A549-RIII and H460-RIII cells as compared with A549-Neo and H460-Neo cells by I125-TGF-β1 binding and cross-linking (Supplementary Figure 2A available at Carcinogenesis Online). Receptor expression at the RNA level in each stable cell line was further confirmed by reverse transcription-PCR (Supplementary Figure 2B available at Carcinogenesis Online). We then characterized the effect of TβRIII on TGF-β1-mediated inhibition of growth, which assessed the combined effects on proliferation and apoptosis. Exogenous expression of TβRIII had no effect on A549 cell growth in the presence or absence of 100 pM TGF-β1, as the growth curves of A549-Neo and A549-RIII were similar and within error, with or without TGF-β1 treatment (Supplementary Figure 2C available at Carcinogenesis Online). Similar results were seen in the H460 stable cell lines, with 100 pM TGF-β1 having no significant affect on H460-Neo versus H460-RIII growth curves (Supplementary Figure 2C available at Carcinogenesis Online). To confirm TGF-β responsiveness in our cell lines, as has been demonstrated previously for the A549 cells (28,29), a dose response of TGF-β1 treatment was performed and Smad2 and Smad3 phosphorylation were examined. The results demonstrate that both cell lines are TGF-β1 responsive, and that although TβRIII expression slightly increased Smad2 phosphorylation in A549 cells, overall their ability to phosphorylate Smad2 or Smad3 was not significantly changed (Supplementary Figure 3A available at Carcinogenesis Online). In addition, a luciferase assay using Smad-responsive reporters (3TP and pE2.1) confirmed that all stable cells were TGF-β1 responsive, with TβRIII expression having modest but opposing effects on these reporters in the A549 cell line (Supplementary Figure 3B available at Carcinogenesis Online). Taken together, these results demonstrate that TβRIII expression had no significant effect on cell growth in vitro and did not significantly alter TGF-β1-dependent Smad phosphorylation or TGF-β1 responsiveness in the A549 or H460 stable cell lines.

TβRIII inhibits lung cancer cell motility
As our expression analysis demonstrated a decrease in TβRIII expression in NSCLC relative to benign lung, and in poorly differentiated/high-grade tumors relative to well-differentiated/low-grade tumors, we investigated whether TβRIII has a role in regulating cell migration and/or invasion. A monolayer wound healing assay was first used to explore the role of TβRIII in regulating cell migration (30). H460 cells form poor monolayers and migrate quite slowly, whereas A549 cells form robust monolayers, leading us to examine A549 lung cancer cells in this assay. Over a 24 h time course, A549 cells stably expressing TβRIII consistently migrated at a slower rate than empty vector control A549-Neo cells (Figure 4A and B). After 24 h, wounds in confluent A549-Neo cells were 90% closed, whereas wounds in confluent A549-RIII cells were 65% closed (P = 0.035, two-tailed t-test) (Figure 4A and B).


Figure 4
View larger version (72K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. TβRIII expression inhibits monolayer wound healing and migration of A549 lung cancer cells. (A) Scratch-wounded A549-Neo and A549-RIII cells were imaged under x10 magnification over a 24 h time course. Scale bar = 150 µm. Images representative of three separate experiments. (B) The percent migration ± SEM was calculated, with the 0 h time point set to 0% migration for each sample type, P = 0.035. (C) A549 cells stably expressing the empty vector pcDNA3.1 or TβRIII were seeded in the upper chamber of fibronectin-coated transwell filters, with or without the addition of 150 pM TGF-β1. After a 24 h incubation, the top of the filters were scraped and cells that migrated through the fibronectin were fixed and stained. Images are representative of four separate experiments. (D) Migrating cells were counted in three fields under x10 magnification and the average from four separate experiments ±SEM is shown, P < 0.01.

 
Although results from the monolayer wound healing assay suggested that expression of TβRIII was sufficient to inhibit cellular migration, to further establish a role for TβRIII in inhibiting cellular migration we examined cell migration in fibronectin-coated transwells seeded with either A549-RIII or control A549-Neo cells, with or without the addition of TGF-β1. Again, A549-RIII cells were impaired in their ability to migrate relative to A549-Neo cells, with 67 ± 0.4% of the A549-RIII cells migrating at 24 h relative to the A549-Neo cells (P < 0.0001, two-tailed t-test) (Figure 4C and D). The addition of 150 pM TGF-β1 had only minimal effects on the migration of the A549 stable cells. Notably, as established by our growth curves, these differences were not due to variances in cell growth at this time point (Supplementary Figure 2C available at Carcinogenesis Online). Collectively, these results confirm a role for TβRIII in reducing lung cancer cellular motility in vitro.

TβRIII inhibits lung cancer cell invasion through Matrigel through generation of sTβRIII
Two necessary components for lung cancer metastasis are increased motility along with increased invasion through the basement membrane. We used the reconstituted extracellular matrix, Matrigel, to mimic the basement membrane and examined the role of TβRIII on lung cancer cell invasion through Matrigel in vitro (31). Stable expression of TβRIII in A549 lung cancer cells significantly inhibited their ability to invade Matrigel by 71 ± 10% (P < 0.001, two-tailed t-test) (Figure 5A). Although the addition of 150 pM TGF-β1 increased invasion of A549-Neo cells by an average of 18% and A549-RIII cells by 30% compared with the same cell lines without TGF-β1 treatment, in both cases, TβRIII was able to decrease invasiveness (P = 0.0172, Kruskal–Wallis test) (Figure 5B).


Figure 5
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. TβRIII expression decreases lung cancer cell invasion through Matrigel and colony formation in soft agar. (A) A549 cells stably expressing the empty vector pcDNA3.1 or TβRIII were seeded in the upper chamber of Matrigel transwells. After a 48 h incubation, invading cells were fixed, stained and counted in three fields under x10 magnification. Images are representative of three separate experiments, P < 0.001. (B) A549 cells stably expressing the empty vector pcDNA3.1 or TβRIII were seeded on Matrigel and analyzed as described in (A), with or without the addition of 150 pM TGF-β1 to the upper chamber. Means from three separate experiments are presented, P = 0.0172. (C) A549-Neo cells were infected with 50MOI shEND (control) or shTβRIII for 48–96 h. Infected cells were then plated onto Matrigel filters and analyzed as described in (A). The average of three independent experiments are presented, P = 0.04. TβRIII knockdown was confirmed using 125I-TGF-β1 binding and cross-linking. (D) sTβRIII expression in A549-RIII cells was confirmed using 125I-TGF-β1 binding and cross-linking. (E) A549-Neo and A549-RIII cells were plated on Matrigel in conditioned serum-free media from COS-7 cells transiently transfected with empty vector (control) or sTβRIII (see inset). Invading cells from four separate experiments were analyzed as described in (A) and results are represented graphically ±SEM, P = 0.01. (F) H460-Neo and H460-RIII were plated in triplicate and incubated for 8 days. Colony formation was then examined by 0.02% crystal violet staining. The mean ±SEM of three independent experiments, normalized to H460-Neo colony formation, is shown graphically, P < 0.0001.

 
Although the ability of exogenous TβRIII to decrease both basal and TGF-β-stimulated invasion suggested a role for TβRIII in regulating invasion, to provide direct evidence for a role of TβRIII, we utilized shRNA-mediated silencing of endogenous TβRIII expression. In A549 cells, shRNA to TβRIII specifically knocked down TβRIII expression by 72%, as determined by densitometry of TβRIII cross-linked to iodinated TGF-β1, normalized to β-actin, relative to A549 cells infected with control shRNA to the related TGF-β co-receptor endoglin (shEND, Figure 5C). This knockdown in endogenous TβRIII expression resulted in enhanced Matrigel invasion with a 2.2 ± 0.5 fold increase in invasion compared with shEND (control) infection (P = 0.04, one-tailed t-test, Figure 5C). These results support a direct role for TβRIII in regulating cellular invasion.

TβRIII undergoes proteolytic cleavage in the extracellular domain generating soluble TβRIII (sTβRIII), which has been demonstrated to suppress tumor growth (32). Accordingly, to assess whether the effects of TβRIII were mediated by the production of sTβRIII, we first examined whether the A549-RIII cell line produced sTβRIII. Conditioned media from the A549-RIII and A549-Neo cell lines were cross-linked with iodinated TGF-β1 and sTβRIII was specifically immunoprecipitated with an antibody to the extracellular domain. These studies determined that both the A549-RIII and A549-Neo cell lines produced sTβRIII, with the A549-RIII cell line producing more than the A549-Neo cell line, as expected (Figure 5D). We then examined the effect of sTβRIII on A549 lung cancer cell invasion in vitro. Conditioned media collected from COS-7 cells transiently transfected with soluble TβRIII inhibited the ability of A549-Neo cells to invade Matrigel by 16 ± 6% (P = 0.03, two-tailed t-test). Although A549-RIII cells were inhibited by 24 ± 8% in their invasion compared with A549-Neo cells (P = 0.02, two-tailed t-test), the addition of sTβRIII to A549-RIII cells further inhibited their ability to invade Matrigel with 43 ± 6.1% inhibition (P < 0.001, two-tailed t-test) (Figure 5E). These results demonstrate that TβRIII inhibits cell invasion, at least in part, through generation of sTβRIII. Taken together, these results suggest that one consequence of loss of TβRIII expression in NSCLC is increased cellular motility and invasiveness due to decreased sTβRIII production.

TβRIII inhibits anchorage-independent growth in soft agar
The ability of TβRIII to decrease lung cancer cell motility and invasiveness in vitro suggested that TβRIII may have effects on lung cancer tumorigenicity. We examined anchorage-independent growth using colony formation in soft agar. Since A549 cells only form small and difficult to quantitate colonies using this assay, we concentrated on the H460 cell model. Stable cell lines expressing the empty vector pcDNA3.1 or TβRIII were seeded in 0.4% agar on a 0.71% base agar and incubated for 7–14 days after which colony formation was assessed. TβRIII significantly decreased colony formation with H460-RIII cells forming an average of 50.4 ± 2.3% less colonies than H460-Neo cells (Figure 5F, P < 0.0001, two-tailed t-test). These studies suggest that loss of TβRIII expression during lung progression not only increases lung cancer cell motility and invasiveness but also facilitates anchorage-independent growth, a hallmark of tumorigenesis.

TβRIII inhibits tumorigenicity in vivo
To examine whether the effects of TβRIII on migration, invasion and tumorigenicity in vitro translated to effects on tumorigenicity in vivo, we injected A549 cells stably expressing TβRIII or an empty vector control into both flanks of female Balb/c Nu/Nu mice and measured tumor volume every 3 days. There was a noticeable difference in tumor incidence, with 100% (12/12) of the injection sites developing tumors in the A549-Neo group, whereas in the A549-RIII group, only 71% (10/14) of the injection sites formed tumors (Figure 6A). In addition, tumor volume was calculated over the time course with A549-Neo mice consistently demonstrating a higher average tumor volume than A549-RIII mice (Figure 6B, P = 0.001, analysis of variance). Primary tumors and potential distant metastasis were extracted, Hematoxylin & Eosin (H&E) stained and analyzed by a board certified pathologist. Whereas all of the A549-Neo tumor sections containing skeletal muscle demonstrated invasion into muscle, only 70% of the A549-RIII tumors exhibited unambiguous skeletal muscle invasion. A549 cells have been reported to have a very low pulmonary metastasis rate (~0.4%), with this being the most common site of metastasis (33). After examination of possible lung metastatic lesions by H&E staining, a lung metastasis in one of the A549-Neo mice was confirmed, whereas none of the A549-RIII mice exhibited lung metastasis. These studies support TβRIII as a novel tumor suppressor in NSCLC.


Figure 6
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. TβRIII expression decreases NSCLC tumorigenicity in vivo. (A) A549-Neo or A549-RIII cells were injected subcutaneously into both flanks of athymic Balb/cAnNCr-nu/nu mice. The percentage of mice forming tumors in each group over the 68 day time course is represented. (B) Mean tumor volume was measured every 3 days over the time course and the growth curves for each group were plotted, P = 0.001. Bars, SEM.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Lung cancer is the leading cause of cancer death in both males and females in the USA, with more people dying from lung cancer than from breast, colon and prostate cancer combined (34). In 2006, there will be 174 470 new cases and 162 460 deaths in the US, with more than 1 000 000 people dying from lung cancer worldwide. The 5-year survival rate for lung cancer is 15%, as compared with 88% for breast cancer and 99% for prostate cancer, underscore the importance of defining mechanisms facilitating lung cancer progression.

Here we have characterized a TGF-β superfamily co-receptor, TβRIII, as a novel tumor suppressor gene in NSCLC. Data to support TβRIII as a tumor suppressor include frequent loss of TβRIII expression at the message and protein levels, with LOH of the TGFBR3 locus correlating with loss of expression, and decreased TβRIII expression correlating with disease progression and a higher grade/less differentiated tumor. Importantly, restoring TβRIII expression decreased migration, invasion and anchorage-independent growth in vitro and tumorigenicity in vivo, while further decreasing TβRIII expression enhanced invasiveness, suggesting important functional roles for loss of TβRIII expression during lung cancer progression.

Loss of expression of tumor suppressor genes is usually multifactorial, with mechanisms including chromosomal alterations/deletions resulting in LOH, mutation, transcriptional and epigenetic regulation (26,35). Although LOH occurred in 38.5% of specimens and correlated with decreased expression in those specimens, consistent with prior reports demonstrating LOH in 60% (38/63) of lung tumor samples at chromosome 1p where the TGFBR3 gene is located, clearly other mechanisms must be involved since all tumor-matched normal pairs demonstrated TβRIII loss at the protein level. In addition, the samples that demonstrated LOH were all squamous cell carcinomas, suggesting that LOH may be a preferential mechanism for TβRIII loss in this subtype of NSCLC. Examination of the TGFBR3 gene promoter reveals several CpG islands and TβRIII expression appears to be epigenetically regulated in prostate (20) and ovarian cancer (36). Whether transcriptional or epigenetic regulation are involved in decreasing TβRIII expression in NSCLC is currently being explored.

Although TβRIII has a clear role in decreasing lung cancer cell migration, invasion and anchorage-independent growth, and these effects appear to be mediated, in part, through generation of sTβRIII, how TβRIII and sTβRIII mediate these effects remains unclear. TβRIII could be functioning as a co-receptor, resulting in increased TGF-β binding and canonical Smad-dependent TGF-β signaling (37). On the other hand, TβRIII could be functioning through its interacting partners, β-arrestin2 and GIPC, both of which are expressed in the lung (38), to signal to Smad-independent pathways (14,39,40). Alternatively, generation of sTβRIII could abrogate some of the functions of cell-surface TβRIII, or directly function to sequester TGF-β and downregulate TGF-β signaling (41). Indeed, previous studies in both breast and prostate cancer xenograft models reported a role for both full-length TβRIII and soluble TβRIII in decreasing tumor growth, metastasis and angiogenesis (27,42,43). In addition, although TβRIII had no effect on proliferation in vitro, enhanced growth in soft agar and in vivo could reflect effects on increased lung cancer cell survival. Whether TβRIII functions to regulate lung cancer cell migration, invasion, anchorage-independent growth or survival by signaling through Smad-dependent or Smad-independent pathways remains an active area of investigation.

Most studies examining lung cancer are performed in NSCLC models, as this type accounts for >80% of all lung cancers (34). However, there are fundamental differences between NSCLC and small cell lung cancers, including their clinical behavior and natural history, their response to therapy and their potential cells of origin. There are also differences in terms of TGF-β signaling, with loss of TβRII expression more common in small cell lung cancer (19), as well as a report that small cell lung cancer cell lines do not synthesize TGF-β1 or TGF-β2 (44). Whether TβRIII expression is lost in human small cell lung cancer patients remains to be established.

The main reasons for the high mortality rate in lung cancer patients are that lung cancer is usually diagnosed in the advanced stages and the lack of effective treatments for lung cancer. As loss of TβRIII expression correlates with lung cancer progression, investigation of the role of TβRIII could lead to advances in both the diagnosis and treatment of lung cancer. As LOH of the TGFBR3 gene locus does not fully account for decreased TβRIII expression in lung cancer, and TβRIII could be subject to epigenetic regulation, TβRIII expression could be restored with HDAC inhibitors or 5-azacytidine analogs currently in clinical use or being evaluated in clinical trials. In addition, as TβRIII expression correlates with disease expression and differentiation status, TβRIII expression levels could have prognostic value in NSCLC. Whether analysis of TβRIII expression in lung cancer biopsies could provide useful information to treating physicians warrants further investigation.


    Supplementary material
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Supplementary Figures 1A–C, 2A–C and 3A and 3B and colour version of Figure 3 can be found at http://carcin.oxfordjournals.org/.


    Funding
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
National Institute of Health/National Cancer Institute (R01-CA106307 [GenBank] ) to G.C.B.; Research Training Fellowship from the Howard Hughes Medical Institute to R.S.T.


    Footnotes
 
{dagger} These authors contributed equally to this work. Back


    Acknowledgments
 
We thank Dr Michael Kelley (Duke University) for generously providing the A549 and H460 cell lines. We thank Kelly J. Gordon for her technical advice with the Matrigel and fibronectin assays.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 

  1. Shi Y, et al. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell (2003) 113:685–700.[CrossRef][Web of Science][Medline]
  2. Wang XF, et al. Expression cloning and characterization of the TGF-beta type III receptor. Cell (1991) 67:797–805.[CrossRef][Web of Science][Medline]
  3. Elliott RL, et al. Role of transforming growth factor beta in human cancer. J. Clin. Oncol. (2005) 23:2078–2093.[Abstract/Free Full Text]
  4. Bierie B, et al. TGF-beta and cancer. Cytokine Growth Factor Rev. (2006) 17:29–40.[CrossRef][Web of Science][Medline]
  5. Roberts AB, et al. The two faces of transforming growth factor beta in carcinogenesis. Proc. Natl Acad. Sci. USA (2003) 100:8621–8623.[Free Full Text]
  6. Derynck R, et al. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature (2003) 425:577–584.[CrossRef][Medline]
  7. Lopez-Casillas F, et al. Structure and expression of the membrane proteoglycan betaglycan, a component of the TGF-beta receptor system. Cell (1991) 67:785–795.[CrossRef][Web of Science][Medline]
  8. Eickelberg O, et al. Betaglycan inhibits TGF-beta signaling by preventing type I-type II receptor complex formation. Glycosaminoglycan modifications alter betaglycan function. J. Biol. Chem. (2002) 277:823–829.[Abstract/Free Full Text]
  9. Lopez-Casillas F, et al. Betaglycan presents ligand to the TGF beta signaling receptor. Cell (1993) 73:1435–1444.[CrossRef][Web of Science][Medline]
  10. Stenvers KL, et al. Heart and liver defects and reduced transforming growth factor beta2 sensitivity in transforming growth factor beta type III receptor-deficient embryos. Mol. Cell Biol. (2003) 23:4371–4385.[Abstract/Free Full Text]
  11. Blobe GC, et al. Functional roles for the cytoplasmic domain of the type III transforming growth factor beta receptor in regulating transforming growth factor beta signaling. J. Biol. Chem. (2001) 276:24627–24637.[Abstract/Free Full Text]
  12. Brown CB, et al. Requirement of type III TGF-beta receptor for endocardial cell transformation in the heart. Science (1999) 283:2080–2082.[Abstract/Free Full Text]
  13. Deng X, et al. Differential responsiveness to autocrine and exogenous transforming growth factor (TGF) beta1 in cells with nonfunctional TGF-beta receptor type III. Cell Growth Differ. (1999) 10:11–18.[Abstract/Free Full Text]
  14. Blobe GC, et al. A novel mechanism for regulating transforming growth factor beta (TGF-beta) signaling. Functional modulation of type III TGF-beta receptor expression through interaction with the PDZ domain protein, GIPC. J. Biol. Chem. (2001) 276:39608–39617.[Abstract/Free Full Text]
  15. Park C, et al. Effects of transforming growth factor beta (TGF-beta) receptor on lung carcinogenesis. Lung Cancer (2002) 38:143–147.[CrossRef][Web of Science][Medline]
  16. Anumanthan G, et al. Restoration of TGF-beta signalling reduces tumorigenicity in human lung cancer cells. Br. J. Cancer (2005) 93:1157–1167.[CrossRef][Web of Science][Medline]
  17. Nagatake M, et al. Somatic in vivo alterations of the DPC4 gene at 18q21 in human lung cancers. Cancer Res. (1996) 56:2718–2720.[Abstract/Free Full Text]
  18. Uchida K, et al. Somatic in vivo alterations of the JV18-1 gene at 18q21 in human lung cancers. Cancer Res. (1996) 56:5583–5585.[Abstract/Free Full Text]
  19. de Jonge RR, et al. Frequent inactivation of the transforming growth factor beta type II receptor in small-cell lung carcinoma cells. Oncol. Res. (1997) 9:89–98.[Web of Science][Medline]
  20. Turley RS, et al. The type III transforming growth factor-beta receptor as a novel tumor suppressor gene in prostate cancer. Cancer Res (2007) 67:1090–1098.[Abstract/Free Full Text]
  21. Beer DG, et al. Gene-expression profiles predict survival of patients with lung adenocarcinoma. Nat. Med. (2002) 8:816–824.[Web of Science][Medline]
  22. Bhattacharjee A, et al. Classification of human lung carcinomas by mRNA expression profiling reveals distinct adenocarcinoma subclasses. Proc. Natl Acad. Sci. USA (2001) 98:13790–13795.[Abstract/Free Full Text]
  23. Powell CA, et al. Gene expression in lung adenocarcinomas of smokers and nonsmokers. Am. J. Respir. Cell Mol. Biol. (2003) 29:157–162.[Abstract/Free Full Text]
  24. Garber ME, et al. Diversity of gene expression in adenocarcinoma of the lung. Proc. Natl Acad. Sci. USA (2001) 98:13784–13789.[Abstract/Free Full Text]
  25. Raponi M, et al. Gene expression signatures for predicting prognosis of squamous cell and adenocarcinomas of the lung. Cancer Res. (2006) 66:7466–7472.[Abstract/Free Full Text]
  26. Ragnarsson G, et al. Loss of heterozygosity at chromosome 1p in different solid human tumours: association with survival. Br. J. Cancer (1999) 79:1468–1474.[CrossRef][Web of Science][Medline]
  27. Dong M, et al. The type III TGF-beta receptor suppresses breast cancer progression. J. Clin. Invest. (2007) 117:206–217.[CrossRef][Web of Science][Medline]
  28. Robinson SP, et al. Transforming growth factor beta 1: lack of in vivo antitumor activity on A549 and Wehi 3BD+ tumors. Anticancer Res. (1992) 12:73–79.[Web of Science][Medline]
  29. Kim WS, et al. Reduced transforming growth factor-beta type II receptor (TGF-beta RII) expression in adenocarcinoma of the lung. Anticancer Res. (1999) 19:301–306.[Web of Science][Medline]
  30. Valster A, et al. Cell migration and invasion assays. Methods (2005) 37:208–215.[CrossRef][Web of Science][Medline]
  31. Repesh LA. A new in vitro assay for quantitating tumor cell invasion. Invasion Metastasis (1989) 9:192–208.[Web of Science][Medline]
  32. Bandyopadhyay A, et al. Extracellular domain of TGFbeta type III receptor inhibits angiogenesis and tumor growth in human cancer cells. Oncogene (2002) 21:3541–3551.[CrossRef][Web of Science][Medline]
  33. Chen MF, et al. Inhibition of lung tumor growth and augmentation of radiosensitivity by decreasing peroxiredoxin I expression. Int. J. Radiat. Oncol. Biol. Phys. (2006) 64:581–591.[CrossRef][Web of Science][Medline]
  34. Jemal A, et al. Cancer statistics, 2006. CA Cancer J. Clin. (2006) 56:106–130.[Abstract/Free Full Text]
  35. Herman JG, et al. Gene silencing in cancer in association with promoter hypermethylation. N. Engl. J. Med. (2003) 349:2042–2054.[Free Full Text]
  36. Hempel N, et al. Loss of betaglycan expression in ovarian cancer: role in motility and invasion. Cancer Res. (2007) 67:5231–5238.[Abstract/Free Full Text]
  37. Kirkbride KC, et al. Cell-surface co-receptors: emerging roles in signaling and human disease. Trends Biochem. Sci. (2005) 30:611–621.[CrossRef][Web of Science][Medline]
  38. Kirikoshi H, et al. Expression of human GIPC1 in normal tissues, cancer cell lines, and primary tumors. Int. J. Mol. Med. (2002) 9:509–513.[Web of Science][Medline]
  39. Chen W, et al. Beta-arrestin 2 mediates endocytosis of type III TGF-beta receptor and down-regulation of its signaling. Science (2003) 301:1394–1397.[Abstract/Free Full Text]
  40. Lefkowitz RJ, et al. Transduction of receptor signals by beta-arrestins. Science (2005) 308:512–517.[Abstract/Free Full Text]
  41. Lopez-Casillas F, et al. Betaglycan can act as a dual modulator of TGF-beta access to signaling receptors: mapping of ligand binding and GAG attachment sites. J. Cell Biol. (1994) 124:557–568.[Abstract/Free Full Text]
  42. Bandyopadhyay A, et al. A soluble transforming growth factor beta type III receptor suppresses tumorigenicity and metastasis of human breast cancer MDA-MB-231 cells. Cancer Res. (1999) 59:5041–5046.[Abstract/Free Full Text]
  43. Bandyopadhyay A, et al. Systemic administration of a soluble betaglycan suppresses tumor growth, angiogenesis, and matrix metalloproteinase-9 expression in a human xenograft model of prostate cancer. Prostate (2005) 63:81–90.[CrossRef][Web of Science][Medline]
  44. Lopez-Gonzalez JS, et al. Lack of correlation between growth inhibition by TGF-beta and the percentage of cells expressing type II TGF-beta receptor in human non-small cell lung carcinoma cell lines. Lung Cancer (2002) 38:149–158.[CrossRef][Web of Science][Medline]
Received August 21, 2007; revised October 29, 2007; accepted December 7, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
J. D. Lee, N. Hempel, N. Y. Lee, and G. C. Blobe
The type III TGF-{beta} receptor suppresses breast cancer progression through GIPC-mediated inhibition of TGF-{beta} signaling
Carcinogenesis, February 1, 2010; 31(2): 175 - 183.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
V. L Dias, E. Rajpert-De Meyts, R. McLachlan, and K. L. Loveland
Analysis of activin/TGFB-signaling modulators within the normal and dysfunctional adult human testis reveals evidence of altered signaling capacity in a subset of seminomas
Reproduction, November 1, 2009; 138(5): 801 - 811.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
N. Y. Lee, K. C. Kirkbride, R. D. Sheu, and G. C. Blobe
The Transforming Growth Factor-{beta} Type III Receptor Mediates Distinct Subcellular Trafficking and Downstream Signaling of Activin-like Kinase (ALK)3 and ALK6 Receptors
Mol. Biol. Cell, October 15, 2009; 20(20): 4362 - 4370.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
H. J. You, T. How, and G. C. Blobe
The type III transforming growth factor-{beta} receptor negatively regulates nuclear factor kappa B signaling through its interaction with {beta}-arrestin2
Carcinogenesis, August 1, 2009; 30(8): 1281 - 1287.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Mythreye and G. C. Blobe
The type III TGF-{beta} receptor regulates epithelial and cancer cell migration through {beta}-arrestin2-mediated activation of Cdc42
PNAS, May 19, 2009; 106(20): 8221 - 8226.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
T. Santiago-Sim, S. Mathew-Joseph, H. Pannu, D. M. Milewicz, C. E. Seidman, J.G. Seidman, and D. H. Kim
Sequencing of TGF-{beta} Pathway Genes in Familial Cases of Intracranial Aneurysm
Stroke, May 1, 2009; 40(5): 1604 - 1611.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
K. J. Gordon, K. C. Kirkbride, T. How, and G. C. Blobe
Bone morphogenetic proteins induce pancreatic cancer cell invasiveness through a Smad1-dependent mechanism that involves matrix metalloproteinase-2
Carcinogenesis, February 1, 2009; 30(2): 238 - 248.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. C. Finger, N. Y. Lee, H.-j. You, and G. C. Blobe
Endocytosis of the Type III Transforming Growth Factor-{beta} (TGF-{beta}) Receptor through the Clathrin-independent/Lipid Raft Pathway Regulates TGF-{beta} Signaling and Receptor Down-regulation
J. Biol. Chem., December 12, 2008; 283(50): 34808 - 34818.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
N. Hempel, T. How, S. J. Cooper, T. R. Green, M. Dong, J. A. Copland, C. G. Wood, and G. C. Blobe
Expression of the type III TGF-{beta} receptor is negatively regulated by TGF-{beta}
Carcinogenesis, May 1, 2008; 29(5): 905 - 912.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
29/3/528    most recent
bgm289v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Finger, E. C.
Right arrow Articles by Blobe, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Finger, E. C.
Right arrow Articles by Blobe, G. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?