Carcinogenesis Advance Access originally published online on April 15, 2008
Carcinogenesis 2008 29(6):1197-1201; doi:10.1093/carcin/bgn099
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
A tandem repeat of human telomerase reverse transcriptase (hTERT) and risk of breast cancer development and metastasis in Chinese women
1 Laboratory of Reproductive Medicine
2 Department of Epidemiology and Biostatistics
3 Cancer Research Center, Nanjing Medical University, Nanjing 210029, China
4 Department of General Surgery, Jiangsu Cancer Hospital, Nanjing, 210009, China
5 Department of General Surgery, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029, China
6 Department of General Surgery, Nanjing Gulou Hospital, Nanjing 210008, China
* To whom correspondence should be addressed. Tel/Fax: +86 25 868 62756; Email: hbshen{at}njmu.edu.cn
| Abstract |
|---|
|
|
|---|
Telomerase reactivation, which prevents telomere shortening and maintains cell viability, is crucial for the continued growth or progression of cancer cells. A minisatellite tandem repeat, MNS16A, located in the downstream of the human telomerase reverse transcriptase (hTERT) gene was recently identified and reported to have an effect on hTERT expression and telomerase activity. The aim of this study was to test the hypothesis that the MNS16A variant is associated with risk of breast cancer development and metastasis. We genotyped MNS16A variant in hTERT in a case–control study of 1029 histologically confirmed breast cancer patients and 1107 cancer-free controls in Chinese women. The variant genotypes (302/271, 302/243 and 243/243) of MNS16A were associated with a significantly increased risk of breast cancer [adjusted odds ratio (OR) = 1.50, 95% confidence interval (CI) = 1.15–1.96], compared with the wild-type 302/302 genotype. In stratified analyses, we found that the 302/271 genotype was associated with a significantly increased risk of axillary lymph nodes metastasis (adjusted OR = 2.13, 95% CI = 1.05–4.33) compared with wild-type 302/302 genotype. These findings indicate that the MNS16A variant in the hTERT gene may contribute to the risk of breast cancer development and metastasis in Chinese women.
Abbreviations: ALNM, axillary lymph node metastasis; CI, confidence interval; ER, estrogen receptor; hTERT, human telomerase reverse transcriptase; OR, odds ratio; PCR, polymerase chain reaction; PR, progesterone receptor
| Introduction |
|---|
|
|
|---|
Genomic instability plays an important role in carcinogenesis and is necessary for the transformation of normal tissue to cancer (1–3). Telomere-driven genome instability is a widespread cause of genome instability in cancer and thought to be the crucial event in the development of breast carcinomas (4,5). Telomeres, a specific protein–DNA structure existing at the end of chromosome, have a number of functions including protecting the ends of the chromosome and preventing chromosome segregation, fusion and instability caused by telomerase (4,6).
Telomerase is a reverse transcriptase enzyme that can elongate the TTAGGG repeats of telomeres in cells, where it is expressed to sustain cellular immortality (6). The components of telomerase include a RNA subunit (human telomerase RNA), a reverse transcriptase catalytic subunit [human telomerase reverse transcriptase (hTERT)] and other associated proteins (7). Among these subunits, hTERT is the limiting factor of the telomerase activity (8,9). hTERT messenger RNA is absent in most normal human somatic cells, including breast tissue, but it is detected in many human cancer cells, including that of the lung, breast, stomach and cervix (10–15). Furthermore, the hTERT protein expression is increased in preinvasive lesions of the breast, such as ductal carcinoma in situ, suggesting that telomerase activity is activated as an early event in breast carcinogenesis (16). Hoos et al. (17) found a significant correlation between telomerase activity and lymph node status in breast cancers, suggesting that the hTERT gene may serve as an indicator of both breast carcinogenesis and metastasis.
hTERT is located at chromosome 5p15.33 and has 16 exons (7). Recently, Wang et al. (18,19) found a polymorphic tandem repeat minisatellite (termed MNS16A) in the downstream of hTERT, and MNS16A was demonstrated to have some promoter activity and may regulate the expression of antisense hTERT messenger RNA level as well as telomerase activity (18,19). Considering the potentially functional significance of the MNS16A variant in hTERT and the crucial role of telomerase in breast carcinogenesis, we hypothesized that the MNS16A variant is associated with the risk of breast cancer development and metastasis. To test this hypothesis, we genotyped the MNS16A variant in 1029 breast cancer patients and 1107 cancer-free controls frequency matched to the cases on age and residential area in Chinese women.
| Materials and methods |
|---|
|
|
|---|
Study population
This case–control study included 1029 breast cancer cases and 1107 cancer-free controls, and the subject recruitment has been described elsewhere (20). Briefly, all subjects were genetically unrelated ethnic Han Chinese from Nanjing City and surrounding geographical regions in Jiangsu Province, China. Cases were patients with histopathologically confirmed incident breast cancer recruited between January 2004 and April 2007 at the Cancer Hospital of Jiangsu Province (Nanjing), the First Affiliated Hospital of Nanjing Medical University, and the Nanjing Gulou Hospital, Nanjing, China, with a response rate of 91.1% (1029/1129). Cancer-free controls were randomly selected from a pool of >30 000 individuals participated in a community-based screening program for non-infectious diseases conducted in Jiangsu Province during the same time period as the cases were recruited. These controls had no history of cancer and were frequency matched to the cases on age (±5 years) and residential (urban or rural) area.
After an informed consent was obtained, each subject was interviewed in person by trained interviewers using a structured questionnaire to obtain information on demographic data, menstrual and reproductive histories, life styles, environmental exposure history and family history of cancer in first-degree relatives (parents, siblings or children). After the interview, a 5 ml venous blood sample was collected from each subject. The estrogen receptor (ER) status, progesterone receptor (PR) status and axillary lymph node metastasis (ALNM) status were obtained from the medical records of the hospitals. A standardized immunohistochemical assay was commonly used in all hospitals and the cutoff level used to define positive ER/PR status was
10% positive staining. The study was approved by the Institutional Review Board of Nanjing Medical University.
Genotyping and allele confirmation
Genomic DNA was isolated from leucocytes of venous blood by proteinase K digestion and phenol–chloroform extraction. The genotyping assay of the MNS16A tandem repeat polymorphism was described previously with the polymerase chain reaction (PCR) primer pairs of 5'-AGGATTCTGATCTCTGAAGGGTG-3' (sense) and 5'-TCTGCCTGAGGAAGGACGTATG-3' (antisense) (19). The PCR products were resolved on a 3.5% agarose gel at 90 V for an hour and stained with ethidium bromide. As shown in Figure 1A, we obtained only four genotype patterns (from lanes 1 to 4) in our study population of Chinese instead of seven reported for non-Hispanic whites (19). We then cut each band from the gel separately and sequenced the eight (from the four lanes) bands using an automated sequencer (ABI model 377 genetic analysis; Applied Biosystems, Foster City, CA). We observed three alleles, 302, 271 and 243, of which 302 is a wild-type allele, 271 has lost a 31 bp 'GATGAGACTGGGAGATGATAAGAGGATGAGA' compared with 302 and 243 has lost a 28 bp 'AAGAGGAAGACAGATGAGACTGGGAGAT' compared with 271, whereas there are alleles reported for non-Hispanic whites (333, 302, 272 and 243) (19). The two bands above the 302 bp band showed in lanes 2 and 3 in Figure 1A were resulted from conformation change of the heterozygote with different length of alleles. When we cut the two bands and reloaded them to the gel, each can be separated to three bands as the whole PCR products did, as confirmed by identical sequencing patterns as the whole PCR products. Furthermore, we performed the PCR-Single Strand Conformation Polymorphism assay to verify the genotyping results derived from the agarose gel. As shown in Figure 1B, lanes 2 and 3 showed two bands in 8% polyacrylamide (29:1 acrylamide:bisacrylamide) gel in denatured single strand form, but the extra band disappeared.
|
Genotyping was performed without knowing the case–control status and approximately equal numbers of cases and controls were assayed in each 96-well PCR plate, with positive controls of known heterozygous genotypes. Twenty-three cases and 12 controls failed in the genotyping assay due to DNA quality and/or quantity. Therefore, 1006 cancer cases and 1095 controls were included in the final analysis for the MNS16A variant.
Statistical analyses
Differences in the distributions of demographic characteristics, selected variables and the variant alleles and genotypes of MNS16A between the cases and controls were evaluated using the Student's t-test (for continuous variables) and
2 test (for categorical variables). The associations between hTERT MNS16A genotypes and risk of breast cancer were estimated by computing odds ratios (ORs) and their 95% confidence intervals (CIs) from logistic regression analyses with and without adjustment for age, menopausal status, family history of cancer and age at menarche. All of the statistical analyses were performed with Statistical Analysis System software (v.9.1.3; SAS Institute, Cary, NC). All tests were two sided and the criterion for significance was set at P < 0.05.
| Results |
|---|
|
|
|---|
The characteristics of the cases and controls enrolled in this study are shown in Table I. There was no significant difference in the mean age between the cases and controls (P = 0.896). Compared with the control subjects, the breast cancer cases had a significantly younger age at menarche (P < 0.0001) and an older age at first live birth (P < 0.0001). Moreover, the distribution of family history of cancer for cases was significantly different from controls (P < 0.001). Among the 756 subjects with known ER/PR status, 337 subjects (44.6%) were positive for both ER and PR status and 277 subjects (36.6%) were negative for both ER and PR status. In addition, among the 854 subjects with known ALNM status, 320 subjects (37.5%) were positive for ALNM status and 534 subjects (62.5%) were negative for ALNM status.
|
The genotype distributions of hTERT MNS16A variant in breast cancer cases and controls are shown in Table II. The MNS16A 302/271 genotype and 302/243 genotype were more frequent in cases (14.0%) than in controls (9.8%), suggesting that the variant alleles may be risk alleles for breast cancer. When the MNS16A 302/302 genotype was used as the reference group, the variant genotypes of MNS16A were associated with a significantly increased risk of breast cancer (adjusted OR = 1.77, 95% CI = 1.06–2.96 for 302/271 genotype; adjusted OR = 1.41, 95% CI = 1.03–1.92 for 302/243 genotype and adjusted OR = 1.50, 95% CI = 1.15–1.96 for combined 302/271, 302/243 and 243/243 genotypes) after adjustment for age, menopausal status, family history of cancer and age at menarche. In addition, a significant risk effect was observed for the short (271 and 243) alleles compared with the long (302) alleles.
|
To evaluate the effects of the MNS16A variant on breast cancer risk by selected variables, we performed stratified analyses. As shown in Table III, the increased risk of breast cancer associated with the MNS16A-variant genotypes was more evident among the older women (age
50) (adjusted OR = 1.75, 95% CI = 1.20–2.54), postmenopausal women (adjusted OR = 1.68, 95% CI = 1.17–2.40) and individuals with family history of cancer (adjusted OR = 4.33, 95% CI = 2.31–8.11), with earlier menarche age (<16) (adjusted OR = 1.68, 95% CI = 1.13–2.51) and with older age at first live birth (
25) (adjusted OR = 1.61, 95% CI = 1.05–2.46). However, only the family history of cancer in cases and controls was statistically heterogeneous (P = 0.001) (Table III). Furthermore, the 302/271 genotype was significantly more abundant in subjects with ALNM (5.6% in metastasis group versus 2.8% in no metastasis group, P = 0.038), suggesting that the 302/271 genotype may be a potential marker for breast cancer metastasis. In logistic regression analyses, the 302/271 genotype was associated with a significantly increased ALNM risk (adjusted OR = 2.13, 95% CI = 1.05–4.33) compared with the wild-type 302/302 genotype (Table IV).
|
|
| Discussion |
|---|
|
|
|---|
In this case–control study, we investigated the association between the hTERT MNS16A variant and risk of breast cancer development and metastasis in Chinese women. We found, for the first time, a significantly increased risk of breast cancer associated with the MNS16A-variant genotypes (302/271, 302/243 and 243/243). In addition, in breast cancer cases, the 302/271 genotype was associated with an increased risk for ALNM. These results supported that hTERT MNS16A variant may be associated with breast cancer development and metastasis.
High levels of endogenous sex hormones, especially estrogens, may increase breast cancer risk (21). Menstrual and reproductive factors, such as early age at menarche, later age at first birth, were recognized as breast cancer risk factors (22,23). Menarche can induce proliferation of breast cells and mutations in some genes (24), whereas pregnancy can induce differentiation of breast tissue with cell cycle lengthening, thus facilitating DNA repair and decreasing the susceptibility to breast cancer (25–26). In the current study, we also found that the increased risk of breast cancer associated with the MNS16A-variant genotypes were more evident among individuals with family history of cancer, with earlier menarche age (<16) and with older age at first live birth (
25). However, none but the family history of cancer in the cases and controls was statistically heterogeneous (P = 0.001). Because only 34 cases (3.38%) and 3 controls (0.27%) reported a specific family history of breast cancer and the frequency of the MNS16A-variant genotypes was low, we could not separate family history of breast cancer from that of other types of cancers to perform the stratified analyses. Further studies with family-based design were called for to explore the joined effect of the MNS16A variant and family history of breast cancer on breast carcinogenesis.
It has been reported that hTERT expression was absent in normal somatic cell, whereas its expression was increased in many cancers, including breast cancer (11) and preinvasive lesions of the breast, such as ductal carcinoma in situ (16). To identify genetic variation in hTERT that may influence hTERT expression, Wang et al. (18) found a novel polymorphic tandem repeat minisatellite, termed MNS16A, in the downstream of the hTERT gene locus. They identified four alleles of MNS16A and classified them as long (L) alleles (333 and 302) and short (S) alleles (272 and 243) (18). Meanwhile, they showed that short alleles of MNS16A were associated with elevated hTERT messenger RNA (antisense) expression and telomerase activity when compared with the long alleles (18,19). In a study of 352 glioma patients (205 glioblastoma and 147 anaplastic gliomas) and 305 controls in a non-Hispanic white population, the short alleles were significantly more frequent in glioma patients compared with the controls and the ORs were 1.33 (95% CI = 0.96–1.84) for the SL genotype and 2.05 (95% CI = 1.22–3.44) for the SS genotype, compared with the LL genotype (27). Similarly, in this case–control study, we found that short alleles (271 and 243) were more common in breast cancer patients and the variant genotypes of MNS16A were associated with an increased risk of breast cancer, although we found only three alleles in Chinese people and the allele frequency was quite different between Chinese and non-Hispanic white populations (19,27).
Accumulative studies showed that mutations in somatic cells may lead to different phenotypes of breast cancer (28). However, genetic polymorphism may also influence the clinical behavior of breast cancer, including the ER/PR status and lymph node metastasis (29). Hoos et al. (17) found a significant correlation between telomerase activity and lymph node status in breast cancer. Therefore, we evaluated the relationship between MNS16A variant and ALNM status in breast cancer. Our results showed that the MNS16A 302/271 genotype was more frequent in patients with ALNM and may serve as a biomarker of breast cancer metastasis. However, the biological mechanism in relation to MNS16A-variant, sense and antisense hTERT expression and breast cancer development and metastasis remains to be explored.
In conclusion, our study suggests that the hTERT MNS16A variant may be associated with risk of breast cancer development and metastasis in Chinese populations. Large population-based prospective studies with ethnically diverse populations are warranted to verify these findings.
| Funding |
|---|
|
|
|---|
Innovative Key Grant of Department of Education (#705023); Program for Changjiang Scholars and Innovative Research Team in University (IRT0631); National Key Basic Research Program (2002CB512908).
| Acknowledgments |
|---|
Conflict of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Hanahan D, et al. The hallmarks of cancer. Cell (2000) 100:57–70.[CrossRef][Web of Science][Medline]
- Loeb KR, et al. Significance of multiple mutations in cancer. Carcinogenesis (2000) 21:379–385.
[Abstract/Free Full Text] - Loeb LA, et al. Multiple mutations and cancer. Proc. Natl Acad. Sci. USA (2003) 100:776–781.
[Abstract/Free Full Text] - Murnane JP. Telomeres and chromosome instability. DNA Repair (2006) 5:1082–1092.[CrossRef][Medline]
- Chin K, et al. In situ analyses of genome instability in breast cancer. Nat. Genet. (2004) 36:984–988.[CrossRef][Web of Science][Medline]
- Ju Z, et al. Telomeres and telomerase in cancer stem cells. Eur. J. Cancer (2006) 42:1197–1203.[CrossRef][Web of Science][Medline]
- Wick M, et al. Genomic organization and promoter characterization of the gene encoding the human telomerase reverse transcriptase (hTERT). Gene (1999) 232:97–106.[CrossRef][Web of Science][Medline]
- Nakamura TM, et al. Telomerase catalytic subunit homologs from fission yeast and human. Science (1997) 277:955–959.
[Abstract/Free Full Text] - Kolquist KA, et al. Expression of TERT in early premalignant lesions and a subset of cells in normal tissues. Nat. Genet. (1998) 19:182–186.[CrossRef][Web of Science][Medline]
- Wang L, et al. hTERT expression is a prognostic factor of survival in patients with stage I non-small cell lung cancer. Clin. Cancer Res. (2002) 8:2883–2889.
[Abstract/Free Full Text] - Clark GM, et al. Telomerase activity and survival of patients with node-positive breast cancer. J. Natl. Cancer Inst. (1997) 89:1874–1881.
[Abstract/Free Full Text] - Hiyama E, et al. Telomerase activity in gastric cancer. Cancer Res. (1995) 55:3258–3262.
[Abstract/Free Full Text] - Wisman GB, et al. Telomerase in (pre)neoplastic cervical disease. Hum. Pathol. (2000) 31:1304–1312.[CrossRef][Web of Science][Medline]
- Tatsumoto N, et al. High telomerase activity is an independent prognostic indicator of poor outcome in colorectal cancer. Clin. Cancer Res. (2000) 6:2696–2701.
[Abstract/Free Full Text] - Falchetti ML, et al. In situ detection of telomerase catalytic subunit mRNA in glioblastoma multiforme. Int. J. Cancer (2000) 88:895–901.[CrossRef][Web of Science][Medline]
- Shpitz B, et al. Telomerase activity in ductal carcinoma in situ of the breast. Breast Cancer Res. Treat. (1999) 58:65–69.[CrossRef][Web of Science][Medline]
- Hoos A, et al. Telomerase activity correlates with tumor aggressiveness and reflects therapy effect in breast cancer. Int. J. Cancer (1998) 79:8–12.[CrossRef][Web of Science][Medline]
- Wang L, et al. Association of a functional tandem repeats in the downstream of human telomerase gene and lung cancer. Oncogene (2003) 22:7123–7129.[CrossRef][Web of Science][Medline]
- Wang L, et al. Survival prediction in patients with glioblastoma multiforme by human telomerase genetic variation. J. Clin. Oncol. (2006) 24:1627–1632.
[Abstract/Free Full Text] - Huo X, et al. Common non-synonymous polymorphisms in the BRCA1 Associated RING Domain (BARD1) gene are associated with breast cancer susceptibility: a case-control analysis. Breast Cancer Res. Treat. (2007) 102:329–337.[CrossRef][Web of Science][Medline]
- Key T, et al. Endogenous sex hormones and breast cancer in postmenopausal women: reanalysis of nine prospective studies. J. Natl Cancer Inst. (2002) 94:606–616.
[Abstract/Free Full Text] - Kelsey JL, et al. The epidemiology of breast cancer. CA Cancer J. Clin. (1991) 41:146–165.
[Abstract/Free Full Text] - Gao YT, et al. Association of menstrual and reproductive factors with breast cancer risk: results from the Shanghai breast cancer study. Int. J. Cancer (2000) 87:295–300.[CrossRef][Web of Science][Medline]
- Clavel-Chapelon F, et al. Differential effects of reproductive factors on the risk of pre- and postmenopausal breast cancer. Results from a large cohort of French women. Br. J. Cancer (2002) 86:723–727.[CrossRef][Web of Science][Medline]
- Li CI, et al. Timing of menarche and first full-term birth in relation to breast cancer risk. Am. J. Epidemiol. (2008) 167:230–239.
[Abstract/Free Full Text] - Krieger N. Exposure, susceptibility, and breast cancer risk: a hypothesis regarding exogenous carcinogens, breast tissue development, and social gradients, including black/white differences, in breast cancer incidence. Breast Cancer Res. Treat. (1989) 13:205–223.[CrossRef][Web of Science][Medline]
- Carpentier C, et al. Association of telomerase gene hTERT polymorphism and malignant gliomas. J. Neurooncol. (2007) 84:249–253.[CrossRef][Medline]
- Cuny M, et al. Relating genotype and phenotype in breast cancer: an analysis of the prognostic significance of amplification at eight different genes or loci and of p53 mutations. Cancer Res. (2000) 60:1077–1083.
[Abstract/Free Full Text] - Han W, et al. Associations between breast cancer susceptibility gene polymorphisms and clinicopathological features. Clin. Cancer Res. (2004) 10:124–130.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
