Skip Navigation


Carcinogenesis Advance Access originally published online on April 30, 2008
Carcinogenesis 2008 29(6):1202-1206; doi:10.1093/carcin/bgn101
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
29/6/1202    most recent
bgn101v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wilkening, S.
Right arrow Articles by Försti, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilkening, S.
Right arrow Articles by Försti, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Interleukin promoter polymorphisms and prognosis in colorectal cancer

Stefan Wilkening1, Björn Tavelin2, Federico Canzian1, Kerstin Enquist3, Richard Palmqvist4, Andrea Altieri1, Göran Hallmans3, Kari Hemminki1,5, Per Lenner2 and Asta Försti1,5,*

1 Division of Molecular Genetic Epidemiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 580, 69120 Heidelberg, Germany
2 Department of Oncology, Norrlands University Hospital, 90187 Umeå, Sweden
3 Department of Public Health and Clinical Medicine/Nutritional Research
4 Department of Medical Biosciences, Umeå University, 90185 Umeå, Sweden
5 Center for Family and Community Medicine, Karolinska Institute, 14183 Huddinge, Sweden

* To whom correspondence should be addressed. Tel: +49 6221 421803; Fax: +49 6221 421810; Email: a.foersti{at}dkfz.de


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
There is strong evidence that cancer-associated inflammation promotes tumor growth and progression. This is especially true for colorectal cancer (CRC). Interleukins (ILs) are important modulators for inflammation. We examined whether promoter polymorphisms in key IL genes (IL4, IL4R, IL6, IL8 and IL10) are associated with the risk or clinical outcome of CRC. Five single-nucleotide polymorphisms (SNPs) were analyzed in genomic DNA from a cohort including 308 Swedish incident cases of CRC with data on Dukes’ stage and up to 16 years of follow-up and 585 healthy controls. The selected SNPs have previously been shown to be functional and/or associated with cancer. None of the analyzed SNPs associated with the risk of CRC. When stratifying by tumor stage, significantly more patients carrying at least one G allele of IL10-1082 had tumors with Dukes’ stages A + B than with stages C + D (Ptrend = 0.035 for genotype distribution). Analyzing associations with overall survival time, we found the rare T allele of IL4-590 to be related to a longer survival [CT versus CC Cox proportional hazard ratio 0.69, 95% confidence intervals 0.46–1.03, TT versus CC 0.32 (0.10–1.03)]. For IL6-174, the CG genotype was associated with a longer survival when compared with the CC genotype [0.64 (0.40–1.01)]. The present study was particularly suitable for survival analysis because all patients were sampled before the diagnosis of CRC. Our results suggest that the SNPs IL4-590 and IL6-174 may be useful markers for CRC prognosis. The predicted biological effect of these SNPs in relation to promotion of cancer progression is consistent with the observed increased survival time.

Abbreviations: CI, confidence interval; CRC, colorectal cancer; HR, hazard ratio; IL, interleukin; OR, odds ratio; SNP, single-nucleotide polymorphism


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Colorectal cancer (CRC) is the second leading cause of cancer-related death in the Western countries (1). Heritable factors have been estimated to account for 35% of the risk of CRC (2). Germ line mutations in the adenomatous polyposis coli gene and the DNA mismatch repair genes lead to the familial adenomatous polyposis and the hereditary non-polyposis CRC syndromes, respectively (3). These inherited syndromes account for <5% of CRC (3). Several low-penetrance alleles or loci for CRC, such as APC*I370K, SMAD7 and 8q24, have also been identified (36). However, hardly anything is known about the effects of genetic variants on the progression and the prognosis of CRC.

It is well established that cancer arises and progresses in chronically inflamed tissue, and this is particularly notable in the gastrointestinal tract (7,8). Inflammatory bowel disease has been shown to be a risk factor for CRC (9). Recently, genome-wide association studies have identified the interleukin (IL) receptor gene, IL23R, as a risk factor for inflammatory bowel disease (10,11). For hepatocellular carcinoma and lung adenocarcinoma, cytokine gene expression signatures have been shown to predict the prognosis with high accuracy (12,13). In CRC, only tumor tissue expression of IL6 and serum levels of IL6 and IL8 have been studied in regard to cancer progression. The results showed that increased expression was a marker for a more aggressive outcome (1417). Polymorphisms in the promoter and other regulatory regions of the cytokine genes may affect gene expression and maintenance and progression of CRC.

Here, we investigate the effects of common single-nucleotide polymorphisms (SNPs) in the promoter regions of proinflammatory (IL6 and IL8) and anti-inflammatory ILs (IL4, IL4R and IL10) on CRC. The selected SNPs have been shown to affect transcriptional activity or gene expression in vitro (1824), production of the IL proteins ex vivo (18,24,25) and/or serum protein levels in vivo (19,2630). The SNPs IL6-174 (rs1800795) and IL8-251 (rs4073) have been associated with the risk of CRC (3133), whereas no association between the IL4-590 (rs2243250), IL4R-3223 (rs2057768) and IL10-1082 (rs1800896) SNPs and CRC has been observed so far (31,34,35). The IL6-174 and IL10-1082 SNPs have been shown to modify the prognosis and the survival of different cancers (3640), but to our knowledge, only one study (without any information of follow-up time) has been published regarding the effect of IL SNPs (IL4-590 and IL4R-3223) on survival in CRC (35). To analyze the effect of the IL SNPs on CRC risk and progression, the SNPs were genotyped in genomic DNA of the Swedish incident CRC patients, for whom data on tumor stage and long-term survival were available.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Population
The analyses were performed on genomic DNA from 308 Swedish CRC cases together with 585 controls. The cases, with the age and gender-matched controls, were drawn from the population-based Västerbotten intervention cohort and mammary screening project, which contain blood samples collected between October 1987 and April 2002 from an ethnically homogenous population living in a geographically defined region in North Sweden (41,42). Prospective cases were identified from the cohorts by record linkage to the regional cancer registry. The controls were selected from the same cohort as the corresponding case. They were matched with the case by the age at baseline (±6 months) and by the time of sampling (±2 months). The controls had to be alive at the time of diagnosis of the corresponding case and without any previous cancer diagnosis, except carcinoma in situ of cervix uteri. The female versus male distribution among the cases was 56.5 versus 43.5% and among the controls 56.1 versus 43.9%. The mean age at sampling of the cases was 56.8 years (range 30.1–73.4) and of the controls 56.8 years (range 30.0–73.8). The blood samples were stored at –80°C until the time of sample selection and DNA isolation for genotyping analyses. The samples were randomly divided on the 96-well plates. The laboratory personnel were kept blinded to the case–control status throughout the study. Clinical data for the CRC cases were retrieved from the registry managed by the Northern Sweden Collaborative Group for Colorectal Diseases (Table I). Information about the date of death was collected from the Swedish population register with a follow-up until September 2006. The data of cause of death were not available. The study was approved by the ethical committee of Karolinska Institute Syd and Umeå University.


View this table:
[in this window]
[in a new window]

 
Table I. Characteristics of the CRC cases at the time of diagnosis

 
SNP genotyping
SNP genotyping was performed with predesigned TaqMan assays from Applied Biosystems (Foster City, CA): IL4-590C/T (rs2243250, assay C_16176216_10); IL4R-3223G/A (rs2057768, assay C_2769607_10); IL8-251A/T (rs4073, assay C_11748116_10) and IL10-1082G/A (rs1800896, assay C_1747360_10) and one customized assay: IL6-174G/C (rs1800795, primers: TGACGACCTAAGCTGCACTTTTC, GGGCTGATTGGAAACCTTATTAAGA, probes: VIC-TCTTGCGATGCTAAA, FAM-TCTTGCCATGCTAAA, the SNP position is underlined). For TaqMan polymerase chain reaction, 5 ng of genomic DNA was analyzed in a total volume of 5 µl with an ABI PRISM 7900 Sequence detection system. Rates of genotyping completion ranged between 97.4 and 99.7%. For quality control, 10% of randomly selected samples containing both cases and controls were analyzed a second time without finding any discrepancies.

Statistical analyses
The observed genotype frequencies in the controls were tested for Hardy–Weinberg equilibrium and the difference between the observed and expected frequencies was tested for significance using the {chi}2 test. Statistical significance for the differences in the genotype frequencies between the CRC cases and controls was determined by using the {chi}2 test. Odds ratios (ORs) and 95% confidence intervals (CIs) for associations between genotypes and CRC and tumor characteristics were calculated by conditional logistic regression. The ORs were considered statistically significant when the 95% CIs did not overlap unity. The frequency of the minor allele homozygous genotype in the controls varied between 7.4 and 22.8% (Table II). For a polymorphism with a risk genotype frequency between 10 and 20%, our study had >80% power to detect an OR of 1.8–1.6 at a significance level of 0.05 (PS software for power and sample size calculation, http://biostat.mc.vanderbilt.edu/twiki/bin/view/Main/PowerSampleSize). The Kaplan–Meier method was used to estimate the survival probabilities, and the log-rank test was used to test differences between subgroups. We used death by any cause as an end point. After 115 months follow-up, only 25 cases were at risk, and no events took place after that. In order to exclude effects of genotype-specific responses to different treatments on survival, we also analyzed genotype-specific survival separately for patients diagnosed before and after 1 January 2000 (147 and 161 cases, respectively). In Sweden, the clinical management of CRC changed around year 2000, when preoperative radiotherapy was introduced for localized rectal cancers (43). Thereafter, postoperative adjuvant chemotherapy has also been introduced for advanced colorectal tumors (Dukes’ C), and surgical techniques have been changed. Additionally, we repeated the survival analyses for a 5 years survival in order to investigate whether the studied SNPs affect short-term survival. The prognostic significance of the IL genotypes was assessed by multivariate Cox proportion hazard model adjusted for age, gender and tumor stage. Statistical analyses were performed in SPSS, version 14. We estimated to have a power of ~80% to observe a hazard ratio (HR) of 3.0, comparable with the situation in the IL4-590 analysis.


View this table:
[in this window]
[in a new window]

 
Table II. Association of the genotypes in the IL genes with CRC susceptibility and Dukes' stage at the time of diagnosis

 

    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
IL SNPs, CRC risk and stage
The distribution of the genotypes for each polymorphism genotyped was in agreement with Hardy–Weinberg equilibrium. No significant differences in the genotype frequencies were observed between the cancer patients and the controls for any of the SNPs (Table II). When stratifying by tumor stage, significantly more patients carrying at least one G allele of IL10-1082 had tumors with Dukes’ stages A + B than with stages C + D (Ptrend = 0.035 for genotype distribution). For the other SNPs, no association was found in the stratified sample set.

IL SNPs and overall survival
Based on the data from our cohort with up to 16 years of follow-up, we examined the impact of the analyzed SNPs on the overall survival time of the CRC patients. The strongest association was found for IL4-590 as shown in Figure 1A: patients with the CC genotype had a significantly shorter survival compared with patients with the CT (P = 0.047) or the TT genotype (P = 0.028). As shown in Figure 1B, the IL6-174 genotype CC (allele annotation refers to the probe sequence) was also found to be associated with a shorter survival. However, the association was statistically significant only when compared with the CG genotype (P = 0.032). The results of the 5 years survival analysis were very similar: the CC genotype of IL4-590 was associated with a significantly shorter survival compared with the CT genotype (P = 0.037) and to the TT genotype (P = 0.055); the association of the CC genotype of IL6-174 with survival was only significant compared with the CG genotype (P = 0.017). The CC genotypes of the IL4-590 and IL6-174 SNPs were also associated with shortest survival both in patients diagnosed with CRC before and after 1 January 2000 (data not shown). However, the only statistically significant association was observed between the IL4-590 CC genotype and survival in patients diagnosed before 2000 (CC versus CT P = 0.021 and CC versus TT P = 0.076). The associations of the IL4-590 and IL6-174 genotypes with survival did not depend on Dukes’ stage (data not shown). In the multivariate analysis, the stage of the tumor was found to be the most important factor for survival (HR 4.46, 95% CI 2.98–6.65, P < 0.001). The prognostic value of the genotypes was of borderline significance after adjusting for age, gender and tumor stage (IL4-590 TT versus CC: HR 0.32, 95% CI 0.10–1.03, P = 0.056 and IL6-174 CG versus CC: HR 0.64, 95% CI 0.40–1.01, P = 0.052). The other SNPs were not associated with survival, either in the long-term or the short-term analysis (data not shown).


Figure 1
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Kaplan–Meier analysis of overall survival is shown for different genotypes of SNPs IL4-590 (A) and IL6-174 (B). See Table II for the number of cases with each genotype.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
The most significant result of our study was the association of the C allele of the promoter SNP IL4-590 with a shorter overall survival. IL4 is an anti-inflammatory cytokine and the C allele has been associated with decreased transcriptional activity (21,22). In cancer cell lines, variations in the activity of IL4 and its receptor have been shown to modulate cell proliferation and to affect signal transduction pathways (44). In a human CRC cell line, IL4 has been shown to inhibit cell growth (45). IL4 has further been described to cause a dose-dependent reduction of proliferation (46) and to inhibit matrix metalloproteinases (MMP-1, -2 and -9), cell matrix invasion and cell migration (47). Thus, a polymorphism decreasing the expression of the gene would be expected to promote cancer progression, consistent with the observed shortened survival time in C allele carriers in our study.

Our results showed that the IL6-174 genotype CC was significantly associated with poor overall survival when compared with the heterozygous genotype CG, but the association did not show statistical significance when compared with the homozygous genotype GG. Results from previous studies concerning the effect of IL6-174 on expression, cancer risk or survival are contradictory (19,23,25,26,2830,32,33,3638). This may partially be explained by the confusion in the nomenclature of IL6-174 alleles because the allele frequencies are close to 50% in Caucasians and the alleles are the complementary nucleotides C and G. Thus, the allele annotation depends on which DNA strand is used as a reference sequence. In our study, the allele annotation is according to the probe sequences given in Materials and Methods. Other factors contributing to the inconsistent results in the literature might be nearby SNPs (-597, -572 and -373) that also affect the activity of the IL6 promoter (23). Furthermore, IL6 has both pro- as well as anti-inflammatory properties (48,49) and it seems to be regulated differently depending on the type of cell it is expressed in (23). In CRC patients, high expression of IL6 has been correlated with the size or invasiveness of the tumor (16), lymph node and/or hepatic metastasis (14) and poor survival (15), all features indicating a more aggressive behavior of the cancer. The C allele, which we found to be associated with shorter survival time, has been associated with a lower IL6 serum level in CRC patients (26). In other studies, however, the C allele has been described to correlate with increased IL6 serum levels (2830).

The present study was particularly suitable for survival analysis because all patients were sampled before the diagnosis of CRC, independently of their genotype (42). The follow-up time was up to 16 years after diagnosis, allowing analysis of long-term survival. Interestingly, the poor survival of the CC genotype carriers of the IL4-590 and IL6-174 SNPs was observed both in the long-term (up to 16 years follow-up) and the short-term (5 years follow-up) survival analyses. However, the changes in the treatment strategies introduced around 2000 in Sweden are a limitation of our study (43). Although the poor survival observed in the CC genotype carriers of the IL4-590 and IL6-174 SNPs was observed both in patients diagnosed before and after 1 January 2000, these results should be taken with caution because of the follow-up time differences and the small numbers of cases in some subgroups. If our finding holds in the future studies, it may indicate the usefulness of these SNPs as early indicators for poor survival, and the treatment and follow-up strategies could be adjusted accordingly.

Genetic factors may also have an effect on prognostically important features of the malignant phenotype and these factors are probably to be different from the ones affecting the risk of CRC (50,51). Because data of Dukes’ stage of the tumors were available, subdivision of the patients according to the severity of the disease based on the traditional prognostic marker was also possible. In our study, significantly more patients carrying at least one G allele of IL10-1082 had tumor stages A + B than stages C + D. A protective effect for the G allele could be due to an increased expression of the anti-inflammatory IL10 (18,24). However, the SNP was not associated with the survival time, decreasing its value as a prognostic biomarker. In our study, more patients with Dukes’ stage A tumors were observed than expected. The participation rate in the Västerbotten Intervention Project was 60–70% of the population. It is possible that there was a selection bias in the recruited population, as individuals aware of their health may have been more prone to participate.

Although all the analyzed SNPs have been shown to have a functional effect or to be associated with the risk of CRC in studies with comparable sample sizes to our study (1833,35), we did not find any association with the risk of CRC in our patient series. However, with our sample size (308 cases and 585 controls), only major effects of the studied SNPs on the CRC risk (OR > 1.6) could be excluded.

As in all association studies, analysis of multiple SNPs represents a statistical multiple comparison problem. Although there are several methods for handling multiple comparisons in molecular epidemiological studies, no standard approach has been universally adopted (52). It is also unclear how the likely biological relevance of an SNP should be taken into account. In our study, the associations of the IL4 and IL6 SNPs with survival were of borderline significance after adjusting for Dukes’ stage, the strongest traditional prognostic marker in CRC, age and sex. However, multivariate analysis is complicated by correlations between variables whereby causality cannot be inferred.

In conclusion, our results suggest a role for IL4 and IL6 SNPs in CRC prognosis. Due to the strong evidence about the biological significance of these SNPs and the rather limited number of cases in our study, further independent studies are needed to evaluate the significance of our findings in the clinic.


    Funding
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Wallenberg Consortium North (KAW 2004.0083), Sweden; European Union (LSHC-CT-2004-503465).


    Acknowledgments
 
We thank Åsa Ågren (Department of Public Health and Clinical Medicine/Nutritional Research, Umeå University, Sweden) for her efficiency and skill in keeping track of samples and data. The Northern Sweden Collaborative Group for Colorectal Diseases is appreciated for providing the clinical data.

Conflict of Interest Statement: None declared.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 

  1. Greenlee RT, et al. Cancer statistics, 2000. CA Cancer J. Clin. (2000) 50:7–33.[Abstract]
  2. Lichtenstein P, et al. Environmental and heritable factors in the causation of cancer—analyses of cohorts of twins from Sweden, Denmark, and Finland. N. Engl. J. Med. (2000) 343:78–85.[Abstract/Free Full Text]
  3. de la Chapelle A. Genetic predisposition to colorectal cancer. Nat. Rev. Cancer (2004) 4:769–780.[CrossRef][Web of Science][Medline]
  4. Broderick P, et al. A genome-wide association study shows that common alleles of SMAD7 influence colorectal cancer risk. Nat. Genet. (2007) 39:1315–1317.[CrossRef][Web of Science][Medline]
  5. Tomlinson I, et al. A genome-wide association scan of tag SNPs identifies a susceptibility variant for colorectal cancer at 8q24.21. Nat. Genet. (2007) 39:984–988.[CrossRef][Web of Science][Medline]
  6. Zanke BW, et al. Genome-wide association scan identifies a colorectal cancer susceptibility locus on chromosome 8q24. Nat. Genet. (2007) 39:989–994.[CrossRef][Web of Science][Medline]
  7. Lee YJ, et al. White blood cell count and the risk of colon cancer. Yonsei Med. J. (2006) 47:646–656.[Web of Science][Medline]
  8. Coussens LM, et al. Inflammation and cancer. Nature (2002) 420:860–867.[CrossRef][Medline]
  9. Bernstein CN, et al. Cancer risk in patients with inflammatory bowel disease: a population-based study. Cancer (2001) 91:854–862.[CrossRef][Web of Science][Medline]
  10. Duerr RH, et al. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science (2006) 314:1461–1463.[Abstract/Free Full Text]
  11. WTCCC. Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature (2007) 447:661–678.[CrossRef][Web of Science][Medline]
  12. Budhu A, et al. Prediction of venous metastases, recurrence, and prognosis in hepatocellular carcinoma based on a unique immune response signature of the liver microenvironment. Cancer Cell (2006) 10:99–111.[CrossRef][Web of Science][Medline]
  13. Seike M, et al. Use of a cytokine gene expression signature in lung adenocarcinoma and the surrounding tissue as a prognostic classifier. J. Natl Cancer Inst. (2007) 99:1257–1269.[Abstract/Free Full Text]
  14. Ashizawa T, et al. Study of interleukin-6 in the spread of colorectal cancer: the diagnostic significance of IL-6. Acta Med. Okayama (2006) 60:325–330.[Web of Science][Medline]
  15. Chung YC, et al. Clinical significance of tissue expression of interleukin-6 in colorectal carcinoma. Anticancer Res. (2006) 26:3905–3911.[Abstract/Free Full Text]
  16. Ueda T, et al. Serum levels of cytokines in patients with colorectal cancer: possible involvement of interleukin-6 and interleukin-8 in hematogenous metastasis. J. Gastroenterol. (1994) 29:423–429.[CrossRef][Web of Science][Medline]
  17. Belluco C, et al. Interleukin-6 blood level is associated with circulating carcinoembryonic antigen and prognosis in patients with colorectal cancer. Ann. Surg. Oncol. (2000) 7:133–138.[Abstract]
  18. Crawley E, et al. Polymorphic haplotypes of the interleukin-10 5’ flanking region determine variable interleukin-10 transcription and are associated with particular phenotypes of juvenile rheumatoid arthritis. Arthritis Rheum. (1999) 42:1101–1108.[CrossRef][Web of Science][Medline]
  19. Fishman D, et al. The effect of novel polymorphisms in the interleukin-6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset juvenile chronic arthritis. J. Clin. Invest. (1998) 102:1369–1376.[Web of Science][Medline]
  20. Hull J, et al. Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax (2000) 55:1023–1027.[Abstract/Free Full Text]
  21. Rosenwasser LJ, et al. Promoter polymorphisms in the chromosome 5 gene cluster in asthma and atopy. Clin. Exp. Allergy (1995) 25(suppl. 2):74–78. discussion 95–176.[CrossRef][Web of Science][Medline]
  22. Song Z, et al. Polymorphic nucleotides within the human IL-4 promoter that mediate overexpression of the gene. J. Immunol. (1996) 156:424–429.[Abstract]
  23. Terry CF, et al. Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation. J. Biol. Chem. (2000) 275:18138–18144.[Abstract/Free Full Text]
  24. Turner DM, et al. An investigation of polymorphism in the interleukin-10 gene promoter. Eur. J. Immunogenet. (1997) 24:1–8.[Web of Science][Medline]
  25. Rivera-Chavez FA, et al. Interleukin-6 promoter haplotypes and interleukin-6 cytokine responses. Shock (2003) 20:218–223.[CrossRef][Web of Science][Medline]
  26. Belluco C, et al. -174 G>C polymorphism of interleukin 6 gene promoter affects interleukin 6 serum level in patients with colorectal cancer. Clin. Cancer Res. (2003) 9:2173–2176.[Abstract/Free Full Text]
  27. Hytonen AM, et al. Haplotypes of the interleukin-4 receptor alpha chain gene associate with susceptibility to and severity of atopic asthma. Clin. Exp. Allergy (2004) 34:1570–1575.[CrossRef][Web of Science][Medline]
  28. Boiardi L, et al. Relationship between interleukin 6 promoter polymorphism at position -174, IL-6 serum levels, and the risk of relapse/recurrence in polymyalgia rheumatica. J. Rheumatol. (2006) 33:703–708.[Abstract/Free Full Text]
  29. Bruunsgaard H, et al. The IL-6 -174G>C polymorphism is associated with cardiovascular diseases and mortality in 80-year-old humans. Exp. Gerontol. (2004) 39:255–261.[CrossRef][Web of Science][Medline]
  30. Jones KG, et al. Interleukin-6 (IL-6) and the prognosis of abdominal aortic aneurysms. Circulation (2001) 103:2260–2265.[Abstract/Free Full Text]
  31. Gunter MJ, et al. Inflammation-related gene polymorphisms and colorectal adenoma. Cancer Epidemiol. Biomarkers Prev. (2006) 15:1126–1131.[Abstract/Free Full Text]
  32. Landi S, et al. Association of common polymorphisms in inflammatory genes interleukin (IL)6, IL8, tumor necrosis factor alpha, NFKB1, and peroxisome proliferator-activated receptor gamma with colorectal cancer. Cancer Res. (2003) 63:3560–3566.[Abstract/Free Full Text]
  33. Theodoropoulos G, et al. Relation between common polymorphisms in genes related to inflammatory response and colorectal cancer. World J. Gastroenterol. (2006) 12:5037–5043.[Web of Science][Medline]
  34. Crivello A, et al. Regulatory cytokine gene polymorphisms and risk of colorectal carcinoma. Ann. N. Y. Acad. Sci. (2006) 1089:98–103.[CrossRef][Web of Science][Medline]
  35. Landi S, et al. Interleukin-4 and interleukin-4 receptor polymorphisms and colorectal cancer risk. Eur. J. Cancer (2007) 43:762–768.[CrossRef][Web of Science][Medline]
  36. DeMichele A, et al. Interleukin-6 -174G-->C polymorphism is associated with improved outcome in high-risk breast cancer. Cancer Res. (2003) 63:8051–8056.[Abstract/Free Full Text]
  37. Grimm C, et al. A common interleukin-6 promoter polymorphism in patients with vulvar cancer. J. Soc. Gynecol. Investig (2005) 12:617–620.[CrossRef][Web of Science][Medline]
  38. Hefler LA, et al. An interleukin-6 gene promoter polymorphism influences the biological phenotype of ovarian cancer. Cancer Res. (2003) 63:3066–3068.[Abstract/Free Full Text]
  39. Howell WM, et al. Interleukin-10 polymorphisms, cancer susceptibility and prognosis. Fam. Cancer (2006) 5:143–149.[CrossRef][Web of Science][Medline]
  40. Tan D, et al. Interleukin-6 polymorphism is associated with more aggressive prostate cancer. J. Urol. (2005) 174:753–756.[CrossRef][Web of Science][Medline]
  41. Kaaks R, et al. Prospective study of IGF-I, IGF-binding proteins, and breast cancer risk, in northern and southern Sweden. Cancer Causes Control (2002) 13:307–316.[CrossRef][Web of Science][Medline]
  42. Pukkala E, et al. Nordic biological specimen banks as basis for studies of cancer causes and control—more than 2 million sample donors, 25 million person years and 100,000 prospective cancers. Acta Oncol. (2007) 46:286–307.[CrossRef][Web of Science][Medline]
  43. Dahlberg M, et al. Improved survival and reduction in local failure rates after preoperative radiotherapy: evidence for the generalizability of the results of Swedish Rectal Cancer Trial. Ann. Surg. (1999) 229:493–497.[CrossRef][Web of Science][Medline]
  44. Beckmann MP, et al. The interleukin-4 receptor: structure, function, and signal transduction. Chem. Immunol. (1992) 51:107–134.[Web of Science][Medline]
  45. Toi M, et al. Inhibition of colon and breast carcinoma cell growth by interleukin-4. Cancer Res. (1992) 52:275–279.[Abstract/Free Full Text]
  46. Lahm H, et al. Growth inhibition of human colorectal-carcinoma cells by interleukin-4 and expression of functional interleukin-4 receptors. Int. J. Cancer (1994) 59:440–447.[Web of Science][Medline]
  47. Uchiyama A, et al. Interleukin-4 inhibits hepatocyte growth factor-induced invasion and migration of colon carcinomas. J. Cell. Biochem. (1996) 62:443–453.[CrossRef][Web of Science][Medline]
  48. Ramji DP, et al. The two C/EBP isoforms, IL-6DBP/NF-IL6 and C/EBP delta/NF-IL6 beta, are induced by IL-6 to promote acute phase gene transcription via different mechanisms. Nucleic Acids Res. (1993) 21:289–294.[Abstract/Free Full Text]
  49. Gabay C, et al. Production of IL-1 receptor antagonist by hepatocytes is regulated as an acute-phase protein in vivo. Eur. J. Immunol. (2001) 31:490–499.[CrossRef][Web of Science][Medline]
  50. Crawford NP, et al. New perspectives on hereditary influences in metastatic progression. Trends Genet. (2006) 22:555–561.[CrossRef][Web of Science][Medline]
  51. Vogelstein B, et al. Cancer genes and the pathways they control. Nat. Med. (2004) 10:789–799.[CrossRef][Web of Science][Medline]
  52. Thomas DC, et al. Betting odds and genetic associations. J. Natl Cancer Inst. (2004) 96:421–423.[Free Full Text]
Received January 23, 2008; revised April 7, 2008; accepted April 18, 2008.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
29/6/1202    most recent
bgn101v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wilkening, S.
Right arrow Articles by Försti, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilkening, S.
Right arrow Articles by Försti, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?