Skip Navigation


Carcinogenesis Advance Access originally published online on June 20, 2008
Carcinogenesis 2008 29(8):1608-1613; doi:10.1093/carcin/bgn152
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
29/8/1608    most recent
bgn152v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Takahashi, M.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, M.
Right arrow Articles by Wakabayashi, K.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Increased expression of inducible nitric oxide synthase (iNOS) in N-nitrosobis(2-oxopropyl)amine-induced hamster pancreatic carcinogenesis and prevention of cancer development by ONO-1714, an iNOS inhibitor

Mami Takahashi1,*, Tsukasa Kitahashi1, Rikako Ishigamori1, Michihiro Mutoh1, Masami Komiya1, Hidetaka Sato2, Yoshihisa Kamanaka3, Masao Naka3, Takayuki Maruyama3, Takashi Sugimura1 and Keiji Wakabayashi1

1 Cancer Prevention Basic Research Project, National Cancer Center Research Institute, 1-1 Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan
2 Japan Food Research Laboratories, Bunkyo 2-3, Chitose-shi, Hokkaido 066-0052, Japan
3 Minase Research Institute, Ono Pharmaceutical Co. Ltd., 1-1, Sakurai 3-chome, Shimamoto-cho, Mishima-gunn, Osaka 618-8585, Japan

* To whom correspondence should be addressed. Tel: +81 3 3542 2511; Fax: +81 3 3543 9305; Email: mtakahas{at}ncc.go.jp


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Elevated protein expression of inducible nitric oxide synthase (iNOS) has been observed in human pancreatic cancers and therefore, iNOS may play important roles in pancreatic carcinogenesis. This was examined in the present study, using an experimental model with N-nitrosobis(2-oxopropyl)amine (BOP)-treated hamsters. Reverse transcription–polymerase chain reaction analysis demonstrated iNOS expression in a hamster pancreatic cancer cell line as well as in human pancreatic cancer cell lines. Immunohistochemical analysis revealed increased expression of iNOS protein in atypical hyperplasia and ductal adenocarcinomas of the pancreas in BOP-treated hamsters. In addition, iNOS expression was also observed in macrophages and islet cells in pancreatic tissue surrounding tumors. In order to assess the role of iNOS expression in carcinogenesis in the pancreas, the effects of ONO-1714 [(1S, 5S, 6R, 7R)-7-chloro-3-imino-5-methyl-2-azabicyclo[4.1.0]heptane], an iNOS inhibitor, on hamster pancreatic ductal carcinogenesis were investigated. Female Syrian golden hamsters were treated with BOP at 10 mg/kg body wt, four times for 1 week, and 1 week after the last carcinogen treatment, ONO-1714 was administered at doses of 100 and 200 p.p.m. in the diet for 15 weeks. The incidences and multiplicities of atypical hyperplasia and invasive adenocarcinoma and total adenocarcinomas (non-invasive and invasive adenocarcinomas) in the pancreas were significantly lowered by treatment with 200 p.p.m. ONO-1714. Treatment with 100 p.p.m. ONO-1714 also significantly decreased the multiplicities of invasive and total adenocarcinomas. Moreover, treatment with 200 p.p.m. ONO-1714 reduced the number of BOP-induced cholangiocellular tumors. These results suggest that iNOS plays roles in promoting pancreatic carcinogenesis in both early and late stages in hamsters.

Abbreviations: BOP, N-nitrosobis(2-oxopropyl)amine; cDNA, complementary DNA; iNOS, inducible nitric oxide synthase; IL, interleukin; NO, nitric oxide; NOS, nitric oxide synthase


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 Funding
 References
 
Pancreatic cancer is steadily increasing in incidence and has a very poor prognosis (1). For development of effective chemotherapeutic and chemopreventive agents, elucidation of causative factors and mechanisms underlying pancreatic carcinogenesis is very important. As with other cancers, chronic inflammation is considered to be one of the risk factors (2). Epidemiological studies have shown that in addition to the environmental factors like cigarette smoking and dietary habits, pancreatitis is very important (3). Causes of pancreatitis are known to include alcohol drinking, smoking, gallstones, hyperlipidemia and stress (4,5).

Chronic inflammation is associated with release of many cytokines and activation of nuclear factor {kappa}B, resulting in the expression of nuclear factor {kappa}B-regulated, inflammatory-related genes, such as inducible nitric oxide synthase (iNOS) (6). The resultant overproduction of nitric oxide (NO) contributes to multistage carcinogenesis by inducing DNA mutations and tissue damage (6). Increased expression of iNOS in human pancreatic cancers has been described (7–9) and expression has been also reported in a rat pancreatitis model (10).

Suppressive effects of iNOS-selective inhibitors, (1S, 5S, 6R, 7R)-7-chloro-3-imino-5-methyl-2-azabicyclo[4.1.0] heptane (ONO-1714) and L-N6-(1-iminoethyl)lysine tetrazole-amide (SC-51), on pancreatitis in rats have been reported (11,12). ONO-1714 is 10-fold more selective for human iNOS than for human endothelial nitric oxide synthase (NOS), very potent in inhibiting plasma NO elevation in lipopolysaccharide-treated mice with a 50% inhibition dose of 0.010 mg/Kg subcutaneously and less toxic with a maximum tolerated dose of 30 mg/kg intravenously in mice (13,14). In addition, ONO-1714 is effective even when orally administered and our previous studies have demonstrated suppressive effects of ONO-1714 on growth of tumors formed in nude mice after subcutaneous injection of the K-ras mutant-transfected cells (15), aberrant crypt focus formation and large tumor development in the colon of rats treated with azoxymethane (16) and on colon cancer development in Min mice treated with dextran sodium sulfate (17). However, to our knowledge, there have hitherto been no reports concerning effects of iNOS inhibitors on pancreatic cancer development.

The Syrian golden hamster provides a unique model animal for the development of ductal pancreatic cancer. With subcutaneous injections of N-nitrosobis(2-oxopropyl)amine (BOP) (18), lesions having close similarities to the major form of pancreatic cancer in humans are induced. Point mutations in codon 12 of the K-ras gene are frequently observed (19), and expression of the fragile histidine triad gene, a tumor suppression gene, is generally abnormal in pancreatic cancers of hamsters (20), as in human tumors (21,22). Upregulation of cyclooxygenase-2 has been also observed in both BOP-induced pancreatic neoplastic lesions in hamsters and in human lesions (23), although there has been no report of iNOS expression in hamster pancreatic cancer. Therefore in the present study, we examined expression of iNOS in hamster pancreatic ductal cancer and investigated suppressive effects of ONO-1714, an iNOS-selective inhibitor, on hamster pancreatic ductal carcinogenesis induced by BOP.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 Funding
 References
 
Chemicals
(1S, 5S, 6R, 7R)-7-chloro-3-imino-5-methyl-2-azabicyclo[4.1.0] heptane (ONO-1714) was chemically synthesized at Ono Pharmaceutical Co. Ltd (Osaka, Japan). BOP was obtained from Nacalai Tesque (Kyoto, Japan).

Cell culture
A hamster pancreatic cancer cell line, HaP-T1 (24), was obtained from RIKEN Cell Bank (Saitama, Japan) and a hamster pancreatic β-cell cell line, HIT-T15, from Dainippon Pharmaceutical Co., Ltd (Osaka, Japan). Human pancreatic cancer cell lines, Capan-2, HPAF-II, HPAC, Hs-776T, MiaPaca-2 and Panc-1, were obtained from Summit Pharmaceutical International Co., LTD (Tokyo, Japan) and BxPC-3 from RIKEN Cell Bank. A human pancreatic normal ductal cell line, HPDE-6 (25), was kindly provided by Dr Ming-Sound Tsao (University Health Network, Toronto, Ontario, Canada). The cells were maintained in RPMI-1640 (Iwaki, Japan), supplemented with 5% fetal bovine serum (HyClone Laboratories, Logan, UT) and 100 units/ml penicillin–streptomycin (GIBCO/Invitrogen Corp., Carlsbad, CA) at 37°C in 5% CO2. To induce iNOS expression, cells were treated with 10 ng/ml of mouse or human interleukin (IL)-1β (Sigma Chemical Co., St Louis, MO) for 6 h.

Animals
Five-week-old female Syrian golden hamsters weighing ~80 g were obtained from Japan SLC (Shizuoka, Japan) and acclimated to laboratory conditions for a week. They were housed two or three per plastic cage, with sterilized softwood chips as bedding, in an air-conditioned animal room, on a 12 h light–dark cycle. Powdered CE-2 (CLEA Japan, Shizuoka, Japan) was used as a standard basal diet. Body weights were measured on a weekly basis and food consumption twice a week. Food and water were made available ad libitum.

Reverse transcription–polymerase chain reaction analysis
Total RNA was extracted from culture cell samples using ISOGEN (Wako Pure Chemical Industries, Ltd, Osaka, Japan). After RNA purification, aliquots of total RNA (2 µg) were subjected to the reverse transcription reaction with oligo-dT or 9mer random primers in a final volume of 20 µl using an Omuniscript Reverse Transcription Kit (Qiagen GmbH, Heilden, Germany). Polymerase chain reaction amplification was performed in a final volume of 10 µl with aliquots of complementary DNA (cDNA) (25 ng) and iTaq DNA polymerase (Bio-Rad Laboratories, Hercules, CA) using a PTC-200 Peltier thermal cycler (MJ Research, Waltham, MA). The primers used were selected from the common sequences among hamster, mouse, rat and human cDNA sequences of β-actin (26) and the common sequences between hamster and human cDNA of iNOS (accession numbers, AY297461 [GenBank] and D26525 [GenBank] )—5'-primer: ACGAGGCCCAGAGCAAGAGA, 3'-primer: TGGCTGGGGTGTTGAAGGTC (product size, 228 bp) for β-actin and 5'-primer: TTCCCCCAGCGGAGTGATGG, 3'-primer: GTACCAGCCATTGAAGGGGC (product size, 382 bp) for iNOS. The cycling conditions were as follows: 95°C for 3 min, 26 cycles (for β-actin) or 35 cycles (for iNOS) of 94°C for 15 s, 60°C for 25 s and 72°C for 30 s and a 10 min cycle at 72°C. Products were analyzed by 2% agarose gel electrophoresis with ethidium bromide staining.

Immunohistochemistry
Paraffin sections from formalin-fixed tissues of hamster normal pancreas and pancreatic tumors obtained in our previous study (26) were used for immunohistochemical analyses with the avidin–biotin complex immunoperoxidase technique as described previously (27). As the primary antibody, monoclonal mouse anti-iNOS IgG (BD Biosciences Pharmingen, San Diego, CA #610328) was applied at 50x dilution. As the secondary antibody, biotinylated anti-mouse IgG raised in a horse, affinity purified and absorbed with rat serum (Vector Laboratories, Burlingame, CA) was employed at 200x dilution. Staining was performed using avidin–biotin reagents (Vectastain ABC reagents; Vector Laboratories), 3,3'-diaminobenzidine and hydrogen peroxide. The sections were counterstained with hematoxylin. As a negative control, duplicate sections were immunostained without exposure to the primary antibody.

Study on the effects of ONO-1714, an iNOS inhibitor, on BOP-induced pancreatic carcinogenesis in hamsters
A total of 126 hamsters at 6 weeks of age were injected subcutaneously with BOP four times (on days 1, 3, 5 and 7) at a dose of 10 mg/kg body wt, whereas 18 hamsters received saline as vehicle controls. One week after the last BOP treatment, one-third of each group was given basal diet, diet containing 100 p.p.m. or 200 p.p.m. of ONO-1714 for 15 weeks. The doses were based on our previous study in mice (15,17) and rats (16) and a preliminary study in hamsters (data not shown). At the killing time point at 23 weeks of age, all surviving animals were anesthetized with diethyl ether, and blood samples were collected from the aorta. At autopsy, the pancreas, heart, lungs, kidneys, liver and bile duct were carefully examined macroscopically. The heart, lungs, kidneys, liver and bile duct were fixed in 10% phosphate-buffered formalin (pH 7.4). Each pancreas was carefully dissected from surrounding tissue and fixed after spreading on filter paper. All paraffin-embedded organs were sectioned and stained with hematoxylin and eosin for assessment of histopathological features, as described previously (26). The experimental protocol was in accordance with the guidelines for Animal Experiments in the National Cancer Center and was approved by the Institutional Ethics Review Committee for Animal Experimentation.

Statistical analysis
The significance of differences in the incidences of tumors was analyzed by the {chi}2 test. Variation in other data was evaluated by the Student’s t-test. A P value of <0.05 was regarded as significant.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 Funding
 References
 
iNOS expression in human and hamster pancreatic cancer cell lines
Expression of iNOS messenger RNA in human and hamster pancreatic cancer cell lines was examined by reverse transcription–polymerase chain reaction. As shown in Figure 1, iNOS was constitutively expressed in five of seven human pancreatic cancer cell lines, BxPC-3, HPAF-II, Hs-766T, MiaPaca-2 and Panc-1. On treatment with IL-1β, expression of iNOS in the other two cancer cell lines, Capan-2 and HPAC, and a human pancreatic normal ductal cell line, HPDE-6, was induced, and the expression in HPAF-II and Hs-766T was enhanced. Expression of iNOS was also constitutively observed in a hamster pancreatic cancer cell line, HaP-T1, and a hamster β-cell cell line, HIT-T15, and in both cases was markedly enhanced by treatment with IL-1β.


Figure 1
View larger version (47K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. Reverse transcription–polymerase chain reaction analysis of iNOS expression in human (A) and hamster (B) pancreatic cell lines. Pancreatic cancer cell lines (BxPC-3, Capan-2, HPAF-II, HPAC, Hs-766T, MiaPaca-2, Panc-1 and HaP-T1), a normal pancreatic ductal epithelial cell line (HPDE-6) and an islet β-cell line (HIT-T15) were incubated in basal medium (lane 1) or treated with 10 ng/ml IL-1β (lane 2) for 6 h. Total RNA from each sample was extracted and cDNA was synthesized by reverse transcription. Then, cDNA fragments of iNOS and β-actin were amplified by polymerase chain reaction, and the polymerase chain reaction products were electrophoresed on a 2% agarose gel.

 
iNOS expression in hamster pancreatic ductal adenocarcinomas induced by BOP
Expression of iNOS protein in hamster pancreatic ductal cancers was examined by immunohistochemical staining. In normal pancreatic tissue, expression of iNOS protein was barely detectable in non-treated normal pancreatic tissue (Figure 2A) and non-tumorous parts of BOP-treated pancreatic tissue (Figure 2B). In contrast, positive staining for iNOS was clearly observed in macrophages and islet cells in areas of inflammation, atypical hyperplasia in ducts (Figure 2C) and in the carcinoma epithelial cells (Figure 2D). All 12 pancreatic carcinomas examined were positive for iNOS staining: six demonstrated strong, four moderate and two weak staining in the cytoplasm of epithelial cancer cells.


Figure 2
View larger version (149K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. Immunohistochemical staining for iNOS. No iNOS immunoreactivity is apparent in normal pancreas of non-treated (A) and BOP-treated (B) hamsters. Immunoreactive iNOS is observed in macrophages and islet cells in inflammation, atypical hyperplasia in ducts (C) and carcinoma epithelial cells (D) in BOP-treated hamsters. (A–D) x100.

 
Effects of ONO-1714 on pancreatic tumor development in BOP-treated hamsters
To examine the role of iNOS on pancreatic carcinogenesis, hamsters were treated with a pancreatic carcinogen, BOP, then were fed a diet containing the iNOS inhibitor, ONO-1714, at doses of 100 or 200 p.p.m. for 15 weeks. The final body weights (g) and average food intake of hamsters are shown in Table I. The body weights and average food intake in the BOP + basal diet group were lower than those in the saline + basal diet group (P < 0.05), and the average body weight in the saline + 200 p.p.m. ONO-1714 group was 13% lower than in the saline + basal diet group (P < 0.01). However, in the BOP-treated groups, no significant differences were observed after treatment with ONO-1714.


View this table:
[in this window]
[in a new window]

  		Table I. Final body weights of the hamsters and average food intake

 
Pancreatic lesions were histopathologically diagnosed as atypical hyperplasia, non-invasive adenocarcinomas and invasive adenocarcinomas. Incidence and multiplicity data are summarized in Table II. The incidence of atypical hyperplasia and adenocarcinomas induced by BOP was lower in the group treated with 200 p.p.m. ONO-1714 than in the control group (21 versus 52% at P < 0.005 and 45 versus 69% at P < 0.05, respectively). Remarkably, the incidence of invasive adenocarcinomas was significantly lower in the 200 p.p.m. ONO-1714 group than in the control group (12 versus 45% at P < 0.001). Multiplicities of total adenocarcinomas were significantly decreased by treatment with 100 p.p.m. (0.76 ± 0.82, P < 0.05) and 200 p.p.m. ONO-1714 (0.60 ± 0.77, P < 0.01) compared with the control value (1.19 ± 1.10). It was notable that the multiplicities of invasive adenocarcinomas in the 100 p.p.m. and 200 p.p.m. ONO-1714 groups were only one-half (0.36 ± 0.62, P < 0.05) and one-fifth (0.14 ± 0.42, P < 0.01) of the control value (0.74 ± 1.01), respectively. On the other hand, the multiplicities of non-invasive adenocarcinomas did not significantly differ among the three groups. Figure 3 shows the size distribution of pancreatic adenocarcinomas. The numbers of carcinomas <3, 3–5 and ≥5 mm in diameter in the BOP + 100 p.p.m. ONO-1714 group were 55, 56 and 86% of the BOP + basal diet values, respectively, suggesting that treatment with 100 p.p.m. ONO-1714 tended to suppress the development of carcinomas <5 mm in diameter, but not the larger lesions. On the other hand, those in the BOP + 200 p.p.m. ONO-1714 group were 75, 38 and 29% of the control group, respectively, indicating that treatment with 200 p.p.m. ONO-1714 tended to suppress the development of carcinoma >3 mm in diameter and significantly reduced the development of carcinoma >5 mm in diameter (P < 0.05).


View this table:
[in this window]
[in a new window]

  		Table II. Effects of ONO–1714 treatment on the incidences and multiplicities of pancreatic lesions induced by BOPa

 


Figure 3
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3. Effects of ONO-1714 treatment on the sizes of pancreatic cancers. The numbers of each size of pancreatic cancers per hamster are given for the BOP + 0 p.p.m. ONO-1714 (black bars), BOP + 100 p.p.m. ONO-1714 (gray bars) and BOP + 200 p.p.m. ONO-1714 (white bars) groups (mean ± standard error values). * and ** Significantly different from the respective controls at P < 0.05 and P < 0.01, respectively. The percentage of the BOP + basal diet control value is shown in each column.

 
In addition to pancreatic ductal tumors, tumors of the bile duct, liver, lungs and kidneys have been reported to be induced by BOP in hamsters (18). In the present study, hepatocellular and cholangiocellular tumors were observed in the BOP-treated group at incidences of 12 and 50%, respectively (Table III). The cholangiocellular tumors developed in both intra- and extrahepatic bile ducts. The incidences of hepatocellular and cholangiocellular tumors were not significantly changed by ONO-1714 administration, but the multiplicity of cholangiocellular tumors was significantly decreased by 200 p.p.m. ONO-1714 treatment compared with the controls (0.38 ± 0.66 versus 1.14 ± 1.57 at P < 0.005) (Table III).


View this table:
[in this window]
[in a new window]

  		Table III. Effects of ONO–1714 treatment on the incidences and multiplicities of liver and bile duct tumors induced by BOPa

 
In contrast, the incidences and multiplicities of lung tumors were statistically increased by 100 p.p.m. ONO-1714 [33/42 (79%) at P < 0.05 and 1.60 ± 1.29 at P < 0.05, respectively] and slightly but not significantly by 200 p.p.m. ONO-1714 [26/42 (62%) and 1.26 ± 1.33, respectively] compared with the control group [21/42 (50%) and 0.98 ± 1.42, respectively]. A renal mesenchymal tumor and a hemangioma were observed in the BOP + basal diet group, an angiosarcoma in the BOP + 100 p.p.m. ONO-1714 group and a nephroblastoma in the BOP + 200 p.p.m. ONO-1714 group, but their incidences were not significant. Tumors in the pancreatic duct, bile duct, liver, lungs and kidneys were not observed in the saline vehicle (n = 15) or 100 p.p.m. and 200 p.p.m. ONO-1714 group hamsters without the BOP treatment (n = 15, each).


   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
Funding
 References
 
The present study demonstrated that iNOS is expressed in pancreatic cancer cells and that the iNOS inhibitor, ONO-1714, can effectively suppress the development of atypical hyperplasia and cancer, especially invasive cancers, in the hamster pancreas after treatment with BOP. The results indicated that iNOS plays important roles in the development of preneoplastic lesions at an early stage of pancreatic carcinogenesis and also in cancer invasion and expansion in later stages.

In our previous study of colon carcinogenesis, ONO-1714 suppressed the development of rat colon tumors >3 mm in diameter (16), in line with the present findings. It has been reported that angiogenesis is necessary to supply oxygen and nutrients to solid tumors >1–2 mm3 in size (28). NO enhances vascular permeability, partly through activation of matrix metalloproteinases (29), suggesting that suppression of the development of large tumors in ONO-1714-treated groups may be associated with inhibition of angiogenesis by the iNOS inhibitor.

Expression of iNOS has been detected in more than half of human pancreatic cancers (7–9). Here, iNOS expression was observed in most of the hamster pancreatic cancers and atypical hyperplasia. In the BOP-induced pancreatic ductal carcinogenesis model in hamsters, G to A transitions at the second base of the codon 12 of the K-ras gene have been shown to be quite frequent in pancreatic cancers and even in preneoplastic lesions at lower frequency (30). Our previous study revealed that iNOS expression can be markedly elevated by transfection of K-ras mutant cDNA into IEC-6 rat intestinal epithelial cells in the presence of IL-1β or lipopolysaccharide through the activation of promoters on nuclear factor {kappa}B, C/EBP and CRE-like sites and that growth of tumors formed in nude mice by subcutaneous injection of the K-ras mutant-transfected cells can be suppressed by feeding diets containing NOS inhibitors (15). It is feasible that iNOS expression in pancreatic cancers could also be associated with K-ras activation. Indeed, human pancreatic cancers frequently harbor K-ras mutations (21,31–33) and other cancers with frequent K-ras mutations, such as colon (32,33), lung (33) and intrahepatic bile duct carcinomas (34), also show increased iNOS expression (35–37). Thus, NO produced by iNOS may be generally involved in tumor development by activated K-ras, and iNOS-selective inhibitors should be considered as possible candidates for the prevention of all cancers featuring K-ras activation.

K-ras mutations are observed from early stages of carcinogenesis in the pancreas, colon, lungs (30,33) and intrahepatic bile ducts (38). Our previous studies in the azoxymethane-induced rat colon carcinogenesis model showed frequent K-ras-activating mutations in hyperplastic aberrant crypt foci (39) and suppression of aberrant crypt focus development by the iNOS inhibitor ONO-1714 (16). The present study also showed iNOS expression in precancerous lesions and suppression of the development of atypical hyperplasia in the pancreas of hamsters by an iNOS inhibitor. It can thus be concluded that K-ras-enhanced iNOS expression may contribute to the development of early precancerous lesions.

It has been reported that IL-1β induces iNOS expression in pancreatic β-cells (40), and overproduction of NO causes dysfunction and destruction of β-cells (41). In the present study, iNOS expression in pancreatic islets surrounded by cancer-associated inflammation was observed. Epidemiological studies have reported that diabetes mellitus is also a risk factor for pancreatic cancer (3). Therefore, increased expression of iNOS in pancreatic islets may also be involved in pancreatic carcinogenesis and iNOS inhibitors might also be protective against autoimmune diabetes.

In the present study, the iNOS inhibitor ONO-1714 significantly suppressed the development of pancreatic cancer and cholangiocellular tumors, but not of lung tumors. Pancreatic ductal adenocarcinomas and cholangiocellular tumors in BOP-treated hamsters have certain genetic characteristics in common; for example, K-ras mutations and aberrant transcription of the fragile histidine triad gene were observed in both (19,20,38,42). Expression of iNOS was also observed in cholangiocellular tumors obtained in the present study (data not shown). It could be speculated that the influence of the iNOS inhibitor might be similar for the two types of carcinoma, one arising from ducts in the pancreas and the other from bile ducts. In contrast, treatment with 100 p.p.m. but not 200 p.p.m. ONO-1714 rather enhanced development of lung tumors. It has been reported that several NOS inhibitors are chemopreventive in the rat tracheal epithelial cell transformation system (43). Reduction in lung tumor development in iNOS(–/–) mice has also been reported (44), suggesting that iNOS expression is associated with lung tumorigenesis. However, endothelial NOS and neuronal NOS are also expressed in lung tumors and high total expression levels of the three NOS types have been suggested to be a favorable prognostic sign (45). Thus, it appears that data on roles of NO in lung tumorigenesis are contradictory and the promotive effect of iNOS is not yet conclusive. Interestingly, other chemopreventive agents reported, such as 4-phenylbutyl isothiocyanate (46), phenethyl isothiocyanate (47) and a cyclooxygenase inhibitor, nimesulide (48) suppressed pancreatic cancers and lung tumors, but enhanced (46) or did not affect (47,48) liver tumorigenesis in BOP-treated hamsters. Thus, it can be presumed that the inhibitory mechanisms of these agents on pancreatic cancer may be different from that of ONO-1714. Our previous study on the prevention of hamster pancreatic carcinogenesis by a peroxisome proliferator-activated receptor {gamma} ligand, pioglitazone, also showed significant suppression of the development of pancreatic ductal adenocarcinomas and cholangiocellular tumors, but not of lung adenomas (26). It is known that peroxisome proliferator-activated receptor {gamma} activation inhibits cytokine-mediated iNOS expression (49,50), indicating that inhibitory mechanisms of ONO-1714 and pioglitazone on hamster pancreatic carcinogenesis could be shared, at least in part.

In conclusion, the present study demonstrated probable involvement of iNOS expression in hamster pancreatic ductal carcinogenesis, and suppression of development of pancreatic atypical hyperplasia and invasive adenocarcinomas by treatment with an iNOS inhibitor. Thus, it is proposed that iNOS inhibitors might be promising chemopreventive agents against pancreatic cancer.


   Funding
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
References
 
Grants-in-Aid for Cancer Research (18-5,19-2); Third-Term Comprehensive 10-Year Strategy for Cancer Control (H19-013) from the Ministry of Health, Labour and Welfare of Japan.


   Acknowledgments
 
We thank Ms Ayami Etoh and Mr Naoaki Uchiya for expert technical assistance. T.Kitahashi was the awardee of Research Resident Fellowship from the Foundation for Promotion of Cancer Research (Japan) for the Third-Term Comprehensive 10 Year Strategy for Cancer Control during the performance of this study.

Conflict of Interest Statement: None declared.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 

  1. Parkin DM, et al. Estimating the world cancer burden: Globocan 2000. Int. J. Cancer (2001) 94:153–156.[CrossRef][Web of Science][Medline]
  2. Farrow B, et al. Inflammation and the development of pancreatic cancer. Surg. Oncol. (2002) 10:153–169.[CrossRef][Web of Science][Medline]
  3. Michaud DS. Epidemiology of pancreatic cancer. Minerva. Chir. (2004) 59:99–111.[Medline]
  4. Otsuki M, et al. 4. Chronic pancreatitis and pancreatic cancer, lifestyle-related diseases. Intern. Med. (2007) 46:109–113.[CrossRef][Medline]
  5. Kemppainen E, et al. Non-alcoholic etiologies of acute pancreatitis—exclusion of other etiologic factors besides alcohol and gallstones. Pancreatology (2007) 7:142–146.[CrossRef][Web of Science][Medline]
  6. Hussain SP, et al. Inflammation and cancer: an ancient link with novel potentials. Int. J. Cancer (2007) 121:2373–2380.[CrossRef][Web of Science][Medline]
  7. Vickers SM, et al. Association of increased immunostaining for inducible nitric oxide synthase and nitrotyrosine with fibroblast growth factor transformation in pancreatic cancer. Arch. Surg. (1999) 134:245–251.[Abstract/Free Full Text]
  8. Kong G, et al. Inducible nitric oxide synthase (iNOS) immunoreactivity and its relationship to cell proliferation, apoptosis, angiogenesis, clinicopathologic characteristics, and patient survival in pancreatic cancer. Int. J. Pancreatol. (2001) 29:133–140.[Web of Science][Medline]
  9. Kong G, et al. Role of cyclooxygenase-2 and inducible nitric oxide synthase in pancreatic cancer. J. Gastroenterol. Hepatol. (2002) 17:914–921.[CrossRef][Web of Science][Medline]
  10. Al-Mufti RA, et al. Increased nitric oxide activity in a rat model of acute pancreatitis. Gut (1998) 43:564–570.[Abstract/Free Full Text]
  11. Mikawa K, et al. ONO-1714, a new inducible nitric oxide synthase inhibitor, attenuates diaphragmatic dysfunction associated with cerulein-induced pancreatitis in rats. Crit. Care Med. (2001) 29:1215–1221.[CrossRef][Web of Science][Medline]
  12. Sandstrom P, et al. Highly selective inhibition of inducible nitric oxide synthase ameliorates experimental acute pancreatitis. Pancreas (2005) 30:e10–e15.[Web of Science][Medline]
  13. Naka M, et al. A potent inhibitor of inducible nitric oxide synthase, ONO-1714, a cyclic amidine derivative. Biochem. Biophys. Res. Commun. (2000) 270:663–667.[CrossRef][Web of Science][Medline]
  14. Hayashi Y, et al. Comparison of effects of nitric oxide synthase (NOS) inhibitors on plasma nitrite/nitrate levels and tissue NOS activity in septic organs. Microbiol. Immunol. (2005) 49:139–147.[Web of Science][Medline]
  15. Takahashi M, et al. Transfection of K-rasAsp12 cDNA markedly elevates IL-1β and lipopolysaccharide-mediated inducible nitric oxide synthase expression in rat intestinal epithelial cells. Oncogene (2003) 22:7667–7676.[CrossRef][Web of Science][Medline]
  16. Takahashi M, et al. Suppressive effect of an inducible nitric oxide inhibitor, ONO-1714, on AOM-induced rat colon carcinogenesis. Nitric Oxide (2006) 14:130–136.[CrossRef][Web of Science][Medline]
  17. Kohno H, et al. A specific nitric oxide synthase inhibitor, ONO-1714 attenuates inflammation-related large bowel carcinogenesis in male Apc(Min/+) mice. Int. J. Cancer (2007) 121:506–513.[CrossRef][Web of Science][Medline]
  18. Pour P, et al. A potent pancreatic carcinogen in Syrian hamsters: N-nitrosobis(2-oxopropyl)amine. J. Natl Cancer Inst. (1977) 58:1449–1453.[Web of Science][Medline]
  19. Fujii H, et al. Pancreatic ductal adenocarcinomas induced in Syrian hamsters by N-nitrosobis(2-oxopropyl)amine contain a c-Ki-ras oncogene with a point-mutated codon 12. Mol. Carcinog. (1991) 3:296–301.[CrossRef][Web of Science]
  20. Tsujiuchi T, et al. Alterations in the Fhit gene in pancreatic duct adenocarcinomas induced by N-nitrosobis(2-oxopropyl)amine in hamsters. Mol. Carcinog. (2003) 36:60–66.[CrossRef][Web of Science][Medline]
  21. Grunewald K, et al. High frequency of Ki-ras codon 12 mutations in pancreatic adenocarcinomas. Int. J. Cancer (1989) 43:1037–1041.[Web of Science][Medline]
  22. Sorio C, et al. The FHIT gene is expressed in pancreatic ductular cells and is altered in pancreatic cancers. Cancer Res. (1999) 59:1308–1314.[Abstract/Free Full Text]
  23. Crowell PL, et al. Cyclooxygenase-2 expression in hamster and human pancreatic neoplasia. Neoplasia (2006) 8:437–445.[CrossRef][Web of Science][Medline]
  24. Saito S, et al. Establishment and characterization of a cultured cell line derived from nitrosamine-induced pancreatic ductal adenocarcinoma in Syrian golden hamsters. Gastroenterol. Jpn. (1988) 23:183–194.[Medline]
  25. Furukawa T, et al. Long-term culture and immortalization of epithelial cells from normal adult human pancreatic ducts transfected by the E6E7 gene of human papilloma virus 16. Am. J. Pathol. (1996) 148:1763–1770.[Abstract]
  26. Takeuchi Y, et al. Suppression of N-nitrosobis(2-oxopropyl)amine-induced pancreatic carcinogenesis in hamsters by pioglitazone, a ligand of peroxisome proliferator-activated receptor gamma. Carcinogenesis (2007) 28:1692–1696.[Abstract/Free Full Text]
  27. Takahashi M, et al. Increased expression of inducible and endothelial constitutive nitric oxide synthases in rat colon tumors induced by azoxymethane. Cancer Res. (1997) 57:1233–1237.[Abstract/Free Full Text]
  28. Folkman J. What is the evidence that tumors are angiogenesis dependent? J. Natl Cancer Inst. (1990) 82:4–6.[Free Full Text]
  29. Wu J, et al. Enhanced vascular permeability in solid tumor involving peroxynitrite and matrix metalloproteinases. Jpn. J. Cancer Res (2001) 92:439–451.[CrossRef][Web of Science]
  30. Cerny WL, et al. K-ras mutation is an early event in pancreatic duct carcinogenesis in the Syrian golden hamster. Cancer Res. (1992) 52:4507–4513.[Abstract/Free Full Text]
  31. Mu DQ, et al. Values of mutations of K-ras oncogene at codon 12 in detection of pancreatic cancer: 15-year experience. World J. Gastroenterol. (2004) 10:471–475.[Medline]
  32. Burmer GC, et al. Frequency and spectrum of c-Ki-ras mutations in human sporadic colon carcinoma, carcinomas arising in ulcerative colitis, and pancreatic adenocarcinoma. Environ. Health Perspect. (1991) 93:27–31.[Web of Science][Medline]
  33. Minamoto T, et al. K-ras mutation: early detection in molecular diagnosis and risk assessment of colorectal, pancreas, and lung cancers—a review. Cancer Detect. Prev. (2000) 24:1–12.[Web of Science][Medline]
  34. Acalovschi M. Cholangiocarcinoma: risk factors, diagnosis and management. Rom. J. Intern. Med. (2004) 42:41–58.[Medline]
  35. Ambs S, et al. Frequent nitric oxide synthase-2 expression in human colon adenomas: implication for tumor angiogenesis and colon cancer progression. Cancer Res. (1998) 58:334–341.[Abstract/Free Full Text]
  36. Liu C-Y, et al. Increased level of exhaled nitric oxide and up-regulation of inducible nitric oxide synthase in patients with primary lung cancer. Br. J. Cancer (1998) 78:534–541.[Web of Science][Medline]
  37. Pinlaor S, et al. Nitrative and oxidative DNA damage in intrahepatic cholangiocarcinoma patients in relation to tumor invasion. World J. Gastroenterol. (2005) 11:4644–4649.[Medline]
  38. Yamanaka S, et al. K-ras gene mutations in intrahepatic bile duct of Syrian golden hamsters. J. Surg. Oncol. (1997) 66:97–103.[CrossRef][Web of Science][Medline]
  39. Takahashi M, et al. Altered expression of β-catenin, inducible nitric oxide synthase and cyclooxygenase-2 in azoxymethane-induced rat colon carcinogenesis. Carcinogenesis (2000) 21:1319–1327.[Abstract/Free Full Text]
  40. Kwon G, et al. Interleukin-1 beta-induced nitric oxide synthase expression by rat pancreatic beta-cells: evidence for the involvement of nuclear factor kappa B in the signaling mechanism. Endocrinology (1995) 136:4790–4795.[Abstract]
  41. McDaniel ML, et al. Cytokines and nitric oxide in islet inflammation and diabetes. Proc. Soc. Exp. Biol. Med. (1996) 211:24–32.[CrossRef][Medline]
  42. Kitahashi T, et al. Aberrant transcription of FHIT gene in intrahepatic cholangiocellular carcinomas induced by N-nitrosobis(2-oxopropyl)amine in hamsters. Exp. Toxicol. Pathol. (2004) 56:153–157.[CrossRef][Web of Science][Medline]
  43. Sharma S, et al. Differential activity of NO synthase inhibitors as chemopreventive agents in a primary rat tracheal epithelial cell transformation system. Neoplasia (2002) 4:332–336.[CrossRef][Web of Science][Medline]
  44. Kisley LR, et al. Genetic ablation of inducible nitric oxide synthase decreases mouse lung tumorigenesis. Cancer Res. (2002) 62:6850–6856.[Abstract/Free Full Text]
  45. Puhakka A, et al. High expression of nitric oxide synthases is a favorable prognostic sign in non-small cell lung carcinoma. APMIS (2003) 111:1137–1146.[CrossRef][Web of Science][Medline]
  46. Son H-Y, et al. Modifying effects of 4-phenylbutyl isothiocyanate on N-nitrosobis(2-oxopropyl)amine-induced tumorigenesis in hamsters. Cancer Lett. (2000) 160:141–147.[CrossRef][Web of Science][Medline]
  47. Nishikawa A, et al. Chemopreventive effects of phenethyl isothiocyanate on lung and pancreatic tumorigenesis in N-nitrosobis(2-oxopropyl)amine-treated hamsters. Carcinogenesis (1996) 17:1381–1384.[Abstract/Free Full Text]
  48. Furukawa F, et al. A cyclooxygenase-2 inhibitor, nimesulide, inhibits postinitiation phase of N-nitrosobis(2-oxopropyl)amine-induced pancreatic carcinogenesis in hamsters. Int. J. Cancer (2003) 104:269–273.[CrossRef][Web of Science][Medline]
  49. Beauregard C, et al. Peroxisome proliferator-activated receptor agonists inhibit interleukin-1beta-mediated nitric oxide production in cultured lacrimal gland acinar cells. J. Ocul. Pharmacol. Ther. (2003) 19:579–587.[CrossRef][Web of Science][Medline]
  50. Crosby MB, et al. A novel PPAR response element in the murine iNOS promoter. Mol. Immunol. (2005) 42:1303–1310.[CrossRef][Web of Science][Medline]
Received April 9, 2008; revised June 5, 2008; accepted June 9, 2008.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
29/8/1608    most recent
bgn152v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Takahashi, M.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, M.
Right arrow Articles by Wakabayashi, K.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?