Skip Navigation


Carcinogenesis Advance Access originally published online on July 16, 2008
Carcinogenesis 2008 29(9):1742-1750; doi:10.1093/carcin/bgn167
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
29/9/1742    most recent
bgn167v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chan, D. W.
Right arrow Articles by Ngan, H. Y.S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, D. W.
Right arrow Articles by Ngan, H. Y.S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Loss of MKP3 mediated by oxidative stress enhances tumorigenicity and chemoresistance of ovarian cancer cells

David W. Chan1, Vincent W.S. Liu1, George S.W. Tsao2, Kwok-Ming Yao3, Toru Furukawa4, Karen K.L. Chan1 and Hextan Y.S. Ngan1,*

1 Department of Obstetrics and Gynecology
2 Department of Anatomy, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Hong Kong SAR, People’s Republic of China
3 Department of Biochemistry, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Hong Kong SAR, People’s Republic of China
4 International Research and Educational Institute for Integrated Medical Sciences, Tokyo Women’s Medical University, Tokyo, Japan

* To whom correspondence should be addressed. Department of Obstetrics and Gynecology, 6/F Professorial Block, Queen Mary Hospital, Pokfulam, Hong Kong, People’s Republic of China. Tel: +852 2855 4518; Fax: +852 2855 0947; Email: hysngan{at}hkucc.hku.hk


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
The RAS-RAF-MEK-extracellular signal-regulated kinase (ERK) pathway plays a pivotal role in various cellular responses, including cellular growth, differentiation, survival and motility. Constitutive activation of the ERK pathway has been linked to the development and progression of human cancers. Here, we reported that mitogen-activated protein kinase phosphatase (MKP)-3, a negative regulator of ERK1/2, lost its expression particularly in the protein level, was significantly correlated with high ERK1/2 activity in primary human ovarian cancer cells using quantitative reverse transcription–polymerase chain reaction and western blot analyses. Intriguingly, the loss of MKP3 protein was associated with ubiquitination/proteosome degradation mediated by high intracellular reactive oxygen species (ROS) accumulation such as hydrogen peroxide in ovarian cancer cells. Functionally, short hairpin RNA knock down of endogenous MKP3 resulted in increased ERK1/2 activity, cell proliferation rate, anchorage-independent growth ability and resistance to cisplatin in ovarian cancer cells. Conversely, enforced expression of MKP3 in MKP3-deficient ovarian cancer cells significantly reduced ERK1/2 activity and inhibited cell proliferation, anchorage-independent growth ability and tumor development in nude mice. Furthermore, the enforced expression of MKP3 succeeded to sensitize ovarian cancer cells to cisplatin-induced apoptosis in vitro and in vivo. These results suggest a molecular mechanism by which the accumulation of ROS during ovarian cancer progression may cause the degradation of MKP3, which in turn leads to aberrant ERK1/2 activation and contributes to tumorigenicity and chemoresistance of human ovarian cancer cells.

Abbreviations: ERK, extracellular signal-regulated kinase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; H2O2, hydrogen peroxide; HOSE, human ovarian surface epithelial; MKP, mitogen-activated protein kinase phosphatase; mRNA, messenger RNA; NAC, N-acetyl-L-cysteine; ROS, reactive oxygen species


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
The extracellular signal-regulated kinase (ERK)-signaling pathway plays a crucial role in various cellular responses including cell proliferation, growth, differentiation and survival by relaying extracellular signals from ligand-bound cell surface tyrosine kinase receptors to gene transcription in nucleus via a cascade of specific phosphorylation events (1). Aberrant activation of this pathway due to increased exposure to growth factors, overexpression or mutation of receptor tyrosine kinases, Ras and Raf, has been implicated in many aspects of tumorigenesis including proliferation, differentiation, invasion, angiogenesis and apoptosis (2,3). Recent studies have identified several negative regulators such as mitogen-activated protein kinase phosphatases (MKPs), Spred and Sef that can modulate duration, magnitude and subcellular compartmentalization of ERK1/2 activity, suggesting that these inhibitor proteins also play important roles in tumorigenesis (4–6). In ovarian cancer, constitutive activation of ERK activity has been associated with high tumorigenicity and chemoresistance (7,8). Therefore, the ERK pathway is a crucial target for therapeutic intervention in ovarian cancer.

MKP3 is a member of the subfamily of protein tyrosine phosphatases known as dual-specificity phosphatases (MKPs) (9,10). Biochemical and structural studies have shown that MKP3 is capable of dephosphorylating ERK1/2 by protein–protein interactions via mitogen-activated protein kinase interaction motif within the N-terminal ERK1/2-binding domain (11). Moreover, MKP3 negatively modulates ERK1/2 but not p38 and c-jun N-terminal kinase activities (12,13). Recent studies have shown that MKP3 is underexpressed in pancreatic cancer due to promoter hypermethylation and frequent loss of heterozygosity (14,15). Overexpression of MKP3 has shown to have apparent tumor-suppressive effects through reduction of phosphorylated ERK1/2 in a dose-dependent manner in pancreatic cancer cells (16,17). However, there is lack of similar reports in other human cancers so far.

In the present study, we analyzed the expression levels of MKP3 ovarian cancer samples and cell lines. We provide here the mechanistic correlation between oxidative stress and ubiquitination/proteosome degradation of MKP3 protein in ovarian cancer cells. Functional analyses employing MKP3 knockdown and ectopically overexpression revealed the role of MKP3 in negatively regulating ERK1/2 activity and inhibiting tumorigenicity and chemoresistance in vitro and in vivo.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 Supplementary material
 Funding
 References
 
Clinical samples and cell lines
Seventy-seven tissue samples of surgically resected primary ovarian cancer and 41 normal ovary samples from women who had surgery for benign diseases such as uterine fibroids were randomly selected for this study. All the clinical specimens used in the present study were approved by the local institutional ethics committee (UW 05-143 T/806). Six immortalized human ovarian surface epithelial (HOSE) cells, HOSE 6-3, HOSE 10-2, HOSE 11-12, HOSE 17-1, HOSE 20-3 and HOSE 21-3, and ovarian cancer cell lines, OV2008, C13*, A2780s, A2780cp, DOV13-5, OVCAR3, SKOV3, OV420, OV429 and OV433 (American Type Culture Collection, Rockville, MD), were used in this study.

Plasmids and RNA interference
The MKP3-expressing construct, pcDNA3.1/V5-His-DUSP6/MKP3, and the HA-tagged ubiquitin-expressing construct, pcDNA-HA(Ub)8, have been used previously (16,18). The MKP3 mutant-expressing construct, pcDNA3.1/V5-His-DUSP6/mut-MKP3, was generated by creating point mutations at serines 159 and 197. The short hairpin RNA interference targeting MKP3 (target sequence: TACACGAGCCGTCTAGATTGG) was ligated into pcDNATM6.2-GW/EMGFP-miR plasmid (Invitrogen Life Technology, Carlsbad, CA). Three synthetic small interfering RNAs specific for human MKP3 were provided and synthesized by Ambion (Ambion K.K., Tokyo, Japan).

Quantitative and semiquantitative reverse transcription–polymerase chain reaction
Total RNA from each cell line was prepared by TRIzol reagent (Invitrogen Life Technology). First-strand complementary DNA was synthesized by random hexamers and Taqman reverse transcription reagent kit (Applied Biosystems, Foster city, CA). For real-time quantitative reverse transcription–polymerase chain reaction, the amount of MKP3 messenger RNA (mRNA) was quantified by TaqMan Gene Expression Assays and in an ABI 7700 system (Applied Biosystems). The MKP3 primers and probe were obtained from Applied Biosystems (Assay ID: Hs00169257_m1). Each sample was performed in triplicate and normalized with human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Assay ID: Hs99999905_m1; Applied Biosystem). For semiquantitative reverse transcription–polymerase chain reaction, the MKP3 mRNA level was evaluated by a pair of primers—MKP3-sense 5'-CTACCTGGAAGGTGGCTTCA-3' and MKP3-antisense 5'-GTTGGACAGCGGACTACCAT-3'—with the following conditions for 30 cycles: denaturation at 94°C for 20 s, annealing at 54°C for 20 s and extension at 72°C for 20 s. The relative amount of MKP3 was normalized using GAPDH mRNA with the following primers: GAPDH-sense—5'-ACGCATTTGGTCGTATTGGG-3' and GAPDH-antisense—5'-TGATTTTGGAGGGATCTCGC-3' and amplification at 25 cycles: denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 1 min.

Western blot analysis
Harvested cells were lysed by Cell Lysis Buffer (Cell Signaling Technology, Beverly, MA) supplemented with Protease Inhibitor Cocktail (Sigma Chemical Co., St Louis, MO). For western blot analyses, samples containing equal amounts of protein were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and electroblotted onto Immobilon-P Transfer Membrane (Millipore Corporation, Bedford, MA). Blots were blocked with 5% skim milk, followed by incubation with antibodies specific for anti-phospho p44/42 ERK1/2 (Thr202/Tyr204, Cell Signaling Technology), anti-ERK1/2 (Chemicon International, Temecula, CA), anti-MKP3 (C-20, Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-actin (AC-74, Sigma Chemical Co), anti-HA (12CA5, Roche Diagnostics Corp, Indianapolis, IN) and anti-V5 (Invitrogen), respectively. Blots were then incubated with goat anti-rabbit or anti-mouse secondary antibody conjugated to horseradish peroxidase (Amersham Pharmacia, Cleveland, OH) accordingly.

In vivo ubiquitination assay
This assay was done as described by Chan et al. (18). Briefly, A2780cp cells were seeded onto 100 mm culture plates. The plasmids, pcDNA3.1/V5-His-DUSP6/MKP3 and pcDNA-HA(Ub)8, were cotransfected into A2780cp cells, respectively, using FuGENETM 6 transfection kit (Roche Diagnostics Corp). Cells were then harvested in NET lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl and 5 mM ethylenediaminetetraacetic acid) with 1% NP40, pH 8.0, 0.1 mM phenylmethylsulfonyl fluoride and 1 mM Complete TM protease inhibitor cocktail (Roche). One milligram of cell lysate was incubated with 1 µg of mouse anti-IgG and anti-V5 antibodies at 4°C. After incubation, 40 µl of Protein A/G Plus-Agarose beads (Santa Cruz Biotechnology) was added to each sample and the mixture was rotated overnight at 4°C. After centrifugation, the beads were washed four times with NET lysis buffer, followed by addition of 30 µl of 2x sample buffer containing β-mercaptoethanol and boiled for 10 min prior to electrophoresis. The proteasome inhibitor, MG132, was obtained from Calbiochem (La Jolla, CA).

Determination of cellular hydrogen peroxide
To evaluate the production of cellular hydrogen peroxide (H2O2), cells were seeded in 96-well plates and cultured in serum-free medium for 2 days. Intracellular generation of H2O2 from these cells was detected by using fluorogenic substrate 2',7'-dichlorodihydrofluorescein (DCF) diacetate (H2DCFDA, Calbiochem) and measured by a Tecan optical-fluorescence Plate Reader (485–530 nm, Tecan Group Ltd, Männedorf, Switzerland) (19). The readings were normalized by cell numbers detected by Cell Proliferation Kit II (XTT) (Roche Diagnostics, Mannheim, Germany). This assay was performed in at least three independent experiments. The antioxidant, N-acetyl-L-cysteine (NAC), was used for the removal of intracellular reactive oxygen species (ROS) (Calbiochem).

Cell viability analysis
Cell viability was measured by Cell Proliferation Kit II (XTT) according to the manufacturer’s instructions (Roche). The experiment was performed in triplicate for each time point. Cisplatin (CDDP) and mitogen-activated protein kinase/ERK kinase 1/2 (MEK1/2) inhibitor PD98059 were obtained from Calbiochem.

Anchorage-independent growth assay in soft agar
A total of 5 x 103 cells were trypsinized and suspended in 2 ml of full medium plus 0.3% agar (Sigma). The agar–cell mixture was plated on top of a bottom layer with 1% full medium agar mixture. The experiment was performed in triplicate for each cell line. After 10–20 days, viable colonies of 20 cells or more were scored.

In vivo tumorigenicity assay
This assay was done as described by Chan et al. (20). To investigate the cisplatin resistance of MKP3 stably transfected A2780cp cells in vivo, 5 mg/body wt (kg)/day of cisplatin (CDDP) (EBEWE Pharma Unterach, Austria) was administered intraperitoneally once for every 6 days with total of three injections into five nude mice when the size of every tumor became ~3 mm in diameter. As a control group, physiological saline alone was used. All the animal experiments were approved by the University of Hong Kong Committee on the Use of Live Animals in Teaching and Research (CULATR No.1391-06).

Statistical analysis
Student’s t-test (for parametric data) and the Mann–Whitney test (for non-parametric data) were used. A P-value was considered significant when <0.05.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 Supplementary material
 Funding
 References
 
MKP3 is underexpressed in ovarian cancer
Real-time quantitative reverse transcription–polymerase chain reaction analysis showed that SKOV3, OVCA429, OVCA433 and A2780cp expressed relatively lower levels of MKP3 mRNA (~2- to 10-fold reductions) as compared with HOSE cell lines (Figure 1A). But western blot analysis revealed that more ovarian cancer cell lines (OVCAR3, SKOV3, OVCA420, OVCA429, OVCA433, A2780cp and DOV13-5) expressed undetectable or lower MKP3 protein level (Figure 1B). Intriguingly, four cell lines (OVCAR3, OVCA420, OVCA433 and DOV13-5) expressed much lower MKP3 protein levels than their corresponding MKP3 mRNA expression levels (Figure 1A and B). This scenario was much obvious in human ovarian cancer samples. No significant difference was observed in the amount of MKP3 mRNA between normal ovarian and cancer samples (Figure 1C). However, 40% of ovarian cancer samples showed downregulation of MKP3 protein expression levels when compared with normal ovarian samples (selected samples showed on Figure 1D). These findings suggest that the loss of MKP3 protein predominates in ovarian cancer and the discrepancy between mRNA and protein expression levels of MKP3 may be due to a posttranscriptional regulation on MKP3 in ovarian cancer cells.


Figure 1
View larger version (37K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. MKP3 is underexpressed and inversely correlated with high phospho-ERK1/2 levels in ovarian cancer. (A) Real-time quantitative reverse transcription–polymerase chain reaction showing the expression levels of MKP3 in HOSEs (normal immortalized ovarian cell lines) and ovarian cancer cell lines. (B) Western blot analysis showed that MKP3 was underexpressed but was correlated with higher phospho-ERK1/2 levels in ovarian cancer cell lines as compared with HOSEs cell lines. (C) MKP3 mRNA in normal ovarian and cancer tissues determined by real-time quantitative reverse transcription–polymerase chain reaction. Each dot represents the mean of triplicates, and the horizontal line among the dots represents the mean of each group. (D) Semiquantitative reverse transcription–polymerase chain reaction showed no difference of MKP3 mRNA in normal ovarian and cancer samples (upper), but western blot analysis demonstrated that low MKP3 but high phospho-ERK1/2 levels were frequently found in ovarian cancer samples as compared with normal ovarian samples. NO, normal ovarian samples; OVC, ovarian cancer samples.

 
Loss of MKP3 is associated with ubiquitination/proteosome degradation
To confirm the involvement of proteolysis in degrading MKP3 in ovarian cancer cells, we tested various pharmacological inhibitors of the cellular proteolytic system on two cell models A2780s and OV2008 (cisplatin-sensitive ovarian cancer cells) and A2780cp and C13* (cisplatin-resistant variants). Both A2780cp and C13* cell lines had relatively low expression protein levels of MKP3, but only A2780cp cells showed lower MKP3 mRNA (Figure 2A). Upon treatment with MG132 at different doses (0, 5 and 10 µM) for 24 h, MKP3 expression was significantly restored in C13* and A2780cp cells in a dose-dependent manner (Figure 2B), suggesting MKP3 protein may be degraded by ubiquitination/proteosome pathway.


Figure 2
View larger version (51K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. Intracellular H2O2 induces MKP3 degradation through ubiquitination/proteasome pathway. (A) Upper, real-time quantitative reverse transcription–polymerase chain reaction (left) and semiquantitative reverse transcription–polymerase chain reaction (right) analyses demonstrated that only A2780cp cell line showed low MKP3 mRNA expression level but western blot analysis (right) showed that both cisplatin resistant (A2780cp and C13*) had relative low MKP3 protein expression levels compared with their cisplatin-sensitive counterparts (A2780s and OV2008). Lower, high intracellular H2O2 levels in cisplatin-resistant (A2780cp and C13*) ovarian cancer cell lines were detected by using fluorogenic substrate 2',7'-DCF diacetate and Tecan optical-fluorescence Plate Reader. The relative intracellular H2O2 content was calculated by normalized readings of excitation (485 nm) and emission (530 nm) with XTT reading of each well. *P = 0.01; **P = 0.001. (B) MKP3 protein was restored in A2780cp and C13* ovarian cancer cells by MG132 in a dose-dependent manner (0, 5 and 10 µM) for 24 h. (C) The MKP3 protein in both OV2008 and A2780s was degraded by H2O2 in a dose-dependent manner. (D) The ubiquitination/degradation of MKP3 in both A2780cp and C13* ovarian cancer cells was inhibited by an antioxidant, NAC, in a dose-dependent manner (0, 20 and 40 mM) and was further suppressed when cotreatment with MG132 (10 µM) for 24 h. (E) In vivo ubiquitination assay showed that MKP3 was degraded in HEK293T (left) and A2780cp (right) cell models. HEK293T and A2780cp cells were transfected with pcDNA3.1/V5-His-DUSP6/MKP-3 and pcDNA-HA(Ub)8 plasmids. Both MG132 and H2O2 were used to enhance the amount of polyubiquitinated MKP3 protein products ((Ub)n-V5/MKP3). Cell lysates were incubated with anti-V5, and the immunoprecipitates were probed with anti-HA. The positions of polyubiquitinated MKP3 protein ((Ub)n-V5/MKP3) are indicated. The same membrane was reprobed with anti-V5 to detect the expression of V5/MKP3.

 
Intracellular H2O2 induces MKP3 ubiquitination/proteosome degradation
It has been shown that accumulation of ROS induces protein ubiquitination/proteasome degradation (21,22). By measuring the intracellular H2O2 using flurogenic substrate, H2DCFDA, we found that both MKP3-deficient cell lines, A2780cp and C13*, had higher intracellular H2O2 content than their counterparts (A2780cp, *P = 0.01 and C13*, **P = 0.001) (Figure 2A). Upon treatment of H2O2 on OV2008 and A2780s cells with different concentrations (0.1, 0.3, 0.5, 1.0, 3.0, 5.0 and 10.0 mM) for 6 h, the endogenous MKP3 was remarkably diminished in a dose-dependent manner at 1.0 and 3.0 mM of H2O2 in OV2008 and A2780s cells, respectively (Figure 2C). On the contrary, the degradation of MKP3 in both A2780cp and C13* ovarian cancer cells was significantly inhibited by an antioxidant, NAC, in a dose-dependent manner and was further enhanced when cotreatment with MG132 (10 µM) (Figure 2D). However, unchanged levels of MKP3 mRNA were observed (data not shown). The restoration of MKP3 by treatment of NAC was further confirmed by in vivo ubiquitination assay using A2780cp cell model (supplementary Figure S1 is available at Carcinogenesis Online).

To further ascertain the role of H2O2 in promoting MKP3 proteosome-mediated proteolysis, we performed the in vivo ubiquitination assay in HEK293T and A2780cp cells. Western blot analysis showed that the levels of ubiquitinated MKP3 were increased when treated with MG132 (Figure 2E). Such ubiquitinated MKP3 protein levels were further enhanced when treated by H2O2 (1 mM) and/or MG132 (Figure 2E). However, high concentration of H2O2 (10 mM) could not degrade MKP3 via ubiquitination/proteosome pathway but lead to extensive degradation via oxidative breakage on MKP3 protein (23) (Figure 2E). To test whether phosphorylation of MKP3 is the possible mechanism leading to proteasomal degradation of MKP3, the mut-MKP3-expressing plasmid (point mutations at serines 159 and 197 MKP3 phosphorylation sites) was transfected into HEK293T cells and treated with H2O2. Western blot analysis showed that both MKP3 and mut-MKP3 proteins were still degraded by H2O2 treatment. However, the reduced level of mut-MKP3 was much less as compared with MKP3 (supplementary Figure S2 is available at Carcinogenesis Online). In vivo ubiquitination assay also revealed that the level of ubiquitinated mut-MKP3 was obviously reduced compared with ubiquitinated MKP3 under treatment of H2O2 and/or MG132 (supplementary Figure S3 is available at Carcinogenesis Online). This indicates that the phosphorylation of MKP3 is associated with proteasomal degradation of MKP3. Taken together, these findings suggest that the loss of MKP3 is due to ROS-mediated degradation via the proteasome/ubiquitination pathway in ovarian cancer cells and phosphorylation of MKP3 is the possible mechanism leads to ubiquitination/degradation.

MKP3 is a negative regulator to ERK1/2 in ovarian cancer cells
Previous studies have demonstrated that MKP3 acts as a negative regulator on ERK1/2-signaling pathway in pancreatic cancer (16,17). In this study, our ovarian cancer cell lines and samples expressed low MKP3 but high phospho-ERK1/2 expression levels (Figure 1B and D). This similar scenario was observed in cisplatin-sensitive ovarian cancer cells (A2780s and OV2008) and vice versa for their cisplatin-resistant variants (A2780cp and C13*) (Figure 3A).


Figure 3
View larger version (37K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3. MKP3 is a negative regulator of ERK1/2 activity in ovarian cancer cells. (A) Low MKP3 but high ERK1/2 activity was found in cisplatin-resistant ovarian cancer cell lines (A2780cp and C13*) as compared with their cisplatin-resistant partners (A2780s and OV2008). (B) Stably knockdown of MKP3 by shMKP3 increased ERK1/2 activity in two A2780s clones (C4 and C6). The pcDNATM6.2-GW/EMGFP-miR-neg plasmid was used as vector control. (C) Knockdown of endogenous MKP3 by small interfering RNA elevated ERK1/2 activity. Two small interfering RNAs (siMKP3#1 and siMKP3#3) and negative control small interfering RNA (NC) were transiently transfected into A2780s and OVCA433 cells. Western blot was used to analyze the expression of MKP3, phospho-ERK1/2 and ERK1/2 after 36 h of transfection. The relative quantity of MKP3 protein was calculated after normalization to β-actin. (D) Left, stable overexpression of V5/MKP3 in remarkably reduced ERK1/2 activity in three transfectants (C7, C13 and C19) of an MKP3-deficient ovarian cancer cell line, A2780cp. The pcDNA3.1 plasmid was used as an empty vector control. Right, transient transfection of MKP3 reduced ERK1/2 activity of SKOV3 ovarian cancer cells.

 
To investigate the regulatory mechanism of MKP3 on ERK1/2 activity, we employed vector-based RNAi (shMKP3) and was successfully depleted >70% endogenous MKP3 in A2780s cells (shMKP3 C4 and shMKP3 C6) (Figure 3B). We also used short interfering RNA (siMKP3#1 and siMKP3#3) to knock down >55 and >62% endogenous MKP3 in A2780s cells and OVCA433 cells, respectively (Figure 3C). As expected, the depletion of MKP3 was associated with the increased phospho-ERK1/2 levels in A2780s cells (Figure 3B and C). Conversely, ectopic expression of V5-tagged MKP3 (V5/MKP3) in A2780cp (C7, C13 and C19) and SKOV3 cells remarkably reduced the expression levels of phospho-ERK1/2 (Figure 3D). These data suggest that MKP3 negatively regulates ERK1/2 activity in ovarian cancer cells.

MKP3 inhibits tumorigenicity of ovarian cancer cells
Constitutive activation of ERK1/2 pathway has been shown to be associated with tumorigenicity in many cancers (24). To determine the involvement of MKP3 in suppressing the tumorigenicity of ovarian cancer, we assessed both cell proliferation rate and anchorage-independent growth ability of MKP3-deficient ovarian cancer cell lines, C13* and A2780cp. With XTT assay, both cisplatin-resistant cell lines, C13* and A2780cp, showed higher cell proliferation rate (Figure 4A). Besides, A2780cp cells showed higher anchorage-independent growth ability by soft agar assay (Figure 4B).


Figure 4
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4. Higher tumorigenicity in cisplatin-resistant ovarian cancer cells. (A) XTT cell proliferation assay showed cisplatin resistant (A2780cp and C13*) with high phospho-ERK1/2 had faster cell proliferation rate compared with cisplatin-sensitive (A2780s and OV2008) ovarian cancer cells. *P = 0.025 and **P = 0.005. (B) The soft agar assay showed that A2780s and A2780cp had anchorage-independent growth ability. The A2780cp had higher anchorage-independent growth ability as compared with A2780s cells. *P < 0.001.

 
On the other hand, depletion of MKP3 significantly increased cell proliferation rate and anchorage-independent growth ability in A2780s cells (shMKP3 C4 and shMKP3 C6) (Figure 5A). On the contrary, enforced MKP3 expression in A2780cp cells (C13 and C19) showed significant inhibition of cell proliferation and anchorage-independent growth ability (Figure 5B).


Figure 5
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5. The expression levels of MKP3 determinate the tumorigenicity of ovarian cancer cells. (A) Left, XTT cell proliferation assay showed the knockdown of MKP3 in A2780s ovarian cancer cells (shMKP3 C4 and shMKP3 C6), increased cell proliferation rate as compared with their vector control. *P < 0.001. Right, the soft agar assay showed that knockdown of MKP3 in A2780s cells (shMKP3 C4 and shMKP3 C6) had higher anchorage-independent growth ability as compared with vector control. *P < 0.01. (B) Left, XTT cell proliferation assay showed overexpression of MKP3 in A2780cp cells (C13 and C19) had reduction in cell proliferation rate as compared with vector control. *P < 0.01. Right, the soft agar assay showed both MKP3 transfectants (C13 and C19) showed reduction of anchorage-independent growth ability as compared with vector control. *P < 0.001. (C) Tumor formation assay in nude mice. Two MKP3 transfectants (C13 and C19) and vector control cells were inoculated subcutaneously into nude mice. Tumor formation in each nude mouse was monitored every 2 days for 26 days. The tumor size was calculated and depicted as mean tumor volume ± SE of five mice for each group. Both MKP3 transfectants (C13 and C19) had significant tumor growth rate (*P < 0.05 and **P < 0.005, respectively) as compared with vector control group.

 
To further examine whether MKP3 could suppress in vivo tumorigenic activity of ovarian cancer cells, two MKP3 transfectants (C13 and C19) and the vector control of A2780cp cells were inoculated into nude mice. The tumor growth rates for both MKP3 transfectants (C13 and C19) were ~2-fold slower compared with the vector control (Figure 5C). This could be confirmed by their tumor sizes on day 26 that the tumor size of vector control was 2111 ± 296 mm3, whereas C13 and C19 were 538 ± 79 mm3 and 836 ± 93 mm3, respectively (P < 0.005 for C13 and P < 0.05 for C19) (Figure 5C). These data highlight the inhibitory functions of MKP3 on tumorigenicity in vitro and in vivo.

MKP3 reduces cisplatin resistance of ovarian cancer cells
It has been demonstrated that high ERK1/2 activity contributes to cisplatin resistance of ovarian cancer cells (25). Two pairs of cell models including cisplatin-sensitive ovarian cancer cell lines (A2780s and OV2008) and their cisplatin-resistant counterparts (A2780cp and C13*) were examined (26). Upon treatment with cisplatin (0, 5 and 10 µM) for 24 h, both cisplatin-sensitive cell lines, A2780s and OV2008, showed >2-fold reduction of cell viability when compared with their cisplatin-resistant counterparts (Figure 6A). Previous studies have demonstrated that pretreatment of cisplatin-resistant ovarian cancer cells with MEK1/2 inhibitor, PD98059, may sensitize cells to cisplatin-induced apoptosis (8). Consistent with this finding, we found that treatment of PD98059 (20 µM) could moderately sensitize both cisplatin-resistant cell lines, A2780cp and C13*, to cisplatin-induced apoptosis by 0.4- to 1-fold (Figure 6B).


Figure 6
View larger version (35K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 6. The expression levels of MKP3 control cisplatin resistance of ovarian cancer cells. (A) Cisplatin-sensitive (A2780s and OV2008) and cisplatin-resistant counterparts (A2780cp and C13*) were treated with different concentration of cisplatin (5 and 10 µM) for 24 h. (B) Pretreatment of cisplatin-resistant cell lines, A2780cp and C13*, by PD98059 (20 µM) for 3 h significantly reduced cell viability under treatment of cisplatin (5 and 10 µM). *P = 0.005 and **P < 0.001. (C) Knockdown of MKP3 in A2780s ovarian cancer cells (shMKP3 C4 and shMKP3 C6) significantly enhanced cisplatin resistance. *P < 0.005. (D) MKP3 transfectants of A2780cp were treated by cisplatin with similar condition. Both C13 and C19 MKP3 transfectants with relatively high level of V5/MKP3 showed significant increased sensitivity to cisplatin treatment for A2780cp cells. *P < 0.001. The percentage of cell viability was analyzed by XTT proliferation assay. (E) The cisplatin resistance of MKP3 stably transfected A2780cp cells in vivo. Left, the vector control and Right, C19 MKP3 transfectant, of A2780cp cells were investigated the cisplatin resistance in nude mice. Mice were divided into two groups of five and treated with either saline as control or cisplatin (5 mg/kg CDDP). Arrows represent the injection. The relative tumor size was calculated relative to those of the first day of treatment (day 0) and represented as relative mean size (%) ± SE for each group. *P < 0.05, significantly different from saline control group.

 
On the contrary, under the same condition of cisplatin treatment, knockdown of MKP3 in A2780s cells (shMKP3 C4 and shMKP3 C6) significantly enhanced cisplatin resistance (Figure 6C), whereas enforced expression of MKP3 in A2780cp (C13 and C19) showed significant reduction of cisplatin resistance by 1- to 2.5-fold when compared with their vector controls (Figure 6D).

Next, we examined whether the above functions of MKP3 were associated with in vivo tumor growth in nude mice. We found that there were no differences in relative tumor sizes among any of the cisplatin treated or saline treated for the vector control groups (Figure 6E). However, for mice injected with MKP3 stably transfected A2780cp cells (C19), the relative tumor growth rate for cisplatin-treated group was significantly lower than that of saline-treated group (Figure 6E).


   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
Supplementary material
 Funding
 References
 
In the present study, we have shown that the loss of MKP3 protein predominated in ovarian cancer and was inversely correlated with the ERK1/2 activity. Loss of MKP3 and high ERK1/2 activity was found to be associated with high intracellular H2O2 accumulation, whereas mild treatment of ovarian cancer cells by H2O2 resulted in MKP3 degradation through proteasome/ubiquitination pathway. We have investigated the molecular mechanism by which intracellular H2O2 regulates MKP3 in ovarian cancer cells. Moreover, the decrease or increase of phospho-ERK1/2 levels due to ectopic overexpression of MKP3- or RNAi-mediated MKP3 knockdown indicates that ERK1/2 activity is regulated by MKP3 in ovarian cancer cells. Interestingly, the reduction of ERK1/2 activity by restoration of MKP3 sensitized MKP3-deficient ovarian cancer cells to cisplatin-induced apoptosis and inhibited tumorigenicity of ovarian cancer cells in vitro and in vivo, suggesting that MKP3 possesses tumor-suppressive functions in ovarian cancer. To the best of our knowledge, this is the first study reporting such a regulatory mechanism between ROS and MKP3 expression in human cancers.

Underexpression of MKP3 gene has been reported in pancreatic cancer due to promoter hypermethylation and allelic loss (15). Our study also confirmed that MKP3 gene was underexpressed in some ovarian cancer cell lines. However, as we did not extensively investigate the mechanisms on silencing MKP3 genetically or epigenetically, we do not rule out that there may be other mechanisms causing silencing of expression of MKP3 in ovarian cancer. But the high discrepancy between the MKP3 protein and mRNA levels in ovarian cancer cell lines and cancer tissues indicates that the loss of MKP3 protein relatively predominates and may involve posttranscriptional modifications for MKP3 protein in ovarian cancer cells.

Increased ROS stress is common in cancer cells, which is attributed to the active metabolism from the effect of oncogenic signaling and/or mitochondrial malfunction during development and progression (27–29). Previous studies have shown that the activity of MKP3 is inactivated by low concentration H2O2 in cells (30,31). It is of interest to know whether the frequent loss of MKP3 is due to ROS-mediated degradation in ovarian cancer cells. Our data presented here clearly demonstrated that the intracellular H2O2 content was higher in MKP3-deficient ovarian cancer cells, A2780cp and C13*, and this finding is consistent with other studies (32). As expected, treatment of these cells by an antioxidant, NAC, could restore MKP3. Conversely, treatment of H2O2 on MKP3-sufficient ovarian cancer cells, A2780s and OV2008, could degrade MKP3. As H2O2 is capable of inducing protein ubiquitination/degradation (22,33), we have thus proved the degradation of MKP3 by low concentration of H2O2 was mediated by the ubiquitin–proteasome system using proteasome inhibitor, MG132, and in vivo ubiquitination assay. Although we did not clarify the precise mechanism on MKP3 degradation via ubiquitination/degradation pathways, increasing evidences have demonstrated that phosphorylation of MKP3 is the possible mechanism leading to proteasomal degradation of MKP3 (34,35). Indeed, numerous studies have shown that ROS is able to regulate the phosphorylation and ubiquitination of proteins such as Bcl-2 family proteins (36), p21Waf1/Cip1 (37) and Arg tyrosine kinase (22). We therefore examined whether the phosphorylation of MKP3 is associated with proteasomal degradation by generating point mutations at serines 159 and 197 of MKP3 according to recent reports (34,35). The loss-of-function mutation on these two phosphorylation sites of MKP3 could reduce the level of proteasomal degradation. However, certain level of proteasomal degradation on this mut-MKP3 was still observed, suggesting that there are other phosphorylation sites of MKP3 or interacting partners responsible for MKP3 proteasomal degradation. Recent studies have reported that casein kinase 2-alpha could interact and phosphorylate MKP3 (34,38). Protein casein kinase 2 is a ubiquitous Ser/Thr kinase and plays as anchoring elements and/or as a docking platform for proteins involved in ubiquitination such as the E2 ubiquitin-conjugating enzyme UBC3B (39,40). Therefore, further investigations are needed to investigate the relationship between casein kinase 2-alpha and the phosphorylation and degradation of MKP3. However, the present findings have clearly demonstrated that the frequent loss of MKP3 protein particularly in cisplatin-resistant and highly tumorigenic ovarian cancer cells is due to the accumulation of ROS during the development and progression of ovarian cancer.

It is well known that constitutive activation of ERK-signaling pathway is crucially involved in the development of many cancers, including ovarian cancer. The overexpression of growth factor tyrosine kinase receptors or mutations in the Ras and BRAF gene families has been linked to aberrant activation of ERK pathway (2,41). This has attracted the exploration of anticancer agents targeting these receptors and kinases such as the Raf kinase inhibitor, BAY 43-9006, for the past decade (2). However, there is still a lack of studies on the antitumorigenic functions of the negative regulators of ERK-signaling pathway. Recent studies have identified that MKPs negatively regulate the mitogen-activated protein kinase kinases by dephosphorylation and inactivation of the mitogen-activated protein kinase (9,10). MKP3, one of the MKPs members, was found to specifically bind to and inactivate ERK1/2 in mammalian cells (11–13,42). This means that MKP3 plays an important role in modulating the duration, magnitude and subcellular compartmentalization of ERK1/2 activity through a negative feedback mechanism (43). Therefore, low MKP3 expression may compromise its ability to control ERK1/2 function activated by upstream factors such as tyrosine kinase receptors, mutated Ras or BRAF. Indeed, the loss of MKP3 has been found in pancreatic cancer (14–17). Consistent with these findings, we found that MKP3 was downregulated in ovarian cancer and this led to high levels of ERK1/2 activity. In fact, we have proved in this study that knockdown of endogenous MKP3 increased ERK1/2 activity which in turn enhanced cell proliferation and anchorage-independent growth ability of A2780s ovarian cancer cell line. On the contrary, enforced expression of MKP3 in MKP3-deficient ovarian cancer cells inhibited their cell proliferation rate, anchorage-independent growth ability and tumor growth in nude mice.

Cisplatin is one of the most potent antitumor agents commonly used in ovarian cancer (44). However, the major limitation of using this drug is the acquisition of resistance to initially responsive tumors (45). Many studies have documented that constitutive activation of ERK1/2 is involved in cisplatin resistance in ovarian cancer, whereas inhibition of ERK1/2 activity by PD98059 can increase sensitivity to cisplatin-induced apoptosis (8,46). Similar to these findings, we demonstrated that inhibition of ERK1/2 activity by MKP3 could increase sensitivity of cisplatin-resistant ovarian cancer cells to cisplatin-induced apoptosis and could inhibit tumor growth in nude mice. Interestingly, the enhanced sensitivity by MKP3 overexpression was much more obvious than PD98059 treatment. This suggests that constitutive expression of MKP3 in MKP3 transfectants has a stronger influence on the suppression of ERK1/2 activity and cisplatin resistance.

In conclusion, our results suggest that the loss of MKP3 is a crucial factor in the aberrant activation of ERK1/2 in ovarian cancer. Importantly, our findings indicate the accumulation of intracellular ROS may induce ubiquitination/degradation of MKP3 during the development and progression of ovarian cancer. The understanding of this molecular mechanism may assist the development of new therapeutic interventions for this disease.


   Supplementary material
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
Funding
 References
 
Supplementary Figures S1–S3 can be found at http://carcin.oxfordjournals.org/


   Funding
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
References
 
CRCG of the University of Hong Kong (10207308); Wong Check She Charitable Foundation; Program for Promoting the Establishment of Strategic Research Centers, Special Coordination Funds for Promoting Science and Technology, Ministry of Education, Culture, Sports, Science and Technology of Japan to T.F.


   Acknowledgments
 
We thank Prof. B. K. Tsang (Deptartment of Obstetrics and Gynecology, University of Ottawa) for cisplatin-sensitive (OV2008 and A2780s) and cisplatin-resistant (C13* and A2780cp) ovarian cancer cell lines.

Conflict of Interest Statement: None declared.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 

  1. Chang L, et al. Mammalian MAP kinase signalling cascades. Nature (2001) 410:37–40.[CrossRef][Web of Science][Medline]
  2. Sridhar SS, et al. Raf kinase as a target for anticancer therapeutics. Mol. Cancer Ther. (2005) 4:677–685.[Abstract/Free Full Text]
  3. Kohno M, et al. Targeting the ERK signaling pathway in cancer therapy. Ann. Med. (2006) 38:200–211.[CrossRef][Web of Science][Medline]
  4. Eblaghie MC, et al. Negative feedback regulation of FGF signaling levels by Pyst1/MKP3 in chick embryos. Curr. Biol. (2003) 13:1009–1018.[CrossRef][Web of Science][Medline]
  5. Wakioka T, et al. Spred is a Sprouty-related suppressor of Ras signalling. Nature (2001) 412:647–651.[CrossRef][Web of Science][Medline]
  6. Furthauer M, et al. Sef is a feedback-induced antagonist of Ras/MAPK-mediated FGF signalling. Nat. Cell Biol. (2002) 4:170–174.[CrossRef][Web of Science][Medline]
  7. Steinmetz R, et al. Mechanisms regulating the constitutive activation of the extracellular signal-regulated kinase (ERK) signaling pathway in ovarian cancer and the effect of ribonucleic acid interference for ERK1/2 on cancer cell proliferation. Mol. Endocrinol. (2004) 18:2570–2582.[Abstract/Free Full Text]
  8. Persons DL, et al. Cisplatin-induced activation of mitogen-activated protein kinases in ovarian carcinoma cells: inhibition of extracellular signal-regulated kinase activity increases sensitivity to cisplatin. Clin. Cancer Res. (1999) 5:1007–1014.[Abstract/Free Full Text]
  9. Camps M, et al. Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J. (2000) 14:6–16.[Abstract/Free Full Text]
  10. Keyse SM. Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Curr. Opin. Cell Biol. (2000) 12:186–192.[CrossRef][Web of Science][Medline]
  11. Nichols A, et al. Substrate recognition domains within extracellular signal-regulated kinase mediate binding and catalytic activation of mitogen-activated protein kinase phosphatase-3. J. Biol. Chem. (2000) 275:24613–24621.[Abstract/Free Full Text]
  12. Muda M, et al. The mitogen-activated protein kinase phosphatase-3 N-terminal noncatalytic region is responsible for tight substrate binding and enzymatic specificity. J. Biol. Chem. (1998) 273:9323–9329.[Abstract/Free Full Text]
  13. Zhou B, et al. Multiple regions of MAP kinase phosphatase 3 are involved in its recognition and activation by ERK2. J. Biol. Chem. (2001) 276:6506–6515.[Abstract/Free Full Text]
  14. Furukawa T, et al. Genomic analysis of DUSP6, a dual specificity MAP kinase phosphatase, in pancreatic cancer. Cytogenet. Cell Genet. (1998) 82:156–159.[CrossRef][Web of Science][Medline]
  15. Xu S, et al. Abrogation of DUSP6 by hypermethylation in human pancreatic cancer. J. Hum. Genet. (2005) 50:159–167.[CrossRef][Web of Science][Medline]
  16. Furukawa T, et al. Potential tumor suppressive pathway involving DUSP6/MKP-3 in pancreatic cancer. Am. J. Pathol. (2003) 162:1807–1815.[Abstract/Free Full Text]
  17. Furukawa T, et al. Distinct progression pathways involving the dysfunction of DUSP6/MKP-3 in pancreatic intraepithelial neoplasia and intraductal papillary-mucinous neoplasms of the pancreas. Mod. Pathol. (2005) 18:1034–1042.[CrossRef][Web of Science][Medline]
  18. Chan DW, et al. Prickle-1 negatively regulates Wnt/beta-catenin pathway by promoting dishevelled ubiquitination/degradation in liver cancer. Gastroenterology (2006) 131:1218–1227.[Medline]
  19. Moon SK, et al. Reactive oxygen species mediates disialoganglioside GD3-induced inhibition of ERK1/2 and matrix metalloproteinase-9 expression in vascular smooth muscle cells. FASEB J. (2006) 20:1387–1395.[Abstract/Free Full Text]
  20. Chan DW, et al. Knock-down of hepatitis B virus X protein reduces the tumorigenicity of hepatocellular carcinoma cells. J. Pathol. (2006) 208:372–380.[CrossRef][Web of Science][Medline]
  21. Trachootham D, et al. Selective killing of oncogenically transformed cells through a ROS-mediated mechanism by beta-phenylethyl isothiocyanate. Cancer Cell (2006) 10:241–252.[CrossRef][Web of Science][Medline]
  22. Cao C, et al. Ubiquitination and degradation of the Arg tyrosine kinase is regulated by oxidative stress. Oncogene (2005) 24:2433–2440.[CrossRef][Web of Science][Medline]
  23. Wang F, et al. Effect of hydrogen peroxide on the activity and structure of Escherichia coli chaperone GroEL. Biochemistry (Mosc) (2002) 67:547–552.[CrossRef][Medline]
  24. Hoshino R, et al. Constitutive activation of the 41-/43-kDa mitogen-activated protein kinase signaling pathway in human tumors. Oncogene (1999) 18:813–822.[CrossRef][Web of Science][Medline]
  25. Lee SY, et al. A high nuclear basal level of ERK2 phosphorylation contributes to the resistance of cisplatin-resistant human ovarian cancer cells. Gynaecol. Oncol. (2006) 104:338–344.[CrossRef][Web of Science][Medline]
  26. Fraser M, et al. p53 is a determinant of X-linked inhibitor of apoptosis protein/Akt-mediated chemoresistance in human ovarian cancer cells. Cancer Res. (2003) 63:7081–7088.[Abstract/Free Full Text]
  27. Vafa O, et al. c-Myc can induce DNA damage, increase reactive oxygen species, and mitigate p53 function: a mechanism for oncogene-induced genetic instability. Mol. Cell. (2002) 9:1031–1044.[CrossRef][Web of Science][Medline]
  28. Sattler M, et al. The BCR/ABL tyrosine kinase induces production of reactive oxygen species in hematopoietic cells. J. Biol. Chem. (2000) 275:24273–24278.[Abstract/Free Full Text]
  29. Szatrowski TP, et al. Production of large amounts of hydrogen peroxide by human tumor cells. Cancer Res. (1991) 51:794–798.[Abstract/Free Full Text]
  30. Seth D, et al. Redox regulation of MAP kinase phosphatase 3. Biochemistry (2006) 45:8476–8487.[CrossRef][Web of Science][Medline]
  31. Kim HS, et al. Constitutive induction of p-Erk1/2 accompanied by reduced activities of protein phosphatases 1 and 2A and MKP3 due to reactive oxygen species during cellular senescence. J. Biol. Chem. (2003) 278:37497–37510.[Abstract/Free Full Text]
  32. Wilson LA, et al. ets-1 is transcriptionally up-regulated by H2O2 via an antioxidant response element. FASEB J. (2005) 19:2085–2087.[Abstract/Free Full Text]
  33. Inukai N, et al. A novel hydrogen peroxide-induced phosphorylation and ubiquitination pathway leading to RNA polymerase II proteolysis. J. Biol. Chem. (2004) 279:8190–8195.[Abstract/Free Full Text]
  34. Marchetti S, et al. Extracellular signal-regulated kinases phosphorylate mitogen-activated protein kinase phosphatase 3/DUSP6 at serines 159 and 197, two sites critical for its proteasomal degradation. Mol. Cell Biol. (2005) 25:854–864.[Abstract/Free Full Text]
  35. Bermudez O, et al. Post-translational regulation of the ERK phosphatase DUSP6/MKP3 by the mTOR pathway. Oncogene (2008) 27:3685–3691.[CrossRef][Web of Science][Medline]
  36. Li D, et al. Reactive oxygen species (ROS) control the expression of Bcl-2 family proteins by regulating their phosphorylation and ubiquitination. Cancer Sci. (2004) 95:644–650.[CrossRef][Medline]
  37. Xie S, et al. Proteasome-dependent downregulation of p21(Waf1/Cip1) induced by reactive oxygen species. J. Interferon Cytokine Res. (2002) 22:957–963.[CrossRef][Web of Science][Medline]
  38. Castelli M, et al. MAP kinase phosphatase 3 (MKP3) interacts with and is phosphorylated by protein kinase CK2alpha. J. Biol. Chem. (2004) 279:44731–44739.[Abstract/Free Full Text]
  39. Pinna LA. Protein kinase CK2: a challenge to canons. J. Cell Sci. (2002) 115:3873–3878.[Abstract/Free Full Text]
  40. Semplici F, et al. CK2-dependent phosphorylation of the E2 ubiquitin conjugating enzyme UBC3B induces its interaction with beta-TrCP and enhances beta-catenin degradation. Oncogene (2002) 21:3978–3987.[CrossRef][Web of Science][Medline]
  41. Thompson N, et al. Recent progress in targeting the Raf/MEK/ERK pathway with inhibitors in cancer drug discovery. Curr. Opin. Pharmacol. (2005) 5:350–356.[CrossRef][Web of Science][Medline]
  42. Karlsson M, et al. Both nuclear-cytoplasmic shuttling of the dual specificity phosphatase MKP-3 and its ability to anchor MAP kinase in the cytoplasm are mediated by a conserved nuclear export signal. J. Biol. Chem. (2004) 279:41882–41891.[Abstract/Free Full Text]
  43. Smith TG, et al. Negative feedback predominates over cross-regulation to control ERK MAPK activity in response to FGF signalling in embryos. FEBS Lett. (2006) 580:4242–4245.[CrossRef][Web of Science][Medline]
  44. Ngan HY, et al. A randomized study of high-dose versus low-dose cis-platinum combined with cyclophosphamide in the treatment of advanced ovarian cancer. Hong Kong Ovarian Carcinoma Study Group. Chemotherapy (1989) 35:221–227.[Web of Science][Medline]
  45. Ozols RF. Ovarian cancer: new clinical approaches. Cancer Treat. Rev. (1991) 18(suppl A):77–83.[CrossRef][Web of Science][Medline]
  46. Hayakawa J, et al. Inhibition of extracellular signal-regulated protein kinase or c-Jun N-terminal protein kinase cascade, differentially activated by cisplatin, sensitizes human ovarian cancer cell line. J. Biol. Chem. (1999) 274:31648–31654.[Abstract/Free Full Text]
Received May 2, 2008; revised July 7, 2008; accepted July 9, 2008.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
29/9/1742    most recent
bgn167v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chan, D. W.
Right arrow Articles by Ngan, H. Y.S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, D. W.
Right arrow Articles by Ngan, H. Y.S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?